ID: 934854589

View in Genome Browser
Species Human (GRCh38)
Location 2:97721309-97721331
Sequence TCATTCTCAGACATACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934854586_934854589 4 Left 934854586 2:97721282-97721304 CCTAAAACCAACATGGCACTTTT 0: 1
1: 0
2: 1
3: 30
4: 397
Right 934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 206
934854588_934854589 -3 Left 934854588 2:97721289-97721311 CCAACATGGCACTTTTGTGGTCA 0: 1
1: 0
2: 0
3: 10
4: 127
Right 934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 206
934854585_934854589 5 Left 934854585 2:97721281-97721303 CCCTAAAACCAACATGGCACTTT 0: 1
1: 0
2: 5
3: 21
4: 225
Right 934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 206
934854583_934854589 29 Left 934854583 2:97721257-97721279 CCTACTTGTTAAATTTATCTGAA 0: 1
1: 0
2: 3
3: 46
4: 366
Right 934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934854589 Original CRISPR TCATTCTCAGACATACAGAG TGG Intronic
900489187 1:2938100-2938122 ACATGCACACACATACAGAGAGG + Intergenic
901434093 1:9235410-9235432 TGATTTTCAGAGATCCAGAGAGG - Intronic
901711834 1:11121884-11121906 TCAGTGACAGACATACAGAGAGG + Intronic
901912923 1:12475293-12475315 TCATTCTCCCCCATACAAAGGGG + Intronic
903375321 1:22862184-22862206 TCATACTCAGAGCTACAGTGGGG + Intronic
905905789 1:41617603-41617625 CCATTCAAAGACACACAGAGAGG + Intronic
907591351 1:55675241-55675263 TGATGCAAAGACATACAGAGTGG - Intergenic
908611824 1:65869625-65869647 TCCCTCTCAGAAAAACAGAGTGG - Intronic
911093793 1:94039455-94039477 ACATTCTCTCACATAGAGAGGGG + Intronic
912252425 1:108025467-108025489 ACATTGAGAGACATACAGAGTGG + Intergenic
913697178 1:121338355-121338377 TCATGCTCAGACAAGCAGGGAGG - Intronic
914140379 1:144941696-144941718 TCATGCTCAGACAAGCAGGGAGG + Intronic
918719367 1:187833343-187833365 CCAGTCTCAGAAATCCAGAGTGG + Intergenic
919562526 1:199139567-199139589 TAATTAACAGACACACAGAGAGG + Intergenic
920484513 1:206356686-206356708 TCATGCTCAGACAAGCAGGGAGG - Intronic
922988242 1:229883284-229883306 TGTTTCTCAGGCATACAGTGAGG + Intergenic
924937345 1:248783536-248783558 TCCTTCTCAGAAAGAGAGAGAGG + Intergenic
1064948793 10:20822973-20822995 TATTATTCAGACATACAGAGTGG - Intronic
1068854094 10:61779719-61779741 TCACTCTCAGATGTGCAGAGTGG - Intergenic
1071485834 10:86102199-86102221 TCATTCTGAGGCAGCCAGAGTGG - Intronic
1074466120 10:113682374-113682396 TCCTTCTCAGACACTAAGAGAGG - Intronic
1075924255 10:126237354-126237376 TTATTCTCAGAAAAATAGAGGGG + Intronic
1076735240 10:132456025-132456047 CCCTCCTCAGACCTACAGAGAGG - Intergenic
1077878926 11:6332203-6332225 TCATTTGCAGACATACACAAAGG + Intergenic
1078503486 11:11908823-11908845 TCAATCTGAGATATACAGAATGG - Intronic
1078554984 11:12317441-12317463 TCATTCTAACACAGCCAGAGTGG + Intronic
