ID: 934853397

View in Genome Browser
Species Human (GRCh38)
Location 2:97715024-97715046
Sequence CCACACTGCCCGGCACATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934853392_934853397 17 Left 934853392 2:97714984-97715006 CCTCCCAGGGCTCTCGGGAGGAT 0: 1
1: 0
2: 3
3: 53
4: 340
Right 934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG 0: 1
1: 0
2: 1
3: 27
4: 287
934853391_934853397 18 Left 934853391 2:97714983-97715005 CCCTCCCAGGGCTCTCGGGAGGA 0: 1
1: 0
2: 7
3: 33
4: 371
Right 934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG 0: 1
1: 0
2: 1
3: 27
4: 287
934853393_934853397 14 Left 934853393 2:97714987-97715009 CCCAGGGCTCTCGGGAGGATAAA 0: 1
1: 0
2: 4
3: 15
4: 165
Right 934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG 0: 1
1: 0
2: 1
3: 27
4: 287
934853394_934853397 13 Left 934853394 2:97714988-97715010 CCAGGGCTCTCGGGAGGATAAAG 0: 1
1: 0
2: 1
3: 16
4: 165
Right 934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG 0: 1
1: 0
2: 1
3: 27
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934853397 Original CRISPR CCACACTGCCCGGCACATAC AGG Intronic
900215577 1:1479840-1479862 ACACACCGCCCCGCACACACGGG + Intronic
901096900 1:6688901-6688923 GCACAGTGCCAGGCACATAATGG - Intronic
901390551 1:8943193-8943215 GCACACTGCCAAGGACATACTGG - Intergenic
901460044 1:9385962-9385984 CCACACTGGCCTGGACACACAGG - Intergenic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
903649439 1:24913913-24913935 GCACAGTGCCCGGCACATCATGG - Intronic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
905130338 1:35750678-35750700 CCACCCTGCCCGGCCCAAAAAGG + Intronic
905422241 1:37855667-37855689 CCACCATGCCCGGCCCATCCAGG - Intronic
905867470 1:41383731-41383753 CTCCTCTGCCCGGCACATATTGG + Intergenic
905873448 1:41417836-41417858 CCACACTGCCTCACACATGCTGG - Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
907310215 1:53534789-53534811 GCACACTGCCAGGCACACAGAGG - Intronic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
908498263 1:64717071-64717093 CCTCAATGCCCAGCACATAAAGG + Intergenic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
908847543 1:68340014-68340036 CTACGCTGCCCACCACATACAGG + Intergenic
909554884 1:76942513-76942535 ACACAGTGTCTGGCACATACAGG - Intronic
909603235 1:77482483-77482505 CCACCGTGCCCGGCCCCTACAGG - Intronic
909699544 1:78507202-78507224 CTACTCTGCACGGCACAGACTGG + Intronic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911692631 1:100851663-100851685 TCACAATGCCTGGCACATAGTGG - Intergenic
912200139 1:107447971-107447993 GCACAATGTCTGGCACATACTGG - Intronic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
913664364 1:121033956-121033978 CCACCATGCCCGGCCCATAATGG - Intergenic
914015755 1:143817235-143817257 CCACCATGCCCGGCCCATAATGG - Intergenic
914162028 1:145143773-145143795 CCACCATGCCCGGCCCATAATGG + Intergenic
914935574 1:151976657-151976679 CAACACTGCCCTGCCCATAGTGG + Intergenic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
918100566 1:181369650-181369672 CCACACTGCCCTGGAGACACAGG + Intergenic
919905946 1:202078380-202078402 CCACCCTGCCAGTCACATACAGG + Intergenic
921471836 1:215558601-215558623 CCACTGTTCCCGGCCCATACTGG + Intergenic
922637123 1:227185398-227185420 CCATACTGCCAGGCACATGTGGG - Intronic
1064335925 10:14441226-14441248 TCTCTCTACCCGGCACATACTGG - Intronic
