ID: 934847540

View in Genome Browser
Species Human (GRCh38)
Location 2:97671905-97671927
Sequence CCACACCCCAAAATCTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934847540_934847546 17 Left 934847540 2:97671905-97671927 CCACATCAGATTTTGGGGTGTGG No data
Right 934847546 2:97671945-97671967 TGTAGTTTTCTAACCCTCCAGGG No data
934847540_934847545 16 Left 934847540 2:97671905-97671927 CCACATCAGATTTTGGGGTGTGG No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data
934847540_934847548 26 Left 934847540 2:97671905-97671927 CCACATCAGATTTTGGGGTGTGG No data
Right 934847548 2:97671954-97671976 CTAACCCTCCAGGGGACACTAGG No data
934847540_934847547 18 Left 934847540 2:97671905-97671927 CCACATCAGATTTTGGGGTGTGG No data
Right 934847547 2:97671946-97671968 GTAGTTTTCTAACCCTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934847540 Original CRISPR CCACACCCCAAAATCTGATG TGG (reversed) Intergenic