1079538784 11:21546987-21547009 TAAGTCTTAGGCATACAGAGAGG + Intronic
1079834133 11:25309921-25309943 TCATAAACAGACATACAAAGAGG + Intergenic
1084180886 11:67445279-67445301 TCACCCTCAGACACACAGTGGGG - Intergenic
1085365972 11:75945239-75945261 CCTTCCTCAGAAATACAGAGGGG - Intronic
1085371025 11:76005580-76005602 AAATTCTAAGACATACAGTGAGG - Intronic
1086955232 11:92928630-92928652 ACATTCTCAGAAGGACAGAGCGG + Intergenic
1087495727 11:98888545-98888567 CTATTCTAATACATACAGAGTGG + Intergenic
1087499892 11:98937116-98937138 TCATGCTCAGAAATTCTGAGAGG + Intergenic
1088383443 11:109222293-109222315 CCATTGTCAGACATAAATAGAGG + Intergenic
1088393445 11:109341449-109341471 TCATTCTCAGCCAGGCACAGAGG - Intergenic
1089917727 11:122175190-122175212 GCACACACAGACATACAGAGTGG + Intergenic
1091105279 11:132913501-132913523 TCATTCACAGAAAGACAGAAAGG - Intronic
1092523859 12:9297763-9297785 TCTCTCTCACACACACAGAGTGG + Intergenic
1092543439 12:9434136-9434158 TCTCTCTCACACACACAGAGTGG - Intergenic
1093142212 12:15522126-15522148 TAATTCTCACACATACTGTGAGG - Intronic
1093494225 12:19737539-19737561 TCATTCACATTCATACACAGAGG + Intergenic
1094061363 12:26318022-26318044 TGATTCTTAGCCATACACAGTGG - Intergenic
1094204035 12:27821617-27821639 TTTTTCTCCCACATACAGAGAGG - Intergenic
1094509507 12:31087920-31087942 TCTCTCTCACACACACAGAGTGG + Exonic
1095463422 12:42465484-42465506 TCATTCGCAGATGTGCAGAGTGG + Intronic
1098260688 12:68667145-68667167 TCATTTTCAGACATATCCAGAGG + Exonic
1099279597 12:80626995-80627017 TCATTTTCATCCATACAGACAGG - Intronic
1100892143 12:99137534-99137556 CCATTCTCAGTTACACAGAGAGG + Intronic
1102112548 12:110375287-110375309 TCAGTCTCAGACATGCAGACTGG - Intronic
1102757899 12:115358182-115358204 TAATTCTCAGACTTCCAGGGAGG - Intergenic
1104492028 12:129202524-129202546 TCATTCTCAGAAACAAAGAGAGG + Intronic
1106367070 13:29091675-29091697 TCATTCTTAGAAATACAGATAGG + Intronic
1108207282 13:48103102-48103124 TCATTATAAGAGATACACAGAGG + Intergenic
1109097820 13:58141390-58141412 TCATTCACAAACATACAGTTTGG + Intergenic
1111050658 13:82879774-82879796 TCATTGTCAGCCATGTAGAGGGG + Intergenic
1111075698 13:83231865-83231887 CCATTCTCATACTTCCAGAGGGG - Intergenic
1111652657 13:91111660-91111682 TCATGCCCAGGCAAACAGAGCGG + Intergenic
1111664362 13:91248743-91248765 TCCTTGTAAGACATACAAAGAGG - Intergenic
1113463933 13:110501072-110501094 GCATTCACAGATATACACAGAGG - Intronic
1113815210 13:113164887-113164909 TAATTCACAGACACACAGACTGG - Intronic
1115287811 14:31736056-31736078 TCATTGTTAGAAATACAGTGGGG + Intronic
1115469911 14:33757777-33757799 GCATTCGCAGAAATAAAGAGTGG + Intronic
1118108535 14:62689393-62689415 TCATCCTCAGACTTCCAGATGGG - Intergenic
1122001189 14:98655596-98655618 TCGTTGTCAGAGATACAGGGAGG - Intergenic
