ID: 934847534

View in Genome Browser
Species Human (GRCh38)
Location 2:97671894-97671916
Sequence AATCTGATGTGGGGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934847534_934847547 29 Left 934847534 2:97671894-97671916 CCACACACACCCCACATCAGATT No data
Right 934847547 2:97671946-97671968 GTAGTTTTCTAACCCTCCAGGGG No data
934847534_934847543 -10 Left 934847534 2:97671894-97671916 CCACACACACCCCACATCAGATT No data
Right 934847543 2:97671907-97671929 ACATCAGATTTTGGGGTGTGGGG No data
934847534_934847545 27 Left 934847534 2:97671894-97671916 CCACACACACCCCACATCAGATT No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data
934847534_934847546 28 Left 934847534 2:97671894-97671916 CCACACACACCCCACATCAGATT No data
Right 934847546 2:97671945-97671967 TGTAGTTTTCTAACCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934847534 Original CRISPR AATCTGATGTGGGGTGTGTG TGG (reversed) Intergenic