ID: 934847545

View in Genome Browser
Species Human (GRCh38)
Location 2:97671944-97671966
Sequence TTGTAGTTTTCTAACCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934847540_934847545 16 Left 934847540 2:97671905-97671927 CCACATCAGATTTTGGGGTGTGG No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data
934847538_934847545 18 Left 934847538 2:97671903-97671925 CCCCACATCAGATTTTGGGGTGT No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data
934847534_934847545 27 Left 934847534 2:97671894-97671916 CCACACACACCCCACATCAGATT No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data
934847539_934847545 17 Left 934847539 2:97671904-97671926 CCCACATCAGATTTTGGGGTGTG No data
Right 934847545 2:97671944-97671966 TTGTAGTTTTCTAACCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934847545 Original CRISPR TTGTAGTTTTCTAACCCTCC AGG Intergenic
No off target data available for this crispr