ID: 934856198

View in Genome Browser
Species Human (GRCh38)
Location 2:97731915-97731937
Sequence GTGTAGCTTTACAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934856198_934856201 -5 Left 934856198 2:97731915-97731937 CCCTCCTCACTGTAAAGCTACAC 0: 1
1: 0
2: 3
3: 8
4: 149
Right 934856201 2:97731933-97731955 TACACTTGACCCTGCAATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934856198 Original CRISPR GTGTAGCTTTACAGTGAGGA GGG (reversed) Intronic
901300706 1:8198227-8198249 GTGCAGCTGTAAAATGAGGATGG + Intergenic
903660540 1:24974635-24974657 TTGTAACTATTCAGTGAGGATGG - Intergenic
907484625 1:54768600-54768622 GGGTGGCTTTGCAGTCAGGAAGG + Intergenic
907528241 1:55067064-55067086 ATGAAGCTTTACAGTGAGGACGG + Exonic
907950962 1:59183477-59183499 GTCTTGCTTTATATTGAGGAAGG + Intergenic
909266654 1:73567891-73567913 CTGTAGCTTTATAGTGAGCCTGG - Intergenic
918913095 1:190598565-190598587 GTGTAGATTTACTGAGTGGAAGG + Intergenic
920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG + Intergenic
921832765 1:219746523-219746545 GTGTAGGGTCACAGAGAGGAGGG - Intronic
923472265 1:234302438-234302460 GAGTAGCTGGACAGTGAGGAAGG + Intronic
1062999751 10:1905625-1905647 GTGTCACCTTACAGAGAGGAAGG - Intergenic
1064088929 10:12366945-12366967 GTGTAGCTTGGCAGTGATGGTGG + Intronic
1067373622 10:45707492-45707514 ATGTGGCTTAACAGTGAGTAGGG - Intergenic
1067380067 10:45764735-45764757 ATGTGGCTTAACAGTGAGTAGGG + Intronic
1067881444 10:50049263-50049285 ATGTGGCTTAACAGTGAGTAGGG - Intergenic
1067887767 10:50105390-50105412 ATGTGGCTTAACAGTGAGTAGGG + Intronic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1070217382 10:74400948-74400970 TTTTAGCTTTTCAGTCAGGAAGG - Intronic
1074733017 10:116397703-116397725 GTGGAGATTTATAATGAGGAAGG + Intergenic
1075794032 10:125106319-125106341 GGGTCCCTTTACAGTGAAGATGG - Intronic
1076402802 10:130194655-130194677 GTGCAGATTTCAAGTGAGGAGGG + Intergenic
1076518781 10:131066274-131066296 TTTTAGCATTACAATGAGGAAGG - Intergenic
1079849594 11:25514894-25514916 TTGAAGCTTTAGAGTGGGGAAGG + Intergenic
1079995559 11:27291859-27291881 GAATGGCTTTATAGTGAGGAAGG - Intergenic
1080839876 11:35974180-35974202 GTGTAATTTTGGAGTGAGGAAGG - Intronic
1085556712 11:77429426-77429448 GAGTAACTTCACAGTGAAGAAGG + Intronic
1086068336 11:82770334-82770356 GTGTAACTTTCTTGTGAGGAAGG - Intergenic
1086536373 11:87851731-87851753 GTGTAGCTTTGCAGAGAGCCTGG + Intergenic
1088311502 11:108465653-108465675 GTGTAGCTAGAGAGTGAGAATGG + Intronic
1088825991 11:113495197-113495219 CAGCAGTTTTACAGTGAGGAAGG - Intergenic
1090565621 11:127988867-127988889 GTTTAGTTTTACAGTTATGAAGG - Intergenic
1091415557 12:279967-279989 GTGTATCTTGTCAGTGGGGAGGG - Intergenic
1091433777 12:458224-458246 TTGAAGCCTTACAGTGAGGTTGG + Intergenic
1096376250 12:51113646-51113668 GTGTAGCTTTATAGTCAGTTTGG - Intronic
1097388947 12:58985293-58985315 GTGTAGCTGTTCACTGAAGAGGG + Intergenic
