ID: 934853752

View in Genome Browser
Species Human (GRCh38)
Location 2:97716723-97716745
Sequence GTGGTGATGGGCATCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934853740_934853752 10 Left 934853740 2:97716690-97716712 CCCGTGTGGCTGGAGGGGAGTGA 0: 1
1: 35
2: 126
3: 407
4: 1149
Right 934853752 2:97716723-97716745 GTGGTGATGGGCATCATGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 163
934853741_934853752 9 Left 934853741 2:97716691-97716713 CCGTGTGGCTGGAGGGGAGTGAG 0: 1
1: 4
2: 54
3: 130
4: 633
Right 934853752 2:97716723-97716745 GTGGTGATGGGCATCATGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934853752 Original CRISPR GTGGTGATGGGCATCATGAA GGG Intronic
902111608 1:14083470-14083492 GAGATGATGAGCAACATGAATGG + Intergenic
902512099 1:16972123-16972145 GTGATGATGGGGATAAAGAATGG + Intronic
903476951 1:23626145-23626167 GTGGTGATGGTGATGATGATGGG + Intronic
904440230 1:30525200-30525222 GGTGTGAGGGGCATCAGGAATGG + Intergenic
905355840 1:37383829-37383851 ATTGTGATGGGTATGATGAAGGG - Intergenic
910066646 1:83161322-83161344 ATGGTGATGGGCCTCTTGGATGG - Intergenic
912756945 1:112332588-112332610 GTGGTGATGAGCTCCAGGAAAGG - Intergenic
913326819 1:117634974-117634996 GTGGTGAGGGGCATGGTGGAAGG - Intergenic
915002135 1:152603237-152603259 ATTGTGAGGGGCAGCATGAATGG - Intergenic
916654586 1:166863010-166863032 GTGGTGATGGAGAACATGAATGG - Intronic
919965227 1:202516483-202516505 GTGGGGCTGGGGAGCATGAAAGG + Intronic
921300229 1:213744956-213744978 GTGGTGAGAGGCACCTTGAAGGG - Intergenic
921354518 1:214273822-214273844 GAGGGCATGGGCCTCATGAATGG - Intergenic
923987093 1:239393507-239393529 GAGGTGATGGGAATCTGGAATGG + Intronic
924934186 1:248754722-248754744 GGGGTCATTGGCATCATGTATGG - Intronic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069903738 10:71720291-71720313 GGGGTGAGGGGCATCTTCAAAGG + Intronic
1069942777 10:71966238-71966260 CTGGAGATGGGTCTCATGAAGGG + Intronic
1070580722 10:77717159-77717181 GTGGTGATGGGCCTGATGGGAGG + Intergenic
1074668624 10:115761024-115761046 GTTGTGTTGTGCAGCATGAAAGG - Intronic
1075591655 10:123695973-123695995 GTGGTAATGGGCATCAGGCAAGG - Intergenic
1075629189 10:123990879-123990901 TTGGTGATTTTCATCATGAAGGG + Intergenic
1075715428 10:124552514-124552536 GCAGTGAGGGGCATCATTAATGG + Intronic
1075904536 10:126069630-126069652 GTGGTGGTGGGGATAATGATAGG + Intronic
1076947248 10:133659777-133659799 GTGGTGGTGACCCTCATGAATGG + Intergenic
1077157103 11:1096796-1096818 GTGGTGATGGGTGTCATGGTTGG - Intergenic
1077157383 11:1097762-1097784 GTGGTGATGGGTGTCATGGTTGG - Intergenic
1077157567 11:1098393-1098415 GTGGTGATGGGTGTCATGGTTGG - Intergenic
1077157607 11:1098531-1098553 GTGGTGATGGGTGTCATGGTTGG - Intergenic
