ID: 934847539

View in Genome Browser
Species Human (GRCh38)
Location 2:97671904-97671926
Sequence CACACCCCAAAATCTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934847539_934847548 27 Left 934847539 2:97671904-97671926 CCCACATCAGATTTTGGGGTGTG No data
Right 934847548 2:97671954-97671976 CTAACCCTCCAGGGGACACTAGG No data
934847539_934847546 18 Left 934847539 2:97671904-97671926 CCCACATCAGATTTTGGGGTGTG No data
Right 934847546 2:97671945-97671967 TGTAGTTTTCTAACCCTCCAGGG No data
934847539_934847547 19 Left 934847539 2:97671904-97671926 CCCACATCAGATTTTGGGGTGTG No data
Right 934847547 2:97671946-97671968 GTAGTTTTCTAACCCTCCAGGGG No data
934847539_934847545 17 Left 934847539 2:97671904-97671926 CCCACATCAGATTTTGGGGTGTG No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934847539 Original CRISPR CACACCCCAAAATCTGATGT GGG (reversed) Intergenic
No off target data available for this crispr