1064364084 10:14691480-14691502 GCTCACTGCCTGGCTCATACTGG - Intronic
1064855880 10:19766743-19766765 CCACTGTGCCCGGCCCCTACTGG - Intronic
1066218455 10:33311561-33311583 TCACAGTGATCGGCACATACTGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1067413405 10:46084885-46084907 CCACCCTGCCCGTCACCTGCAGG - Intergenic
1071404437 10:85316748-85316770 GCACAGTGCCCAGCACATAAAGG - Intergenic
1071506563 10:86235276-86235298 CCACACTGCCAGGTACAGAGAGG - Intronic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1073103806 10:101021049-101021071 GCACAGTGGCCGGCACATAGTGG + Intronic
1074256775 10:111810934-111810956 CCACAATGCCTGGCACTTAGTGG + Intergenic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074784861 10:116829939-116829961 ACATACTGCCCGGCACATTCCGG + Intergenic
1076891039 10:133283578-133283600 CCACACTGCTGGCCACACACGGG - Intronic
1077537396 11:3131005-3131027 CCACACTGCCTGGGACATTCCGG - Intronic
1079639629 11:22788995-22789017 CCACAATTCCTGGCACATAGAGG - Intronic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1083686912 11:64382032-64382054 CCACCGTGCCCGGCACCCACAGG + Intergenic
1084281398 11:68097345-68097367 CCACCGTGCCCGGCCCACACGGG - Intronic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1088533148 11:110832192-110832214 ACACAGTGCCCAGCACAGACAGG - Intergenic
1088684376 11:112272619-112272641 CCACAATGCCTGCCACATATTGG - Intergenic
1089040439 11:115443724-115443746 GCAGACTGCTTGGCACATACTGG - Intronic
1089576248 11:119446526-119446548 CCACACTGCCCCACACCTAGTGG + Intergenic
1090042131 11:123300476-123300498 ACCCAATGCCCTGCACATACAGG + Intergenic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1091717964 12:2793604-2793626 GCACAGTGCCGGGCACATAACGG + Intergenic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1093503080 12:19834727-19834749 CCTCACTGCCCTGCACAGAATGG - Intergenic
1094365375 12:29674311-29674333 CCACAGTGCCCAGCACATAAAGG + Intronic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1096248571 12:50011666-50011688 CCACCATGCCCGGCCCACACCGG - Intronic
1096554806 12:52396809-52396831 CCGCCCTGCACGGCACAGACTGG + Intronic
1100100998 12:91105703-91105725 CCACAGTGCCCAGTACATAGTGG - Intronic
1100573317 12:95863560-95863582 TCACAGTGCCAGGCACATAATGG - Intronic
1104553640 12:129780218-129780240 CCACAGTGCCCAGCACACAGCGG - Intronic
1104945667 12:132413948-132413970 CCTCAGCGCCCGGCACAGACAGG - Intergenic
1105553211 13:21418085-21418107 CCACACTATCTGGCACATAGTGG - Intronic
1106435473 13:29719993-29720015 CCCCAATGCCCAGGACATACAGG - Intergenic
1110559359 13:76893990-76894012 CCACAATGTCTGGCACATAACGG + Intergenic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1114387033 14:22266197-22266219 GCACATTTCCCTGCACATACAGG + Intergenic
1117455262 14:55890543-55890565 GCACAGTGCCCGGCACATCATGG + Intergenic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1119419814 14:74501851-74501873 CCACAATGCCCGGCTCCTGCTGG + Intronic
1119683599 14:76612189-76612211 GTACACTGCCCGGCACGTAGTGG - Intergenic
1119876360 14:78062992-78063014 GTACAATGCCCGGCACATGCAGG - Intergenic
1120544844 14:85798563-85798585 ACACACTGCCAGGGACATATAGG + Intergenic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121691120 14:95877500-95877522 GCACACTGCCCGGCACGGCCTGG - Intergenic
1122052951 14:99072646-99072668 CCTCACTGCCCGGCACTTAGAGG - Intergenic