1077157709 11:1098876-1098898 GTGGTGATGGGTGTCATGGTTGG - Intergenic
1077157942 11:1099704-1099726 GTGCTGATGGGTATCATGGTTGG - Intergenic
1077283225 11:1754720-1754742 GAGGTGATGGGGAGCATGGAGGG + Intronic
1077930589 11:6727947-6727969 GTGGTGAGGGGGATGATGAGGGG + Intergenic
1079493952 11:21019807-21019829 GAGGTGATGAGCACCCTGAATGG + Intronic
1079495706 11:21041499-21041521 GTGGTTGTGAGCATCATGAAAGG - Intronic
1080419430 11:32096828-32096850 CTGGTGATGGCCATTATCAACGG - Intronic
1081332195 11:41817391-41817413 GTTGTGATGGCCTTTATGAAAGG + Intergenic
1081653955 11:44844884-44844906 GTGGTGATGAGCACCAGGCAAGG - Intronic
1083678477 11:64340736-64340758 CGGGTGCTGGGCATCATGTAAGG + Exonic
1085534422 11:77209514-77209536 GTGGGGAGGGGCATGAGGAAAGG - Intronic
1086236325 11:84635318-84635340 GTGGTAATGGGCATCAGTATTGG - Intronic
1086460338 11:86999498-86999520 GTGTTTAAGGGCAACATGAATGG + Intergenic
1088397126 11:109381472-109381494 GTGGTGTTGGGGAGCAAGAAAGG + Intergenic
1089955650 11:122568679-122568701 GTGGAGTTGGGCAACATCAAGGG - Intergenic
1095909802 12:47414669-47414691 GGGGTGATTAGCATCATGCAGGG + Intergenic
1097055629 12:56247581-56247603 CTGATGCTGGCCATCATGAATGG - Exonic
1098442097 12:70529754-70529776 GGGTTGATGGGGATAATGAAGGG + Intronic
1103705420 12:122868613-122868635 GCCGTGGTTGGCATCATGAAGGG - Intronic
1106118662 13:26838864-26838886 ATGGAGAAGGTCATCATGAAGGG + Intergenic
1106526317 13:30544021-30544043 CTGGGGATGGGCATCTGGAATGG + Intronic
1107966774 13:45604392-45604414 ATGGAGATGGGCAGCATGAGGGG - Intronic
1108009101 13:45985496-45985518 GTAGTCATGGGCATCACGAGTGG + Exonic
1108226251 13:48292860-48292882 CTGCTGATGGGAATCAAGAAAGG + Intergenic
1110098659 13:71566357-71566379 GTGGTGGCTGGCATCATAAAAGG - Intronic
1112125938 13:96468264-96468286 GATGTGCTGGGCATCTTGAATGG + Intronic
1113421824 13:110176911-110176933 GTGGACATGGGCAGCATGAAGGG - Exonic
1113887703 13:113669780-113669802 CTGGTGATGACCATCATGAACGG + Exonic
1115957851 14:38801535-38801557 GTGGTGATGGGCCTCTGGCAGGG - Intergenic
1118500501 14:66357983-66358005 GTGGTGCAGGGCAGCATGGAGGG - Intergenic
1119860237 14:77930949-77930971 GTGGCGATGACCAGCATGAAGGG + Intronic
1122008993 14:98730225-98730247 GTGGTTTTGGGCATCAGGGAAGG - Intergenic
1122748397 14:103914676-103914698 GTGGTGTTGGGCATAGTGACGGG + Intronic
1125132630 15:36301775-36301797 GTGGTGTTGGGAAGCATGAATGG - Intergenic
1128364538 15:66988391-66988413 GTGGTGATGGACATGGGGAAAGG + Intergenic
1128818216 15:70629697-70629719 GAGGTGATGGGGATCAGGGAAGG - Intergenic
1132124699 15:99212638-99212660 GTTGCGATGGGCACCATAAAAGG + Intronic
1132576705 16:667605-667627 GTGGTGGTGGGCATCACGCCTGG + Exonic