1122266658 14:100549890-100549912 TCCTTAGCAGACATACAGGGAGG + Intronic
1123685071 15:22791275-22791297 TGACTTTCAGACATACAGAGTGG - Intronic
1123873988 15:24605624-24605646 TCTCTCCCAGACATACAAAGTGG - Intergenic
1124805857 15:32882001-32882023 TCAATGTCAGAGAGACAGAGAGG + Intronic
1124827929 15:33117390-33117412 GCATTCTGAGAAATACACAGGGG + Intronic
1124985846 15:34612202-34612224 TCATTCACACACGTACATAGAGG + Intergenic
1125763857 15:42119717-42119739 TCAATCCCCGACAGACAGAGGGG - Intergenic
1129180676 15:73872900-73872922 TCTCTGTCATACATACAGAGAGG + Intergenic
1129498495 15:76012146-76012168 TCTTTCTTAGACAAGCAGAGAGG + Intronic
1129508313 15:76101698-76101720 TCAGTCTCAGACCCACAAAGAGG + Intronic
1129674289 15:77624074-77624096 TCACTCACAGACACACACAGAGG - Intronic
1130312580 15:82768092-82768114 TCATTCTCAGAGAGCTAGAGGGG - Intronic
1133321948 16:4919568-4919590 TGAGACTCAGAAATACAGAGTGG - Intronic
1134558777 16:15189380-15189402 TGATTCTCAGCCAGACACAGTGG - Intergenic
1134919310 16:18100981-18101003 TGATTCTCAGCCAGACACAGTGG - Intergenic
1137812941 16:51370405-51370427 TTGTACCCAGACATACAGAGAGG - Intergenic
1146060410 17:29602600-29602622 TCTTTCTAAGACACTCAGAGAGG - Intronic
1147457869 17:40549770-40549792 TCATGCACAGACACAAAGAGAGG + Intergenic
1148743755 17:49907368-49907390 TCACTCTGAGACATATAGGGTGG - Intergenic
1151472758 17:74328076-74328098 TCATTCGCGGAAACACAGAGAGG + Intronic
1151780898 17:76244663-76244685 TCATTCTCAGCCACGCACAGTGG + Intergenic
1152964500 18:102190-102212 TCATTCCGAGACAGAAAGAGAGG + Intergenic
1156204466 18:34871093-34871115 GCATTCTCAGCCAAACTGAGAGG + Intronic
1157278931 18:46333451-46333473 GCATTCTCAGAGACACACAGAGG - Intronic
1158322450 18:56278488-56278510 TGTTGCTTAGACATACAGAGTGG + Intergenic
1159211317 18:65326286-65326308 CCATTCTCAGGCATACTGACTGG + Intergenic
1165963542 19:39555334-39555356 TCAATCTCAGACACACATTGAGG - Intergenic
1167081340 19:47278087-47278109 TGAGTCAGAGACATACAGAGTGG - Intergenic
925278047 2:2664237-2664259 ACACCCTCAGACACACAGAGAGG + Intergenic
925278055 2:2664295-2664317 ACACTCTCACACACACAGAGAGG + Intergenic
929011803 2:37452236-37452258 TCATTCTCAGTCAGACATGGTGG - Intergenic
929128987 2:38547209-38547231 CCATTCTAATACATATAGAGTGG + Intergenic
931469023 2:62519404-62519426 TCACTTTCAGACATACACATAGG - Intergenic
934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG + Intronic
935351862 2:102157960-102157982 TCATTCTCTCCCATATAGAGTGG + Intronic
935807846 2:106766669-106766691 TGAGTCACAGACAGACAGAGAGG + Intergenic
937119022 2:119429371-119429393 ACATTCTCAGTCCTACAGGGAGG + Intergenic
937795787 2:126018580-126018602 TCAATCTCATAGATAGAGAGAGG - Intergenic
938483960 2:131684340-131684362 ACATTTTCATACATACAGATTGG + Intergenic
