ID: 934846391

View in Genome Browser
Species Human (GRCh38)
Location 2:97663783-97663805
Sequence GCCGCCGCGTGCGCCCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934846377_934846391 27 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846391 2:97663783-97663805 GCCGCCGCGTGCGCCCCCGGGGG 0: 1
1: 0
2: 4
3: 15
4: 170
934846385_934846391 4 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846391 2:97663783-97663805 GCCGCCGCGTGCGCCCCCGGGGG 0: 1
1: 0
2: 4
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934846391 Original CRISPR GCCGCCGCGTGCGCCCCCGG GGG Intronic