ID: 934856759

View in Genome Browser
Species Human (GRCh38)
Location 2:97734642-97734664
Sequence CTCATAGCTGACATTGAACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934856754_934856759 26 Left 934856754 2:97734593-97734615 CCCAGAGGAGCTCAAGGACAAGA 0: 1
1: 1
2: 1
3: 24
4: 230
Right 934856759 2:97734642-97734664 CTCATAGCTGACATTGAACTTGG 0: 1
1: 0
2: 2
3: 8
4: 145
934856756_934856759 -4 Left 934856756 2:97734623-97734645 CCTGAAGCGCGATAACCTCCTCA 0: 1
1: 0
2: 0
3: 1
4: 41
Right 934856759 2:97734642-97734664 CTCATAGCTGACATTGAACTTGG 0: 1
1: 0
2: 2
3: 8
4: 145
934856755_934856759 25 Left 934856755 2:97734594-97734616 CCAGAGGAGCTCAAGGACAAGAA 0: 1
1: 0
2: 2
3: 21
4: 239
Right 934856759 2:97734642-97734664 CTCATAGCTGACATTGAACTTGG 0: 1
1: 0
2: 2
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934856759 Original CRISPR CTCATAGCTGACATTGAACT TGG Exonic