940064350 2:149610460-149610482 CCATTGGCAGACATACAGAGTGG + Intergenic
940254275 2:151712778-151712800 TCACTCTCAGACTTGCAGAGTGG - Intronic
941241098 2:163038856-163038878 TCTGTCTCAGACATACTGAAAGG - Intergenic
943853881 2:192763500-192763522 TCATGTTCAGAAATGCAGAGTGG + Intergenic
945233789 2:207615918-207615940 TTTTTCCCAAACATACAGAGAGG + Intronic
945904014 2:215570448-215570470 TCATTCCAAGACATATAGAAAGG - Intergenic
946560957 2:220913128-220913150 TCATTCTTAGATATAAAGATAGG + Intergenic
946577554 2:221092299-221092321 GCACACACAGACATACAGAGTGG - Intergenic
947479381 2:230484274-230484296 TCATTTGCAGACATGCAGTGTGG - Intronic
948226117 2:236310468-236310490 ACATACTCACACATACACAGGGG - Intergenic
1169949032 20:11022248-11022270 GCATGCACAGGCATACAGAGTGG + Intergenic
1170792356 20:19518550-19518572 TCATGATCAGAGACACAGAGAGG + Intronic
1171224784 20:23433299-23433321 TCATTCACAGACGCTCAGAGTGG + Intergenic
1174378204 20:50140059-50140081 TCATTCACAGAGATGGAGAGAGG - Intronic
1175246918 20:57587765-57587787 TGAATCTCAGACAGACTGAGGGG + Intergenic
1175275832 20:57770103-57770125 TGGTTCTCAGAAAGACAGAGTGG + Intergenic
1175286984 20:57843583-57843605 TCATTCTCATATAAACAGATGGG - Intergenic
1175683797 20:61011378-61011400 TAATTCACAGACATATAGGGAGG + Intergenic
1177766556 21:25464597-25464619 TCATTCTCAGAGAGAAAGAAGGG - Intergenic
1177812218 21:25936574-25936596 TCTTTCTCAGAGAGAAAGAGAGG - Intronic
1178510889 21:33204016-33204038 TCATACACAGAAGTACAGAGTGG + Intergenic
1178857497 21:36262460-36262482 TCATCCTGAGAGCTACAGAGCGG + Intronic
1185240089 22:49737707-49737729 TCATTCCCGCATATACAGAGAGG + Intergenic
1185240107 22:49737800-49737822 CCATTCCCACATATACAGAGAGG + Intergenic
952193569 3:31048826-31048848 AAATTCTCACACATACACAGTGG + Intergenic
952264548 3:31772731-31772753 TCATTTCCAGACACACAGAATGG - Intronic
953722404 3:45368053-45368075 TCATTGACAGACATGCAGAGAGG - Intergenic
959525851 3:107375689-107375711 TCATTGTCACACTTACAGAGTGG - Intergenic
963054437 3:141174244-141174266 ACATTCTCTTTCATACAGAGGGG - Intergenic
963345108 3:144087061-144087083 TCATACACAGTCATACAAAGTGG + Intergenic
964691151 3:159451427-159451449 TCAATATCAGACATTCACAGTGG - Intronic
964847409 3:161058698-161058720 TGATTTTCAAACATTCAGAGTGG - Intronic
965630776 3:170730474-170730496 TCATTTTCTGCCAAACAGAGTGG + Intronic
967734263 3:192935627-192935649 TCACTTAAAGACATACAGAGGGG - Intergenic
969296820 4:6275203-6275225 ACTTTCTCAGACAGAGAGAGAGG - Intronic
969509041 4:7606926-7606948 TCATTCCTAGATAAACAGAGTGG + Intronic
970320134 4:14867464-14867486 TTATTGTCAGAGACACAGAGAGG + Intergenic
970908145 4:21241421-21241443 TCATTCTTTGACATTCACAGAGG + Intronic
973250920 4:48059098-48059120 TCATTTTGTGACATCCAGAGTGG + Intergenic