1097720852 12:63019531-63019553 ATGTAGCATTACAGTGTGTAAGG - Intergenic
1098429559 12:70404922-70404944 GTGAACATTTAGAGTGAGGAGGG + Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103827114 12:123748298-123748320 GTGTAGCCTTACTTTAAGGAAGG + Intronic
1107275441 13:38673126-38673148 GTATAGCTTTAGAGTGTGGGTGG - Intergenic
1110515241 13:76403971-76403993 GTGTAGCTTCCCAGTGTGGGTGG - Intergenic
1112083018 13:95996746-95996768 GTTTAGCTTTTAAGTGAGGCAGG + Intronic
1113028993 13:105973255-105973277 CTGTAGCTTCACATTGTGGATGG + Intergenic
1115012319 14:28564214-28564236 GAGTAACTTTACAGTTAAGAAGG + Intergenic
1117240403 14:53826690-53826712 GTATGGTTTTACAGTGTGGATGG - Intergenic
1117803696 14:59468853-59468875 GTGGACCTTTGCAGTGAAGAAGG + Intronic
1118063452 14:62165595-62165617 GTGTAGCTGTACGCAGAGGAGGG - Intergenic
1120205131 14:81579677-81579699 GAGAAGCCTTACAGTGTGGAAGG + Intergenic
1120617883 14:86730574-86730596 GTGTAATTTTACAGTGGAGAAGG + Intergenic
1121025203 14:90610556-90610578 GTGTTTCTTCACAGTGGGGACGG - Intronic
1121037193 14:90716137-90716159 GTGAAGCTTTACAGCCAAGAAGG + Intronic
1122407845 14:101510821-101510843 GAGTATCTTTACACTGGGGAAGG + Intergenic
1125160935 15:36642841-36642863 TGGTTGCTATACAGTGAGGAGGG + Intronic
1126567710 15:50116821-50116843 AGGTAGCTTTAAAGTAAGGAAGG + Intronic
1128361915 15:66968138-66968160 ATGGAGGTTTAGAGTGAGGATGG + Intergenic
1129745891 15:78020656-78020678 GTGATGCTTTACATTGAGCATGG - Intronic
1139719730 16:68842878-68842900 TTGTAGCTTTACATTCACGATGG + Intergenic
1140138101 16:72226116-72226138 ATGTAGCTTGACAGAGAGGATGG - Intergenic
1140792888 16:78409299-78409321 CTGTATCTTGACAGTGATGATGG - Intronic
1141841191 16:86575383-86575405 TTTTTGCTTTCCAGTGAGGAAGG + Intergenic
1142714781 17:1741535-1741557 GAGGAGCTGGACAGTGAGGATGG + Intergenic
1145106768 17:20124223-20124245 GTGTCTGTTTACAGTGGGGAGGG + Intronic
1145688873 17:26711349-26711371 GTGTAGTTTTTATGTGAGGATGG - Intergenic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1147339025 17:39742901-39742923 GTAAAGGTGTACAGTGAGGATGG + Exonic
1147970204 17:44215342-44215364 GCGGAGCCTAACAGTGAGGATGG + Intronic
1157454213 18:47811610-47811632 GTGTATGTTTGGAGTGAGGATGG - Exonic
1168273537 19:55263603-55263625 TTGCAGCTGTACAGTGCGGATGG - Intronic
926792165 2:16584917-16584939 GTGTGGCATGACAGTAAGGAAGG - Intronic
927194080 2:20535835-20535857 GTGTAGCTTTAGGGTCTGGAAGG + Intergenic
927328530 2:21834835-21834857 GAGTAGCTAAACAGTGTGGATGG + Intergenic
928176202 2:29035870-29035892 TAGCAGATTTACAGTGAGGAGGG + Intronic
929868033 2:45734906-45734928 GGGGAGCTCTACAGCGAGGATGG - Intronic
934856088 2:97731280-97731302 GTGCAGCTTTCCAGTGAGGAGGG - Intronic
934856198 2:97731915-97731937 GTGTAGCTTTACAGTGAGGAGGG - Intronic
938110578 2:128561894-128561916 ATTTAACTTTACATTGAGGAAGG + Intergenic
939236331 2:139498811-139498833 GTGTTGCTTTACAGTGACACTGG - Intergenic