1134595940 16:15496015-15496037 GTGGTGATGGTGATGATGAAAGG + Intronic
1134778680 16:16875681-16875703 GTAGAGATGGGCTGCATGAACGG + Intergenic
1137777315 16:51066664-51066686 GAGGTTATGGGCATCATCAGAGG + Intergenic
1139638628 16:68274883-68274905 CTGGTGGTGGGCAACATGATCGG + Exonic
1143720096 17:8803295-8803317 GTGTTGATGGGCATCAGAAGGGG + Exonic
1143825156 17:9599695-9599717 GTGTTCATGGGCATCATTCAGGG + Intronic
1145979054 17:29000996-29001018 GTGCTGATGGCCATTCTGAATGG - Intronic
1146228800 17:31090702-31090724 GGGGTGGTGGGCAGAATGAAGGG + Intergenic
1146491099 17:33282982-33283004 GAGGTCATGGGCATCTTTAAGGG + Intronic
1147445295 17:40471531-40471553 GTGGGGATGGGGAACATGACCGG + Intergenic
1147766368 17:42839053-42839075 GAGGTGGTGGGCACCATCAAGGG + Intronic
1150328470 17:64275509-64275531 GGGGTGATGGGCAAGAGGAAGGG - Intergenic
1157684319 18:49630471-49630493 GTGGGGCTGGGCATCAGGACTGG + Intergenic
1157746882 18:50143736-50143758 GTTCGGATGGGCACCATGAAAGG + Intronic
1161951729 19:7471363-7471385 GAGGTGTTGGGCAGCATCAAAGG + Exonic
1167357381 19:49012201-49012223 GTTGGGATGGGCATCACAAAAGG + Intronic
1168269564 19:55242122-55242144 CTGGGGATGGGCAGCATGCATGG + Intronic
925831036 2:7895772-7895794 GTGGTGATGGTCAGAATGAAGGG + Intergenic
926132411 2:10312355-10312377 GTGGTGATGGTGATGATGATGGG - Intronic
926132447 2:10312703-10312725 GTGGTGATGGTGATGATGATGGG - Intronic
927922145 2:26981245-26981267 GTGGGGACGGGCACCAGGAATGG + Intronic
930357532 2:50340887-50340909 GTGGTGATGGTCAACAGTAAAGG + Intronic
931250115 2:60522691-60522713 GTGGTGATGGGCCACATGGTGGG - Intronic
932066194 2:68564097-68564119 TTAGTGCTGGGCATCAGGAACGG - Intronic
933144393 2:78833724-78833746 GTGGTGTTGGGCATCAGAACTGG - Intergenic
933779703 2:85792969-85792991 GTGGTGATGGGCATGAAGGGGGG - Intergenic
934853752 2:97716723-97716745 GTGGTGATGGGCATCATGAAGGG + Intronic
936919835 2:117676681-117676703 GTTGGGATAGGCATCAAGAATGG + Intergenic
937947044 2:127349473-127349495 GTACTGATAGGCATGATGAAGGG - Intronic
940047670 2:149426766-149426788 GTGGTGAGGGGTGTCAGGAAGGG + Intronic
940151678 2:150609172-150609194 TTGGTGATAGGCAAAATGAAAGG + Intergenic
941483670 2:166051074-166051096 GTGGTGATTGATATAATGAAAGG - Intronic
941540709 2:166780608-166780630 GTTGGGATGGGCATCAGAAAGGG - Intergenic
944365807 2:198918179-198918201 GTAGTGATTGCCATCATTAATGG + Intergenic
944735111 2:202556066-202556088 GTGGTGACAGTCACCATGAATGG + Exonic
946341296 2:219071085-219071107 GTGCTGTTGGGAATCATGCATGG - Intergenic
946397417 2:219449900-219449922 GTGGTGTTGGTCATCATCCATGG - Intronic
947372847 2:229466150-229466172 GTGGACAAGGGCACCATGAATGG - Intronic
948229038 2:236336402-236336424 GTGGTGGTGGTCAGCATGAATGG - Intronic