973698752 4:53516421-53516443 ACATTATCAGAGAGACAGAGAGG + Intronic
974513855 4:62882078-62882100 TCATTTTGAGTCATTCAGAGAGG + Intergenic
975318718 4:72984829-72984851 TTATACTCAGATATACAGGGGGG + Intergenic
975598962 4:76079301-76079323 TCCTTCTCAGACACACTGGGTGG - Intronic
975936595 4:79588944-79588966 GCATTCTCAGGCAGACACAGAGG + Intergenic
976732011 4:88272394-88272416 ACTTGCTCAGACATTCAGAGTGG - Intronic
977233619 4:94480759-94480781 TAGTTCTCTGTCATACAGAGAGG + Intronic
977346885 4:95827589-95827611 TCAATAACAGACAAACAGAGAGG + Intergenic
978573085 4:110161425-110161447 TCATTTTCAAACATGCACAGAGG + Intronic
979057744 4:116016883-116016905 TCATTCATGGACATACAGAAAGG - Intergenic
981857121 4:149307924-149307946 TCATTCTCAGGCCTTCAGACTGG + Intergenic
982252422 4:153420663-153420685 TGATTTTCAGACATGCACAGTGG + Intergenic
982437633 4:155397026-155397048 CCATTAACAGACAAACAGAGAGG - Intergenic
984110071 4:175601810-175601832 CCAATATCAGACAAACAGAGAGG - Intergenic
984832311 4:183987040-183987062 TCATTCTCAGAAACCCATAGAGG - Intronic
985861569 5:2475642-2475664 TCCTGCACAGACATTCAGAGAGG + Intergenic
986775638 5:11011535-11011557 TCATTCGGAGAGATACTGAGTGG + Intronic
988204654 5:28118088-28118110 ACATTCTCAGAAACACAGGGTGG + Intergenic
988259210 5:28862067-28862089 TTATTCTCGGACTTAAAGAGAGG - Intergenic
988879317 5:35483515-35483537 TCAGTCTCAGATATACAAAAAGG - Intergenic
990913941 5:60882164-60882186 ACATTCTCAGACATGCAGTAGGG - Intronic
991211868 5:64115194-64115216 ACATTCACAGACACACACAGTGG + Intergenic
994578178 5:101608174-101608196 TTTCTCTCAGACATACAAAGTGG - Intergenic
994607246 5:101984120-101984142 TCATTCTAAGACTTTCAGAAAGG + Intergenic
995587338 5:113661802-113661824 TCATTCTCATTAATACATAGGGG - Intergenic
996941550 5:129011775-129011797 TCTTTCTCAGATATAAAGAAAGG - Intronic
1000451601 5:161395782-161395804 TCATTCTCTAAGATCCAGAGAGG - Intronic
1000772473 5:165372661-165372683 ATATTCTCAAACATTCAGAGTGG + Intergenic
1003201036 6:3960709-3960731 TCATTTGCAGACATGCAGAGTGG - Intergenic
1004749840 6:18550881-18550903 TCATTCACAGATATGCAGAGAGG - Intergenic
1006774271 6:36579956-36579978 TGGTTCTCAGACCTACAGAGAGG - Intergenic
1008549939 6:52619179-52619201 TCATTCACATATATAGAGAGAGG - Intergenic
1013569781 6:111410485-111410507 TCTCTCACACACATACAGAGTGG - Intronic
1014020626 6:116584464-116584486 TCTTTCTCAGACATGCAGTCTGG + Intronic
1015284663 6:131471866-131471888 TCATTCTCAGACCTTTAGAAAGG - Intergenic
1015812840 6:137178247-137178269 TGATTCTCAGTCCTACAGAGGGG + Intergenic
1016566210 6:145457629-145457651 TCATTCTAAGACATTCTAAGAGG + Intergenic
1018252842 6:161889523-161889545 GCATTCTCAGACAGACAGACTGG + Intronic
1018424219 6:163665632-163665654 TCACACTCAGACACACAGACAGG + Intergenic
1021783499 7:24129928-24129950 AAATTCTCAGCTATACAGAGGGG + Intergenic