944290292 2:197997097-197997119 GTGTAGCACTACTGTGGGGAGGG + Intronic
945402158 2:209396836-209396858 CTGTAACTTCACAGTGAGGGTGG + Intergenic
946049250 2:216848176-216848198 GTGCAACTTTACAGTTACGAGGG + Intergenic
1169036263 20:2454916-2454938 GCATTGCTTTACAGGGAGGAAGG - Intergenic
1169422271 20:5470256-5470278 GTGAAGCTTTCCGGTAAGGAGGG + Intergenic
1172234662 20:33362982-33363004 GAGTAACTTTACAGTCAAGAAGG + Intronic
1175209842 20:57346776-57346798 GTGTAGCTTTACAGGGAATTGGG - Intergenic
1175787897 20:61723543-61723565 GGGTATCTGTAAAGTGAGGATGG - Intronic
1176185352 20:63775469-63775491 GGCTGGCTTTAGAGTGAGGAGGG - Intronic
1178519983 21:33281346-33281368 ATCTAGTTTTACAGTGAGCAGGG + Intronic
1184522716 22:45004976-45004998 GTGCAGCTTTACAGTCAGGTTGG - Intronic
1185155972 22:49193778-49193800 GTGTAAATTTACAGAGAGGCTGG - Intergenic
949959658 3:9301576-9301598 CTGTAGAATTACAGTGAGCACGG + Intronic
951512431 3:23518514-23518536 GTTTATGTTTACAGTGAGGAAGG + Intronic
952226088 3:31377719-31377741 GTTTATGTTTACAGTTAGGAAGG - Intergenic
954402749 3:50327699-50327721 GCTTAGCTTTACCGTGCGGAAGG + Intronic
957748876 3:84385189-84385211 GGGTAACTTTACAGACAGGAAGG + Intergenic
959146557 3:102552992-102553014 CTGTAGCTTGACATTGATGATGG + Intergenic
961740216 3:129028572-129028594 TTGCAGCTTTACCATGAGGAGGG + Intronic
963794476 3:149617730-149617752 GTGGAGGTTAACAGTGAGCAGGG + Intronic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
966258775 3:177950454-177950476 GGGTGGTTTTACAGTGGGGAAGG - Intergenic
967403944 3:189095565-189095587 GCGAAGCTTTCCAGAGAGGATGG - Intronic
968154601 3:196369489-196369511 GTTTATCATGACAGTGAGGAAGG - Exonic
973808942 4:54551564-54551586 ATGTAGCTTTACACTGAAGATGG + Intergenic
978376698 4:108081598-108081620 GTGTCGACTGACAGTGAGGATGG + Exonic
980661077 4:135858978-135859000 ATGTATCTTGACAGTGAGAAAGG + Intergenic
986874541 5:12092139-12092161 GTGTAGCTTTTTAGTGGGGAAGG - Intergenic
994283384 5:97933838-97933860 ATGTTGCTTAAAAGTGAGGATGG - Intergenic
996522279 5:124440476-124440498 GTGAAGATTTATAGTGAGGTGGG + Intergenic
997179407 5:131812862-131812884 GAGTAGTTTTCCACTGAGGATGG - Intronic
1000853759 5:166373199-166373221 ATGTAGCTTTACTGTGGTGAAGG - Intergenic
1003414944 6:5899040-5899062 GTGTAGATATACTATGAGGATGG - Intergenic
1006236656 6:32639203-32639225 ATGTGGCTTTACAGTATGGAGGG - Intronic
1006246625 6:32742778-32742800 TTGTAGCTTTACAGTTTGGAGGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007940814 6:45779600-45779622 GTATAGCTTTAGAGTCAGAATGG - Intergenic
1008470809 6:51882184-51882206 GTGTAGTTTTCAAGAGAGGATGG - Intronic
1010003233 6:70969200-70969222 GTGTAGCTTAAGAGAGAGGCAGG + Intergenic
1012131037 6:95493305-95493327 GTTTACATTTACTGTGAGGAAGG - Intergenic
1012917074 6:105181671-105181693 TTTTAGCATTAAAGTGAGGAAGG + Intergenic
1014564378 6:122930290-122930312 GGGTACCTGTCCAGTGAGGAGGG + Intergenic
