ID: 934849389

View in Genome Browser
Species Human (GRCh38)
Location 2:97687824-97687846
Sequence CTGCCTGGCAGGTGACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934849384_934849389 12 Left 934849384 2:97687789-97687811 CCATCACAGAGGCCTCGGGCAGT No data
Right 934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG No data
934849381_934849389 21 Left 934849381 2:97687780-97687802 CCACGGGAGCCATCACAGAGGCC No data
Right 934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG No data
934849380_934849389 22 Left 934849380 2:97687779-97687801 CCCACGGGAGCCATCACAGAGGC No data
Right 934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG No data
934849377_934849389 26 Left 934849377 2:97687775-97687797 CCTCCCCACGGGAGCCATCACAG No data
Right 934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG No data
934849378_934849389 23 Left 934849378 2:97687778-97687800 CCCCACGGGAGCCATCACAGAGG No data
Right 934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG No data
934849385_934849389 0 Left 934849385 2:97687801-97687823 CCTCGGGCAGTCTGCATAGACAA No data
Right 934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934849389 Original CRISPR CTGCCTGGCAGGTGACCAGG AGG Intergenic
No off target data available for this crispr