1023115900 7:36862189-36862211 TCATCCTAAGAAAGACAGAGAGG + Intronic
1024819631 7:53312346-53312368 TCATTTTAAAACATACAAAGAGG + Intergenic
1024916477 7:54505553-54505575 TTATTCCTAGACATAAAGAGGGG - Intergenic
1025897717 7:65719361-65719383 TCATTCAGAGACATACAAATGGG + Intergenic
1026138274 7:67682695-67682717 ACATCTTCAGACACACAGAGTGG - Intergenic
1026796318 7:73368205-73368227 GCATTGCCAGACACACAGAGGGG + Intergenic
1027436038 7:78165428-78165450 TCATTATGAGAGATACAGAAAGG - Intronic
1028667388 7:93362578-93362600 TCTTTCTCAAATACACAGAGTGG - Intergenic
1034852788 7:154511298-154511320 TCATTATCACCCATTCAGAGAGG + Intronic
1035436242 7:158862143-158862165 TAATTCTCAGAATTACAGAGTGG - Intronic
1041941149 8:63389269-63389291 TCATTCTCAGCCAGGCACAGTGG - Intergenic
1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG + Intergenic
1042839140 8:73106182-73106204 TCATACACACACACACAGAGAGG - Intronic
1043294124 8:78643182-78643204 CCATTCTCAGCCAGACACAGTGG - Intergenic
1043398182 8:79858420-79858442 TCAGACTGAAACATACAGAGGGG + Intergenic
1045293316 8:100851979-100852001 TCATACTGAGAAGTACAGAGAGG + Intergenic
1046425844 8:114047375-114047397 TCATTTTTAGATATACATAGGGG - Intergenic
1047063474 8:121253555-121253577 TCAGACACAGACATACACAGAGG - Intergenic
1048018753 8:130519805-130519827 GCCATCTCAGGCATACAGAGAGG - Intergenic
1048554616 8:135462466-135462488 TCATTCTCAAACGCACACAGAGG - Intronic
1048683229 8:136870474-136870496 TCTTTCAAAGACATAAAGAGTGG - Intergenic
1048832510 8:138490482-138490504 CCATGCTCAGACAGACAGACGGG + Intronic
1048903943 8:139068812-139068834 TCATTCTAAGAGAAAGAGAGGGG - Intergenic
1051581261 9:18677820-18677842 TCAGTATCAGACATACAAGGGGG - Intronic
1052037576 9:23700509-23700531 TCATTCTATGAACTACAGAGAGG + Intronic
1052610096 9:30760245-30760267 TCATTCAAAGACACACAGATAGG + Intergenic
1052740680 9:32389706-32389728 AAAATCTCAGACATACAAAGTGG + Intronic
1055721031 9:79175083-79175105 TCATTAAAAGACACACAGAGAGG - Intergenic
1056717375 9:89043224-89043246 TCATTCTCACACCTACAGCCTGG - Intronic
1057404315 9:94754903-94754925 CCATTCTCAGCCATCCAAAGTGG - Intronic
1062193767 9:135261997-135262019 ACATACACAGACATGCAGAGAGG - Intergenic
1062193768 9:135262035-135262057 ACATACACAGACATGCAGAGAGG - Intergenic
1186673660 X:11793420-11793442 TCATGCTTTGACATGCAGAGAGG + Intergenic
1187673672 X:21693786-21693808 TCATTCCCAGACATAGAAAAAGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1195870830 X:109483640-109483662 GAATTCCCAGACATCCAGAGAGG + Intergenic
1196903342 X:120408580-120408602 TTATTCTAAGACACACAGACAGG - Intergenic
1199347093 X:146754354-146754376 TCATTCACAGAGAAACAAAGAGG - Intergenic
1200219562 X:154384394-154384416 CCATGCTCAGACATACAGCAGGG + Intergenic