1122873287 14:104651126-104651148 CCACTGTGCCCGGCAGATGCTGG - Intergenic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1124158997 15:27252393-27252415 CCACACAGCCACCCACATACAGG - Intronic
1126387938 15:48113019-48113041 ACACAGTGCCAGGCACATGCTGG - Intergenic
1126391286 15:48156063-48156085 CCACCATGCCCGGCCCATAATGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1128657148 15:69470632-69470654 CCACTGTGCCCGGCCCAGACTGG + Intergenic
1129120301 15:73392354-73392376 CCACTGTGCCCGGCCCACACTGG - Intergenic
1129383185 15:75180705-75180727 CCTCACTGCCCAGCACCTCCCGG + Intergenic
1129414098 15:75365435-75365457 CCACCGTGCCCGGCTCATCCCGG - Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1130301253 15:82681001-82681023 CCACACTGCCCGCCACCAGCTGG + Exonic
1133639736 16:7705217-7705239 CCACCATGCCCGGCCCACACAGG - Intronic
1134617827 16:15665217-15665239 TCACACTGCCTGGCACATATAGG - Intronic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1136409093 16:30066038-30066060 CCCCACTACCAGGCACACACAGG + Intronic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1139951953 16:70676871-70676893 CCCCACTGACCTGCACATGCTGG + Exonic
1140772618 16:78218748-78218770 CCACACTGCACGGCGCACACTGG - Intronic
1141648177 16:85378388-85378410 CCACACTGCCAGGCGCAGGCTGG - Intergenic
1142480402 17:215245-215267 CCACCCTGCCCTGCACCTGCTGG - Intronic
1142513433 17:411974-411996 CCACACTGCACGGTCCATATGGG - Intronic
1143156682 17:4841812-4841834 CCACCGTGCCCAGCATATACTGG - Intronic
1144873098 17:18382530-18382552 CCGCCATGCCCGGCCCATACTGG - Exonic
1146061584 17:29610466-29610488 CCTCAATGCCTGGCACATAAAGG + Intronic
1146257647 17:31400849-31400871 CCCCACCGCCTGGCACATCCTGG + Intronic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1149424663 17:56543488-56543510 GAACAGTGCCCGGCACATAGTGG + Intergenic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1151046817 17:70930023-70930045 CCATCATGCCCGGCCCATACTGG + Intergenic
1151965115 17:77427189-77427211 CCACACTCACCGGCACTCACAGG - Intronic
1152240385 17:79157754-79157776 CCACCCAGCTCGGCACATGCTGG + Intronic
1152660280 17:81538900-81538922 CCACACCCCCGGGCACACACTGG - Intergenic
1152977555 18:237445-237467 CCACACTGGGCTTCACATACTGG + Intronic
1155996538 18:32336477-32336499 TCACAGTGCCCAGCAAATACTGG + Intronic
1157724018 18:49949151-49949173 CCTCACTGCCCAGCACATGCTGG + Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1160824631 19:1073959-1073981 CCTCACTGCCCGGTCCATACAGG - Exonic
1161156181 19:2732915-2732937 CCACGCTGCCCGGCACGCCCTGG + Exonic
1161271057 19:3389542-3389564 CCACACTGCCTGGAGCACACAGG - Intronic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161594043 19:5142239-5142261 CCTGACTCCCCGGCACACACTGG + Intronic
1162777360 19:12987917-12987939 CCACACTGCCCGCAGCATCCTGG + Intergenic
1164412893 19:28020565-28020587 CCAGGCTGCCCGGCAAATAGAGG - Intergenic
1165208325 19:34210857-34210879 CCACAGTGCCCGGCCTATTCTGG + Intronic
1168074414 19:53971781-53971803 CCACTCTGCCCCTCACATGCTGG - Intronic
1168251017 19:55141982-55142004 CCTCACTGGACGGCACATCCCGG - Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
925916913 2:8613557-8613579 CCACCGTGCCCGGCCCATAGGGG + Intergenic
926133365 2:10319405-10319427 CCAGACTGCCCAGTACATAACGG - Intronic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
