ID: 934853524

View in Genome Browser
Species Human (GRCh38)
Location 2:97715619-97715641
Sequence GTCTCCTAATAGACATTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934853521_934853524 -9 Left 934853521 2:97715605-97715627 CCCAGCTCTCCAGGGTCTCCTAA 0: 1
1: 0
2: 2
3: 19
4: 233
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853515_934853524 2 Left 934853515 2:97715594-97715616 CCCCGCACCAGCCCAGCTCTCCA 0: 1
1: 0
2: 1
3: 66
4: 424
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853522_934853524 -10 Left 934853522 2:97715606-97715628 CCAGCTCTCCAGGGTCTCCTAAT 0: 1
1: 0
2: 2
3: 50
4: 258
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853516_934853524 1 Left 934853516 2:97715595-97715617 CCCGCACCAGCCCAGCTCTCCAG 0: 1
1: 0
2: 8
3: 82
4: 598
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853513_934853524 8 Left 934853513 2:97715588-97715610 CCCTGACCCCGCACCAGCCCAGC 0: 1
1: 0
2: 5
3: 46
4: 542
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853517_934853524 0 Left 934853517 2:97715596-97715618 CCGCACCAGCCCAGCTCTCCAGG 0: 1
1: 0
2: 2
3: 54
4: 562
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853514_934853524 7 Left 934853514 2:97715589-97715611 CCTGACCCCGCACCAGCCCAGCT 0: 1
1: 0
2: 3
3: 56
4: 543
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124
934853520_934853524 -5 Left 934853520 2:97715601-97715623 CCAGCCCAGCTCTCCAGGGTCTC 0: 1
1: 0
2: 14
3: 106
4: 512
Right 934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934853524 Original CRISPR GTCTCCTAATAGACATTTGC TGG Intronic
900846246 1:5103982-5104004 GTCTCCTCAAATAAATTTGCAGG - Intergenic
904155914 1:28483006-28483028 GTCTTCTAATAGACACTTTTTGG + Intronic
904391205 1:30187369-30187391 TTCTGCTAACAGACATTTTCTGG - Intergenic
904408021 1:30306375-30306397 TTTTCCTAATAGCCAGTTGCAGG + Intergenic
904871606 1:33622540-33622562 GTCTCCTCATAGCCATCTTCAGG + Intronic
908916108 1:69128410-69128432 GTCTATTTTTAGACATTTGCAGG - Intergenic
909239951 1:73199796-73199818 ATTTCTTTATAGACATTTGCTGG - Intergenic
912048486 1:105491353-105491375 TTATCCTAATAATCATTTGCTGG + Intergenic
914797842 1:150936599-150936621 GTCTCCTGATGCACATGTGCAGG + Intronic
915135759 1:153730171-153730193 GACTGCAAGTAGACATTTGCTGG - Intronic
916852619 1:168719063-168719085 TTCTTCTATTAAACATTTGCTGG - Intronic
917772982 1:178300577-178300599 GTCTCATAAAAGTCATATGCTGG + Intronic
1063814383 10:9756103-9756125 ATCTCATAATGGAGATTTGCTGG + Intergenic
1066761684 10:38760489-38760511 GTCTCCTATTCTACATGTGCAGG + Intergenic
1066959903 10:42211932-42211954 GTCTCCTATTCTACATGTGCAGG - Intergenic
1068508236 10:57930035-57930057 GTCTCCTAGTAGACAGATGTTGG + Intergenic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1074309632 10:112311195-112311217 GTCTCCAAATAGACAGTATCTGG + Intergenic
1074906384 10:117867824-117867846 GTCTTCTAAGAGACATTGCCAGG - Intergenic
1075285973 10:121186335-121186357 TTCTCCTCAGAGACATTTCCCGG + Intergenic
1076785366 10:132747063-132747085 GTCTCCCAAAAGGCATCTGCGGG - Intronic
1077451761 11:2652605-2652627 GTCTCCCAAGACACATTTTCAGG - Intronic
1079241139 11:18722911-18722933 GTCACATAAAAGACATCTGCAGG - Intronic
1084925989 11:72511813-72511835 GACTCCTATTATACATTTGTTGG + Intergenic
1087577832 11:100011689-100011711 GTTCCCTAATAGGCATTTGATGG - Intronic
1090034153 11:123233697-123233719 GTCTCCTAATTGAAATTCCCTGG - Intergenic
1090760099 11:129829021-129829043 GTCACCTGCTAGACATTTTCAGG + Intronic
1091928930 12:4379144-4379166 CTCTCCTAATTAGCATTTGCTGG - Intronic
1097814184 12:64054160-64054182 TTCTCCCTATAAACATTTGCAGG + Intronic