1169489859 20:6062237-6062259 GTGGAGATGGTCATCAAGAAGGG + Intergenic
1172266427 20:33618967-33618989 GTGGTGAAGGGAATCAAGGAGGG + Intronic
1173844414 20:46178874-46178896 GTGGTGAGGGGCCTGATGAGGGG + Intronic
1175121078 20:56716850-56716872 GTGGTGATGTGCGACATGCAGGG + Intergenic
1176108216 20:63399362-63399384 GTGGTGATGGGAAGCATGGTGGG - Intergenic
1176247873 20:64105787-64105809 GTGATGATGGGCATGATGATGGG + Intergenic
1181773090 22:25140848-25140870 GTGGTCACTGTCATCATGAATGG + Intronic
1184896588 22:47410818-47410840 GCAGTGATGGGCAGCTTGAAGGG + Intergenic
950996346 3:17501546-17501568 GTGGTGATGGGAGTCCTGAAGGG - Intronic
953516976 3:43602977-43602999 TAGGTGATGGGAATGATGAATGG - Intronic
953971487 3:47351974-47351996 GTGGTGGTGGGCAGTATGAGTGG - Intergenic
955403162 3:58608110-58608132 GTGGTGATGTGACTCATGCAAGG - Intronic
955444956 3:58999967-58999989 GTTGTGATGGCCTTCATGCAAGG - Intronic
956080356 3:65549887-65549909 GTGGTGATGATGATAATGAAAGG - Intronic
961683774 3:128616315-128616337 GAAGTGCTGGGCATCAGGAAAGG - Intergenic
961699906 3:128735192-128735214 GTGGTGAGGGGCATGTTGAGTGG + Intronic
962233847 3:133691680-133691702 GAAGTGATGGGCATCATGCATGG + Intergenic
962684513 3:137834174-137834196 GTGGAGATGGGCACCAGGAAGGG + Intergenic
967010937 3:185432900-185432922 GTGTTGCTGTGCACCATGAAAGG + Intronic
967709483 3:192688286-192688308 GTGGTGTGGGGCACCATGAATGG - Intronic
968082961 3:195859577-195859599 TTGGTGAGGGGCATCCTGACAGG + Intergenic
968214538 3:196877318-196877340 GTGGTGGTGGGCACCAGTAATGG - Intronic
968791103 4:2662917-2662939 GAGGTGGTGGCCAACATGAATGG + Exonic
969273446 4:6118566-6118588 TTGGTGGTGGGCATCGTGGAAGG - Intronic
970985963 4:22158404-22158426 GTGGTGATGAGAATAATGTATGG + Intergenic
974293395 4:59963316-59963338 GTGGTGATAGGGAGCTTGAATGG - Intergenic
975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG + Intergenic
978459923 4:108940441-108940463 GTGGTGAGGGGCATCAGGTCAGG - Intronic
979767777 4:124482948-124482970 CTGGTGATGGGTGTCAAGAAGGG - Intergenic
981562016 4:146058324-146058346 GTGGTGATGGGAATGAGGAGGGG - Intergenic
984096450 4:175441191-175441213 GAGGTGATGTACAACATGAAAGG + Intergenic
985450706 4:190060577-190060599 GTGGTGGTGACCCTCATGAATGG + Intergenic
986369502 5:7065857-7065879 GTGGGGCTGGTCTTCATGAACGG + Intergenic
989767166 5:45101163-45101185 ATGGTGATGGGTATGTTGAATGG - Intergenic
996087550 5:119320514-119320536 GTGGGGAGGGGCAGCAGGAAGGG - Intronic
998623906 5:143824018-143824040 GTCAGGATGGGCATCATGGAAGG + Intergenic
1000464725 5:161561815-161561837 CTGGTGATGGGCATCTTGAGAGG - Intronic
1001613131 5:173019718-173019740 GTGGTGATGGGGATTAGAAAAGG + Intronic