930485496 2:52006906-52006928 CCTCACTGCCCGGCACCGGCAGG - Intergenic
934563743 2:95326999-95327021 CCACAGTGCTCGGCACGTGCCGG + Intronic
934775162 2:96932648-96932670 CCACCATGCCCGGCCCATGCTGG - Intronic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
936160664 2:110082014-110082036 CCCCAGTGCCCAGCACATGCTGG + Intergenic
936184000 2:110289340-110289362 CCCCAGTGCCCAGCACATGCTGG - Intergenic
936387993 2:112047590-112047612 CCACTCTGCCCTGCGCATAGTGG + Intergenic
936556303 2:113500626-113500648 CCACCTTGCGCGGCCCATACTGG + Exonic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943102440 2:183504887-183504909 CCACCATGCCCGGCACATTGAGG + Intergenic
943559356 2:189442269-189442291 CAACAATGCCCGGCACATAATGG + Intronic
943613082 2:190057900-190057922 CCAGATTGCCTGGCACATAATGG + Intronic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
946019317 2:216629965-216629987 CCTCACTGCTGGGCACAGACAGG + Intergenic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
947507947 2:230724392-230724414 CCACCGTGCCCGGCCCATAGAGG - Intronic
948784765 2:240346623-240346645 CCCCACAGCCCTGCACATACAGG + Intergenic
1168991081 20:2096131-2096153 CCAAACTGCCTTGCACATAGAGG + Intergenic
1170464459 20:16610255-16610277 CCACTGTGCCCAGCACATCCTGG - Intergenic
1170882024 20:20305127-20305149 CCACACTTCCCCGCACACGCCGG + Intronic
1171455856 20:25271784-25271806 CCTCACTGCCCGGCTGCTACTGG - Intronic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172573140 20:35985911-35985933 TCACACTGCCAGACACATGCAGG + Intronic
1172718177 20:36979373-36979395 CCACCATGCCCGGCCGATACAGG + Intergenic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1175463951 20:59176977-59176999 CAACACAGCCAGGCCCATACTGG + Intergenic
1176067193 20:63204239-63204261 CCTCACGGCCCTGCACATCCTGG - Intronic
1176123790 20:63466148-63466170 CCAAACTACCCGGCACACACAGG + Intronic
1176293797 21:5059936-5059958 CCCCCCTGCCCGCCACAAACGGG + Intergenic
1179863462 21:44203712-44203734 CCCCCCTGCCCGCCACAAACGGG - Intergenic
1180252420 21:46597991-46598013 CCACACTGCCTGGGACAGGCAGG + Intergenic
1181235273 22:21444749-21444771 CCACAATGCCCACCACATGCAGG - Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182008872 22:26983823-26983845 CCTCACTCTCCGGCACATACAGG - Intergenic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1185042361 22:48511688-48511710 TCACCCGGCCCGGCACACACAGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950026742 3:9825438-9825460 TCACAATGCCTGGCACATAGTGG + Intronic
950459892 3:13115020-13115042 CCCCCCTGCCCGGCACCTCCAGG - Intergenic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
952893301 3:38059098-38059120 CCCCACTGACCTGCAGATACAGG - Intronic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
962458866 3:135590812-135590834 CCATACTGCCAGGCACATGTGGG - Intergenic
962551875 3:136501892-136501914 CCACTGTGCCCGGCCTATACTGG - Intronic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
967036162 3:185649642-185649664 CCACACTCCCTGGGACACACAGG + Intronic
968149441 3:196325485-196325507 CCACCGTGCCCGGCCCATATTGG + Intronic
968668580 4:1835155-1835177 CCACTGTGCCCGGCCCACACGGG - Intronic
968907521 4:3461611-3461633 CCACACAGCCTGGAACACACAGG - Intergenic
969612841 4:8236724-8236746 CCACTCAGCCTGGCACATGCAGG - Intronic
