ID: 934847625

View in Genome Browser
Species Human (GRCh38)
Location 2:97672408-97672430
Sequence CTGCCTGGCAGGTGACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934847621_934847625 0 Left 934847621 2:97672385-97672407 CCTCGGGCAGTCTGCATAGACAA No data
Right 934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG No data
934847616_934847625 22 Left 934847616 2:97672363-97672385 CCCACGGGAGCCATCACAGAGGC No data
Right 934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG No data
934847620_934847625 12 Left 934847620 2:97672373-97672395 CCATCACAGAGGCCTCGGGCAGT No data
Right 934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG No data
934847617_934847625 21 Left 934847617 2:97672364-97672386 CCACGGGAGCCATCACAGAGGCC No data
Right 934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG No data
934847613_934847625 26 Left 934847613 2:97672359-97672381 CCTCCCCACGGGAGCCATCACAG No data
Right 934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG No data
934847614_934847625 23 Left 934847614 2:97672362-97672384 CCCCACGGGAGCCATCACAGAGG No data
Right 934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934847625 Original CRISPR CTGCCTGGCAGGTGACCAGG AGG Intergenic
No off target data available for this crispr