1002915448 6:1524736-1524758 GTGGTGACGGGCTGCAGGAAGGG + Intergenic
1003147518 6:3521137-3521159 GAGGTGATGGGATTTATGAATGG + Intergenic
1003190983 6:3874294-3874316 GTGCAGATGGGCAAAATGAAGGG + Intergenic
1005077676 6:21924731-21924753 GTGGTGGTGGTGATGATGAATGG + Intergenic
1005077694 6:21924827-21924849 GTGGTGGTGGTGATGATGAATGG + Intergenic
1005077711 6:21924923-21924945 GTGGTGGTGGTGATGATGAATGG + Intergenic
1005077727 6:21925019-21925041 GTGGTGGTGGTGATGATGAATGG + Intergenic
1006980179 6:38141452-38141474 GTGGTTAGGGACACCATGAAAGG - Intronic
1007482142 6:42157213-42157235 GTGGGGATGGGGGTTATGAAGGG + Intronic
1007757281 6:44108094-44108116 GTCGACATGGTCATCATGAATGG + Intergenic
1008533332 6:52485537-52485559 TTGGAGATGGGCCTCATGGAAGG + Intronic
1009509980 6:64538926-64538948 GCGGGGATGAGCATCATAAAAGG - Intronic
1014654435 6:124082134-124082156 ATGGTGGTGGGCAACAGGAAGGG + Intronic
1018557034 6:165060662-165060684 GTGTTGAGGGGAATCATGGAGGG - Intergenic
1018851006 6:167590081-167590103 GTGGTGATGTGCCTCATACAAGG - Intergenic
1019622543 7:1999661-1999683 GTAGTGACGGGCATGATGTAGGG - Intronic
1021227624 7:18046905-18046927 GTGGAGAGGGGTATCATAAAAGG + Intergenic
1021949726 7:25762903-25762925 GGGATAATGGGCATCATAAAAGG + Intergenic
1023611983 7:41980923-41980945 GTTGTGATAGGCATTATGAAGGG + Intronic
1027277463 7:76573439-76573461 ATGGTGATGGGCCTCTTGGATGG + Intergenic
1030398255 7:109015861-109015883 GTGGGGAAGAGCATCAGGAAGGG - Intergenic
1031618806 7:123911330-123911352 GTGGTGTTGGGGATTAGGAAGGG - Intergenic
1031850150 7:126853712-126853734 ATGGTGCTGGGCCTCAGGAATGG + Intronic
1039038377 8:33383898-33383920 GTGGTGGTGGGGATTATGATGGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1048372420 8:133790932-133790954 GTGGTGCTGGGCATATGGAAGGG + Intergenic
1048602265 8:135930964-135930986 CTGGTGTTGGGCAACAAGAATGG + Intergenic
1048628444 8:136213437-136213459 GTGGTGATGGTGATAATGATGGG + Intergenic
1048628460 8:136213531-136213553 GTGGTGATGGTGATAATGATGGG + Intergenic
1056182612 9:84100514-84100536 CTGCTCATGAGCATCATGAAGGG - Intergenic
1061757439 9:132824825-132824847 GTTGTGATCAGCATCATCAATGG + Intronic
1189693796 X:43643030-43643052 GTGGAGATGGGAGGCATGAAAGG + Intergenic
1193178722 X:78427829-78427851 AATGTGATGGGCATCATGATTGG + Intergenic
1197907974 X:131446759-131446781 TTGGTGGTCGGCATAATGAATGG + Intergenic
1199475014 X:148235455-148235477 GTGGAGGTGGGGATCATTAATGG + Intergenic
1200622444 Y:5468444-5468466 ATGAAGATTGGCATCATGAAAGG + Intronic
1201745022 Y:17362660-17362682 GTGGTGCAGGGCACAATGAATGG + Intergenic
1202300855 Y:23412300-23412322 GTGGGGCTGGGGATCATGAAAGG + Intergenic
1202569956 Y:26258298-26258320 GTGGGGCTGGGGATCATGAAAGG - Intergenic