970173251 4:13309984-13310006 GCACAGTGCCCAGCACATAGTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970844706 4:20522828-20522850 CCAGACTGCCCAGCACATACTGG - Intronic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
976402081 4:84618779-84618801 CCCCACTGCCCTGCACACACTGG - Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
981177035 4:141693440-141693462 CCATAGTGCCTGACACATACGGG + Intronic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984938082 4:184907197-184907219 CCCTAGTGCCCAGCACATACTGG - Intergenic
985038332 4:185863263-185863285 CGACATTGCCTGGCACACACAGG - Intronic
986265297 5:6185305-6185327 CCACAGTGCCCGGCCCACAATGG + Intergenic
986793091 5:11182293-11182315 CCACACAGACCAGCACATGCAGG - Intronic
988411560 5:30892543-30892565 CCACAGTGCCCAGCACATAGTGG - Intergenic
991019562 5:61965796-61965818 CCACACTGCCTGGGACCCACGGG + Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
994313839 5:98308892-98308914 GAACAGTGCCCAGCACATACAGG - Intergenic
996624249 5:125550957-125550979 CCACCGTGCCCGGCCCATCCCGG - Intergenic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998667251 5:144312069-144312091 GCAAAGTGCCCGGCACCTACAGG - Intronic
999212220 5:149899757-149899779 ACACACTGCCTGACACACACTGG - Intronic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1001741472 5:174056340-174056362 GCACAGTGCCAGGCACATAGTGG + Intronic
1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG + Intronic
1002688309 5:181032562-181032584 CCACACCGGCCGGCGCCTACTGG + Intergenic
1003592259 6:7446053-7446075 CCACCCTGCACGGCACCTCCTGG + Intergenic
1004522114 6:16371864-16371886 CCACCATGCCCAGCCCATACAGG + Intronic
1004703935 6:18105109-18105131 CCACACTGCATGACACAGACTGG - Intergenic
1006375350 6:33668776-33668798 CCACAGTGCCAGGCACACAGCGG - Intronic
1006898190 6:37484004-37484026 TCCCACTGCCCAGCACAGACAGG - Intronic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013288279 6:108698892-108698914 CCCCACTCCCCAGCACATTCTGG - Intergenic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1015866262 6:137729795-137729817 GCACAGTGCACGGCACATAGTGG - Intergenic
1016902397 6:149115298-149115320 GGACACTGCCTGGCACATCCTGG + Intergenic
1016932922 6:149427441-149427463 CCACACTGCCCTGCACAGTGTGG + Intergenic
1016985961 6:149896137-149896159 GCATACTGCCCGGCACACAGAGG - Intronic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018905855 6:168075519-168075541 CCTCACTTCCCGGCACTCACAGG - Intronic
1018999189 6:168734073-168734095 CAACACTGCCATGCACATCCTGG + Intergenic
1019917638 7:4143919-4143941 CTACACTGCTAGGCACATCCAGG - Intronic
1021918156 7:25456024-25456046 CCGCCCGGCCCGGCACAGACTGG - Intergenic
1022044601 7:26612854-26612876 CCATACTGCACAACACATACAGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1023670732 7:42573553-42573575 ACACAGTGTCAGGCACATACTGG + Intergenic
1023866734 7:44241964-44241986 CCACTCTGCCCCTCACAGACAGG + Intronic
1024216521 7:47253729-47253751 CCACACTGCCCCGGAGACACAGG - Intergenic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1030147217 7:106368909-106368931 TCACACTGCCAGGCACGTAATGG - Intergenic
1030288696 7:107850900-107850922 CCATACTGCCCTACCCATACTGG - Intergenic