1101476037 12:105049430-105049452 GTCTCCTAAAATGCATGTGCTGG + Intronic
1101549627 12:105749976-105749998 GTCTGGCAATAGACATTTGGGGG + Intergenic
1102522402 12:113486687-113486709 TTCTCCTAATAGATGTTTGTTGG - Intergenic
1105247203 13:18665047-18665069 GTCTCCAAAGGAACATTTGCAGG - Intergenic
1106685694 13:32056390-32056412 CCCTCCTAATACACATTTTCAGG + Intronic
1107821722 13:44291903-44291925 GTCTCTCAACAGACATTTGTTGG - Intergenic
1122171562 14:99880259-99880281 GTCTCCTCTTAGGCAATTGCTGG + Intronic
1202933036 14_KI270725v1_random:56846-56868 GTCTCCTATTCTACATGTGCAGG + Intergenic
1128447968 15:67781561-67781583 GTCTACCGAGAGACATTTGCTGG + Intronic
1131087576 15:89589465-89589487 GGCTCCTGCTTGACATTTGCTGG + Intronic
1132946542 16:2534704-2534726 GGCTCCCAATATACATTCGCTGG - Intergenic
1132969168 16:2676922-2676944 GGCTCCCAATATACATTTGCTGG + Intergenic
1136936256 16:34468431-34468453 GCCTCCTAATAGTGATTTTCAGG + Intergenic
1136963564 16:34880139-34880161 GCCTCCTAATAGTGATTTTCAGG - Intergenic
1141288041 16:82690974-82690996 GTGTCTTTATAGACATTGGCTGG - Intronic
1154250182 18:12737790-12737812 GTTTCCTAACAGACATTTGGTGG - Intergenic
1154441640 18:14394074-14394096 GTCTCCAAAGGAACATTTGCAGG + Intergenic
1156088084 18:33432343-33432365 CTCTACTAATATACTTTTGCTGG - Intronic
1159007428 18:63025209-63025231 GTCTCCTAATTGATATTCTCTGG - Intergenic
1166204153 19:41258066-41258088 GTCTCCTCTGAGATATTTGCAGG + Intronic
924998369 2:384634-384656 CTCTACTAATAAACATTAGCTGG + Intergenic
925228960 2:2213453-2213475 GTCTCCTCATAGACTTGTGCTGG - Intronic
925263741 2:2549922-2549944 GTCCCCTAATTTATATTTGCTGG + Intergenic
925809394 2:7684284-7684306 ATCTGCTATTAAACATTTGCAGG - Intergenic
926199934 2:10787650-10787672 GGCATCTAATAAACATTTGCTGG + Intronic
929218363 2:39438303-39438325 ACTTCCCAATAGACATTTGCAGG + Intergenic
931726965 2:65120768-65120790 CTCTCCTTATAGATATTTTCTGG - Intronic
933361300 2:81289091-81289113 GGGACCTAATAGACATATGCAGG - Intergenic
934324995 2:92005156-92005178 GTCTCCTATTCTACATGTGCAGG + Intergenic
934463376 2:94235868-94235890 GTCTCCTATTCTACATGTGCAGG + Intergenic
934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG + Intronic
935259313 2:101341486-101341508 GCCTCCTAACAGACATTTTCAGG - Intergenic
940684275 2:156826808-156826830 GTATTCTAATAGTCATTTACTGG + Intergenic
940885885 2:158988899-158988921 GCTTCCTAATAGGCATTTCCTGG + Intronic
941345016 2:164357537-164357559 GTCTCATAATAAAAATTTTCTGG + Intergenic
941775287 2:169386875-169386897 TTCTCCTAAGAGAGATTTTCTGG - Intergenic
1170032041 20:11954157-11954179 GCCACCTATGAGACATTTGCAGG + Intergenic
1171761852 20:29209068-29209090 GTCTCCAAATATCCACTTGCAGG - Intergenic
1172757402 20:37295857-37295879 GTCTCCTAGTTGAGATCTGCAGG + Intronic
1174101605 20:48130647-48130669 AGCTCCTGGTAGACATTTGCTGG + Intergenic
1176454420 21:6897100-6897122 GTCTCCAAAGGAACATTTGCAGG - Intergenic
1176594421 21:8678919-8678941 GTCTCCTATTCTACATGTGCAGG + Intergenic
1176832593 21:13762148-13762170 GTCTCCAAAGGAACATTTGCAGG - Intergenic
1180277274 22:10656053-10656075 GTCTCCTATTCTACATGTGCAGG + Intergenic
1180584500 22:16874941-16874963 GTCTCCTATTCTACATGTGCAGG + Intergenic
1185108020 22:48885317-48885339 GTCTCCCAACAGACAATTCCCGG + Intergenic
951329949 3:21354693-21354715 GGCTACTAATAGGCATTTACTGG + Intergenic
956953007 3:74303727-74303749 CTGTCCTTAAAGACATTTGCTGG + Intronic
957353216 3:79052549-79052571 AACTCCTAATAGAAACTTGCTGG + Intronic
957421200 3:79974059-79974081 GCCTCTTAATAAACACTTGCAGG + Intergenic
958210796 3:90471779-90471801 ATCTCCTAGTGGACATTTGGAGG - Intergenic
960302499 3:116020990-116021012 GTCTCCTAATGAAGATTTGCAGG - Intronic
