ID: 934856813

View in Genome Browser
Species Human (GRCh38)
Location 2:97734876-97734898
Sequence TCGGGACACCTGACGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934856813 Original CRISPR TCGGGACACCTGACGGGGGT GGG Intronic
900578188 1:3394457-3394479 TCAGGACCCTCGACGGGGGTGGG + Intronic
912480865 1:109981308-109981330 TGGGGACAGGTGATGGGGGTGGG - Intergenic
919979273 1:202632232-202632254 TCTGGCCTCCTGACTGGGGTGGG + Intronic
1062844525 10:693667-693689 TCAGGAAATCTGACTGGGGTGGG + Intergenic
1067152650 10:43749307-43749329 GCTGGACACCTGACAGTGGTTGG + Intergenic
1067769349 10:49112138-49112160 TTGGGGAACCTGACTGGGGTAGG - Intronic
1076137428 10:128054760-128054782 TCGGGACACCTGTGGGTGGCAGG + Intronic
1077186774 11:1239014-1239036 TCCGGACACCTGCCGTGAGTCGG + Exonic
1078657857 11:13259062-13259084 TCAGGACACCTGTCAGTGGTGGG + Intergenic
1080197717 11:29631731-29631753 ATGGGACACCTGGCTGGGGTGGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1084494572 11:69496582-69496604 TGGGGACAACTGAAGGGGCTTGG + Intergenic
1090432037 11:126654172-126654194 TTGGGACACCTGACAGGTGGCGG + Intronic
1096069684 12:48768058-48768080 GAGGGACACCTGGCTGGGGTGGG + Exonic
1103944593 12:124518915-124518937 TCGGGACAGAGGACGGGGGAGGG - Intronic
1104721688 12:131048018-131048040 TCGGCTCCCCTGAAGGGGGTTGG + Intronic
1107886821 13:44880660-44880682 TGTAGACACCTGGCGGGGGTGGG - Intergenic
1124494870 15:30180188-30180210 TCTGGCCTCCTGACTGGGGTGGG + Intergenic
1124748697 15:32358457-32358479 TCTGGCCTCCTGACTGGGGTGGG - Intergenic
1128789794 15:70424648-70424670 TGGGAGCACCTGACAGGGGTGGG - Intergenic
1136655559 16:31707093-31707115 TCAGGGCACCTGACAGGGCTGGG - Intergenic
1136984392 16:35085166-35085188 TCAGGGCACCTGACAGGGCTGGG - Intergenic
1137291231 16:47053327-47053349 TGGGCACACGTGACGGAGGTCGG + Intergenic
1141487418 16:84349994-84350016 TCTGGAAACTTGAAGGGGGTGGG - Intergenic
1142139690 16:88467385-88467407 TGGGGAGACCTCAGGGGGGTTGG - Intronic
1142850013 17:2700260-2700282 TCGGGGAACCTGACAGGGTTAGG + Intronic
1143610859 17:8016614-8016636 TCGGGACACCTGGCTTGGGTGGG - Intronic
1147368387 17:39974509-39974531 TAGGGAGATCTGACGGGGGCAGG + Intronic
1147717690 17:42519344-42519366 TCTGGACACCTCACTGGAGTCGG + Intronic
1150675757 17:67245052-67245074 CCGGGACACCGGAGGGGAGTCGG + Intronic
1152388989 17:79991883-79991905 TCCGGGCAGCTGGCGGGGGTGGG + Intronic
1157213967 18:45766869-45766891 TGGGGACTCCTGAAGGGGGGAGG - Intergenic
1157479781 18:48046002-48046024 TCGGGAGTCCTGACTGGGGCTGG - Intronic
1165062367 19:33211122-33211144 AAGGGACACCTGCCGGGGGAGGG - Intronic
1168146025 19:54420537-54420559 GCGGGACACCGGCCGGGGGCGGG + Intronic
931393171 2:61862275-61862297 TTGGAACACCTGATGGTGGTGGG + Intergenic
934856813 2:97734876-97734898 TCGGGACACCTGACGGGGGTGGG + Intronic
947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG + Intergenic
947650161 2:231780514-231780536 TGTGGAAACCAGACGGGGGTGGG + Intronic
948406899 2:237728519-237728541 TAGGGAGACCGGGCGGGGGTGGG + Intronic
1169143310 20:3238081-3238103 CCGGGGCGCGTGACGGGGGTCGG - Exonic
1172890528 20:38260759-38260781 TCGGGCCACCAGACGGGGGGCGG + Exonic
1175260495 20:57670913-57670935 TCGGGACACTGGTTGGGGGTTGG - Intronic
1185112024 22:48905472-48905494 GAGGGACACCTGAACGGGGTGGG - Intergenic
956084075 3:65591238-65591260 GGGGGACACCAGGCGGGGGTGGG - Intronic
957156530 3:76551356-76551378 TCAGGAGACCTGAAGTGGGTAGG - Intronic
979566254 4:122157396-122157418 TCCGTGCACCTGACAGGGGTGGG + Intronic
979637833 4:122977794-122977816 TCAGGAGACCTGAAGTGGGTAGG + Intronic
983792314 4:171813348-171813370 GCGGGCCGCCTGGCGGGGGTGGG - Intronic
986867219 5:12003840-12003862 TGGTGACACCTGACAGGGCTAGG - Intergenic
995650147 5:114361262-114361284 TCGGCACCCCGGCCGGGGGTGGG - Intronic
1000029506 5:157389891-157389913 TGGGGACACCTGCCCGGGTTGGG + Intronic
1004229075 6:13814578-13814600 TCGGGACGCGCGCCGGGGGTGGG + Intergenic
1035045579 7:155963384-155963406 TCCTGACACCTGACAGTGGTAGG + Intronic
1057553163 9:96066851-96066873 TGGGGACAGCTGAGGGGGGCTGG + Intergenic
1196783031 X:119399704-119399726 CCGGGAGACCGGACGGGGGTGGG + Intronic