1031030332 7:116727428-116727450 CCTCAGTGCCTGGCACATTCTGG + Intronic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033543776 7:142381383-142381405 TCACACTGCCCGGCACCCATTGG - Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1034475234 7:151277764-151277786 CCACAGTGCCCAGCACAGAGGGG + Intronic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1035369002 7:158366949-158366971 CGGCACTGCCCAGCACAGACAGG - Intronic
1035635018 8:1138063-1138085 CCACACTGCCCCGCTGACACCGG + Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1038601348 8:28946238-28946260 CCACCGTGCCCGGCCCATAGGGG + Intronic
1039064486 8:33597275-33597297 CCAGTCTGCCCGATACATACTGG + Exonic
1039587295 8:38718034-38718056 CCACCCTGCCCACCACAAACAGG - Intergenic
1039880601 8:41623147-41623169 CCTCACTGCCCGGCCCGCACAGG - Exonic
1039963543 8:42268097-42268119 CCACAGTGCCCAGCACATATAGG + Intergenic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1041914428 8:63125733-63125755 GGACACTGCCTGGCACATAAGGG + Intergenic
1043458683 8:80437858-80437880 TCACAGGGCCTGGCACATACTGG - Intergenic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045378073 8:101595135-101595157 GGACACTGCCTGGCACATAGAGG + Intronic
1045663196 8:104459455-104459477 CCACAATGCCTGGCACTTAGTGG + Intronic
1046089138 8:109478280-109478302 CCAAAATGCCTGGCACATAGTGG - Intronic
1046131099 8:109969557-109969579 CCACCGTGCCCGGCCCATAATGG - Intronic
1046336070 8:112788664-112788686 TCACAATGCCTGGCACATAGAGG + Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1049716965 8:144097604-144097626 CCACACTGCATGGGACATCCTGG - Intergenic
1049879045 8:145049541-145049563 GCACACTACCAGGCACATAGGGG - Intergenic
1049896720 9:116738-116760 CCACCTTGCGCGGCCCATACTGG - Exonic
1050270050 9:3934002-3934024 ACACAGTGCCCAGCACATCCCGG - Intronic
1050322591 9:4468167-4468189 CCACTCTGCCCGTCACTTTCAGG - Intergenic
1051103213 9:13546918-13546940 CCACACTGCCCAACACACACTGG - Intergenic
1051259080 9:15244368-15244390 CCACACTGCCCGCCAGTGACTGG - Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1054442785 9:65282934-65282956 CCACCTTGCGCGGCCCATACTGG - Exonic
1054487493 9:65738567-65738589 CCACCTTGCGCGGCCCATACTGG + Exonic
1054688533 9:68304376-68304398 CCACCTTGCGCGGCCCATACTGG + Exonic
1056708992 9:88975573-88975595 CCACTGTGCCCGGCAGTTACTGG - Intergenic
1057171333 9:92965024-92965046 CCACACTGCCAGGCACAGCACGG - Intronic
1058372341 9:104284434-104284456 AAACACTGCCTGGCACATAGTGG + Intergenic
1059609849 9:115880672-115880694 GCACAGGGCCAGGCACATACTGG + Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1061033077 9:128098581-128098603 CCCCGATGACCGGCACATACAGG - Intronic
1061801764 9:133116663-133116685 CTACAGTGCCCAGCACATGCGGG + Intronic
1062207543 9:135345700-135345722 GCACATAGCCAGGCACATACAGG - Exonic
1185790325 X:2924319-2924341 CCACCGTGCCCGGCCCACACAGG + Intronic
1187247180 X:17563283-17563305 CCTCAATGCCTGGCACATAGGGG + Intronic
1188705817 X:33328481-33328503 CCACCACGCCCGGCCCATACAGG + Intronic
1190454614 X:50615574-50615596 GCACAGTGCCCGGCACACAGTGG + Intronic
1190683610 X:52851208-52851230 CCACTCTTCCCAGCACAGACAGG + Intergenic
1190775081 X:53546194-53546216 CCCCGCTGCCCGGCACACAGTGG - Intronic
1190969607 X:55335832-55335854 CCACAGTGCCCGGCCTATATGGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1198037667 X:132817665-132817687 GCACAGTGCCCGACACATAATGG - Intronic
1199600297 X:149537738-149537760 CCCCACTGCCCAGCACACCCAGG + Intergenic
1199650287 X:149942202-149942224 CCCCACTGCCCAGCACACCCAGG - Intergenic