964213788 3:154256656-154256678 GTTTCCAAATAGAAATTAGCTGG + Exonic
966413338 3:179665334-179665356 GACTCATAATAGACACTTGACGG - Intronic
967905583 3:194497018-194497040 TTCTATTAATACACATTTGCAGG - Intronic
970233121 4:13931583-13931605 GTCTGCTAACAAACAGTTGCTGG + Intergenic
971718339 4:30210507-30210529 GTTTCATAATAAACATTTGTTGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972873875 4:43333713-43333735 GTCTCTTAAAAGACATTTATTGG - Intergenic
974891220 4:67886426-67886448 GTGTGTTAATACACATTTGCAGG - Intergenic
975756783 4:77579150-77579172 GTCTCCAAACTGACATTTGTTGG + Intronic
976511272 4:85911774-85911796 GACTCCCAATAATCATTTGCAGG - Intronic
977301912 4:95277435-95277457 GTCTCCTAATAATCATTTAAAGG + Intronic
979005437 4:115289342-115289364 GTCTCCTAGTAGACACTTAATGG - Intergenic
981622193 4:146714429-146714451 GCAGCCTAATAGACATTTACTGG + Intronic
983796689 4:171872935-171872957 ATCTATTAATAGACATTTACTGG - Intronic
986553712 5:8987980-8988002 TTCTTCTAATAGTCATTTGGTGG + Intergenic
988042391 5:25906112-25906134 GTCTCCTAATAAATATATGTTGG - Intergenic
988441762 5:31241769-31241791 GTCCACTAATAGACCTTTGGAGG + Intronic
994146237 5:96398765-96398787 GTCTCCTAATAGATATTTTCAGG - Intronic
1005290330 6:24373258-24373280 GTCTCCTGATGCACATGTGCAGG - Intergenic
1006258420 6:32849215-32849237 GTCTCCTAAGTGACATCGGCAGG + Intronic
1019849979 7:3545162-3545184 GACGCCTAACAGACCTTTGCTGG + Intronic
1020835548 7:13145913-13145935 TTCTCCTAGTATACATGTGCTGG + Intergenic
1024535444 7:50427151-50427173 TTTTCCTAAAAGGCATTTGCAGG + Intergenic
1024730599 7:52249776-52249798 GTCTTCTCCTAGACATTTTCTGG - Intergenic
1025530592 7:61877086-61877108 TTCTGCTAATGGACATTTGGGGG - Intergenic
1026659535 7:72287836-72287858 GTCTCTTCATATATATTTGCAGG + Intronic
1031516264 7:122702752-122702774 GTCTCTTAATAGACAAATGGAGG - Exonic
1031755918 7:125642370-125642392 GACTCCTATTATCCATTTGCTGG - Intergenic
1032799222 7:135305147-135305169 GTCTCCAAAGACACATTTCCTGG + Intergenic
1034999182 7:155597795-155597817 CTTTCCTAATAGCCATTTGATGG + Intergenic
1038371750 8:27000773-27000795 TTCTTATAATACACATTTGCTGG + Intergenic
1039182966 8:34887103-34887125 GCCTCCTAATTGAGATCTGCTGG + Intergenic
1040118498 8:43653043-43653065 GTCTTCAAAAAGACATTTGGGGG + Intergenic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1045037971 8:98191772-98191794 ATCTGCTAAGACACATTTGCAGG - Exonic
1046365239 8:113220725-113220747 GTCTGCTAAAAAACATTTTCAGG - Intronic
1048033863 8:130658307-130658329 TTCTCCTACAAGTCATTTGCAGG - Intergenic
1050890252 9:10816499-10816521 TTCTCCTAATAGCTATTTTCTGG - Intergenic
1051868697 9:21711757-21711779 GTCTTCTAAGAGACATTCACAGG - Intergenic
1053940429 9:43242904-43242926 GTCTCCTATTCTACATGTGCAGG + Intergenic
1055189032 9:73495027-73495049 TTCTCCCAATAGACATTGGATGG - Intergenic
1057278069 9:93686759-93686781 GTGTCCTAATCCACATCTGCAGG - Intergenic
1203400658 Un_KI270519v1:91083-91105 CACTCCAAATATACATTTGCAGG - Intergenic
1191568646 X:62576263-62576285 CTCTCCAAATATCCATTTGCAGG - Intergenic
1191568854 X:62579995-62580017 GGCTCCAAATAGCCACTTGCCGG - Intergenic
1191572598 X:62649333-62649355 CTCTCCTAATATCCATTTGCAGG - Intergenic
1191572780 X:62653081-62653103 GTCTCCTAACATCCATTTGCAGG - Intergenic
1201500628 Y:14639078-14639100 GTCACCTTCTAGAGATTTGCAGG - Intronic
1202101737 Y:21315901-21315923 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202187562 Y:22202869-22202891 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202188511 Y:22215689-22215711 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202203798 Y:22383527-22383549 GTCTTCTAATGGAAATGTGCTGG + Intronic