ID: 934847543

View in Genome Browser
Species Human (GRCh38)
Location 2:97671907-97671929
Sequence ACATCAGATTTTGGGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934847533_934847543 14 Left 934847533 2:97671870-97671892 CCTCTTTTTAACAATTGAGACAT No data
Right 934847543 2:97671907-97671929 ACATCAGATTTTGGGGTGTGGGG No data
934847530_934847543 27 Left 934847530 2:97671857-97671879 CCCCTGGGGCAATCCTCTTTTTA No data
Right 934847543 2:97671907-97671929 ACATCAGATTTTGGGGTGTGGGG No data
934847532_934847543 25 Left 934847532 2:97671859-97671881 CCTGGGGCAATCCTCTTTTTAAC No data
Right 934847543 2:97671907-97671929 ACATCAGATTTTGGGGTGTGGGG No data
934847534_934847543 -10 Left 934847534 2:97671894-97671916 CCACACACACCCCACATCAGATT No data
Right 934847543 2:97671907-97671929 ACATCAGATTTTGGGGTGTGGGG No data
934847531_934847543 26 Left 934847531 2:97671858-97671880 CCCTGGGGCAATCCTCTTTTTAA No data
Right 934847543 2:97671907-97671929 ACATCAGATTTTGGGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934847543 Original CRISPR ACATCAGATTTTGGGGTGTG GGG Intergenic
No off target data available for this crispr