ID: 934856759 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:97734642-97734664 |
Sequence | CTCATAGCTGACATTGAACT TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 156 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 8, 4: 145} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
934856754_934856759 | 26 | Left | 934856754 | 2:97734593-97734615 | CCCAGAGGAGCTCAAGGACAAGA | 0: 1 1: 1 2: 1 3: 24 4: 230 |
||
Right | 934856759 | 2:97734642-97734664 | CTCATAGCTGACATTGAACTTGG | 0: 1 1: 0 2: 2 3: 8 4: 145 |
||||
934856756_934856759 | -4 | Left | 934856756 | 2:97734623-97734645 | CCTGAAGCGCGATAACCTCCTCA | 0: 1 1: 0 2: 0 3: 1 4: 41 |
||
Right | 934856759 | 2:97734642-97734664 | CTCATAGCTGACATTGAACTTGG | 0: 1 1: 0 2: 2 3: 8 4: 145 |
||||
934856755_934856759 | 25 | Left | 934856755 | 2:97734594-97734616 | CCAGAGGAGCTCAAGGACAAGAA | 0: 1 1: 0 2: 2 3: 21 4: 239 |
||
Right | 934856759 | 2:97734642-97734664 | CTCATAGCTGACATTGAACTTGG | 0: 1 1: 0 2: 2 3: 8 4: 145 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
934856759 | Original CRISPR | CTCATAGCTGACATTGAACT TGG | Exonic | ||