1014742090 6:125157460-125157482 GTGGAGCTGTTCACTGAGGAGGG + Intronic
1015486690 6:133778731-133778753 GTGTAGTTTTATATTGAGTATGG - Intergenic
1015788403 6:136941781-136941803 GTGAACCTTTGGAGTGAGGAAGG - Intergenic
1017609300 6:156167579-156167601 TTGTAGCTGTACAGTAATGATGG - Intergenic
1018888676 6:167964658-167964680 GTGTAGCTCTAGAGGGAGTAGGG + Intronic
1019138813 6:169930006-169930028 GTGGAGGTCAACAGTGAGGATGG + Intergenic
1021334219 7:19378422-19378444 GTGTAACTTCACCCTGAGGAAGG + Intergenic
1022440698 7:30430612-30430634 CTGTAGCTGAACAGTGGGGAGGG - Intronic
1023052690 7:36267123-36267145 GAGTAGCTTGACTGGGAGGATGG - Intronic
1025111862 7:56223817-56223839 GTGTAGCCTTGTAGTGAAGAGGG - Intergenic
1028232518 7:88322708-88322730 TTGTAACTTTACAGAGAGGCTGG + Intergenic
1028881404 7:95884478-95884500 CTGTAGCCTTCCAGTGAGCAAGG + Intronic
1030085976 7:105816076-105816098 GTATAGCTGTACTGGGAGGATGG + Intronic
1032382336 7:131498062-131498084 GTGAAGCTGTAGAGTAAGGATGG - Intergenic
1035828155 8:2666640-2666662 CTGTACGTTTACAGTGAAGATGG - Intergenic
1038302320 8:26364158-26364180 ATGTACATTTAAAGTGAGGATGG + Intronic
1039576998 8:38631659-38631681 GGGTAGCTTTCCATTTAGGATGG - Intergenic
1041582355 8:59476047-59476069 GTGTAGGTTTAAAGGGAGTATGG + Intergenic
1042164446 8:65932004-65932026 TTATAACTTTACAGAGAGGAAGG + Intergenic
1044278337 8:90327854-90327876 GTGTATCTTGGCAGTGAGAAAGG - Intergenic
1044397138 8:91726240-91726262 GTCCAGCTTTACAGTAAGCATGG + Intergenic
1045917181 8:107486071-107486093 ATGGAGCTTTAGAGTGTGGATGG + Intronic
1046048659 8:108993995-108994017 GTTTAGCTTTAGAATCAGGAGGG - Intergenic
1047061529 8:121232055-121232077 GTTTAGGCTAACAGTGAGGAGGG - Intergenic
1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG + Intergenic
1050260355 9:3835161-3835183 GTTTTCCTTTACAGTGAGGCTGG + Intronic
1052751972 9:32501135-32501157 CTGTAGGTTTCCAGAGAGGATGG - Intronic
1052890274 9:33692900-33692922 GTCTAGATTTACAGTGAACAAGG - Intergenic
1054888660 9:70228323-70228345 GTGTAAATTGACATTGAGGATGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057891228 9:98871592-98871614 GTGTAGTCCTACAGTGAGAAGGG - Intergenic
1057949456 9:99358377-99358399 GTGTAGCTATTGACTGAGGAAGG - Intergenic
1059464006 9:114454805-114454827 CTGTAGCTTTACAGTAAGTCTGG - Intronic
1186607173 X:11104451-11104473 GAGTAGCTTTAAAGGAAGGAAGG - Intergenic
1190041361 X:47074908-47074930 TTGACTCTTTACAGTGAGGAGGG - Intergenic
1190408969 X:50115665-50115687 GGGTAGCTTCAGAATGAGGATGG - Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1192580178 X:72274629-72274651 GAGTAGCTTTACTTTGGGGAGGG - Intronic
1195170288 X:102260723-102260745 GTGTAGCCTTCTAGAGAGGAAGG + Intergenic
1195188571 X:102426377-102426399 GTGTAGCCTTCTAGAGAGGAAGG - Intronic
1197995810 X:132371235-132371257 GTGTCTCTTAACAGTGAAGAGGG - Intronic
1198721625 X:139627763-139627785 CTGTATCTTTACAGTGAGGTTGG - Intronic