ID: 934857389

View in Genome Browser
Species Human (GRCh38)
Location 2:97737813-97737835
Sequence CGCTGCGGCTGGAGAACTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934857389_934857400 23 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857400 2:97737859-97737881 ATGTGGGAGGCCTTGTCCTACGG 0: 1
1: 0
2: 1
3: 15
4: 202
934857389_934857395 -5 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857395 2:97737831-97737853 CAGCGATGTCTGGAGCTATGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
934857389_934857398 10 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857398 2:97737846-97737868 CTATGGGGTCACCATGTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 126
934857389_934857397 7 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857397 2:97737843-97737865 GAGCTATGGGGTCACCATGTGGG 0: 1
1: 0
2: 1
3: 127
4: 4815
934857389_934857393 -7 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857393 2:97737829-97737851 CGCAGCGATGTCTGGAGCTATGG 0: 1
1: 0
2: 2
3: 4
4: 75
934857389_934857394 -6 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857394 2:97737830-97737852 GCAGCGATGTCTGGAGCTATGGG 0: 1
1: 0
2: 0
3: 14
4: 76
934857389_934857396 6 Left 934857389 2:97737813-97737835 CCGCAAGTTCTCCAGCCGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 934857396 2:97737842-97737864 GGAGCTATGGGGTCACCATGTGG 0: 1
1: 0
2: 2
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934857389 Original CRISPR CGCTGCGGCTGGAGAACTTG CGG (reversed) Exonic
900206551 1:1434221-1434243 CGCAGCCGCTGGAGGACCTGGGG - Intergenic
900372752 1:2339535-2339557 TGCTGCAGCTGCAGAAATTGTGG - Intronic
904679800 1:32221464-32221486 GGCTGGAGCTGGAGGACTTGGGG - Intronic
905327861 1:37170589-37170611 CTCTGCAGCTGGAAAACATGTGG + Intergenic
906136835 1:43505995-43506017 CGCTGTGGATGGGGAACTTGGGG - Intergenic
907043133 1:51281390-51281412 CGAGGCGGCTGGATCACTTGAGG - Intergenic
910526012 1:88179316-88179338 CGAGGCGGATGGATAACTTGAGG + Intergenic
911707532 1:101031051-101031073 AGGTGAGGCTGGAGAACTAGGGG - Intergenic
912859314 1:113198860-113198882 CGCCGCAGCAGGTGAACTTGCGG - Intergenic
912957737 1:114167341-114167363 GGCTGCTGCTGCAGAGCTTGTGG - Intergenic
913063586 1:115229737-115229759 GGCTGAGGCTTGAGAACCTGAGG - Intergenic
914026391 1:143916667-143916689 CGAGGCGGCTGGATCACTTGAGG - Intergenic
914664828 1:149824415-149824437 CGAGGCGGCTGGATCACTTGAGG - Intergenic
914670937 1:149869405-149869427 CGAGGCGGCTGGATCACTTGAGG + Intronic
915408793 1:155684013-155684035 CGAGACGGCTGGAGAACTTGAGG + Intronic
916344454 1:163772131-163772153 CGCTGTGGCTGAGGGACTTGAGG + Intergenic
918034403 1:180853158-180853180 CGAGGCGGGTGGAAAACTTGAGG - Intronic
918440734 1:184564538-184564560 GGCTGAGGCTGGATCACTTGAGG - Intronic
921902211 1:220463100-220463122 CGCTGCAGCTGCAGCACCTGTGG + Intergenic
923478208 1:234357084-234357106 CGCCGCGGTAGGTGAACTTGCGG + Intergenic
923564350 1:235065545-235065567 CGATGCGGGTGGATCACTTGAGG + Intergenic
1063740396 10:8811695-8811717 GGCTGGGGCTGGAAAGCTTGGGG + Intergenic
1063880543 10:10527207-10527229 CGAGGCGGGTGGATAACTTGAGG + Intergenic
1064035997 10:11913773-11913795 CGAGGCGGATGGAGCACTTGAGG + Intergenic
1064378690 10:14820630-14820652 GGCTGCGGCGGGAGAATTTCTGG + Intronic
1065369478 10:24969124-24969146 CGCGGCGGGTGGATCACTTGAGG - Intergenic
1067702787 10:48585741-48585763 CTCTGCTGCTGGAGAGGTTGGGG + Intronic
1071285238 10:84138682-84138704 CGCGGCGGGTGGATCACTTGAGG - Intergenic
1071450740 10:85789919-85789941 TGCTGCCACTGCAGAACTTGGGG - Intronic
1071981850 10:91011384-91011406 CTCAGGGGCTGGAGGACTTGAGG - Intergenic
1074299939 10:112224874-112224896 CCTGGAGGCTGGAGAACTTGCGG - Intergenic
1075141663 10:119842852-119842874 GGCTGAGGCAGGAGAACTGGAGG - Intronic
1075209156 10:120476230-120476252 CCCTGGGGCTGGAGAGCTGGAGG - Intronic
1076536474 10:131181144-131181166 AGCTCTGGCTGGAGAACTGGAGG - Intronic
1081792963 11:45802045-45802067 CTGTGCGGCTTGAGAACTTCTGG - Intergenic
1084934034 11:72577491-72577513 GGCCGCGGATGGTGAACTTGTGG + Exonic
1085150910 11:74252318-74252340 CGATGCGGGTGGATCACTTGAGG - Intronic
1085320137 11:75569000-75569022 TGATGAGGCTGGAGAGCTTGTGG - Exonic
1086742360 11:90383554-90383576 CGATGCGGGTGGATCACTTGAGG + Intergenic
1088100898 11:106154768-106154790 CGAGGCGGCTGGATCACTTGAGG - Intergenic
1088672957 11:112161564-112161586 CGAGGCGGCTGGATCACTTGAGG + Intronic
1089641716 11:119852029-119852051 CTCTGCTTCTGGAGAGCTTGTGG - Intergenic
1090872862 11:130763323-130763345 CACTTCGGCAGGAGGACTTGAGG + Intergenic
1093718201 12:22408039-22408061 CGCTGGAGCTGGGGAAGTTGAGG + Intronic
1094406202 12:30118940-30118962 GCCTGCGGCTGGACAATTTGGGG - Intergenic
1101386784 12:104265523-104265545 CCCTGCGGGTGAAGAACTTCAGG + Intronic
1102048222 12:109843240-109843262 CGAGGCGGCTGGATCACTTGAGG + Intergenic
1102986787 12:117284815-117284837 CGAGGCGGGTGGAGCACTTGAGG + Intronic
1103241583 12:119417776-119417798 CCCTGAGGCTGGAGAAATTGTGG - Intronic
1103316052 12:120056803-120056825 GGCTGCAGCTGGGGAACCTGAGG + Intronic
1103702565 12:122855430-122855452 TGCTGCAGCTGGAGGACTGGGGG - Intronic
1104684401 12:130775431-130775453 CGATGCGGGTGGATCACTTGAGG - Intergenic
1105240916 13:18609305-18609327 CGCTGCGGCCGGAGGAGCTGGGG + Intergenic
1105405748 13:20131246-20131268 GGCTGCGGCTGGGGGACCTGGGG + Intergenic
1112351339 13:98637246-98637268 CGAGGCGGCTGGATCACTTGAGG - Intergenic
1112784275 13:102934644-102934666 CGAGGCGGGTGGATAACTTGAGG + Intergenic
1113931450 13:113971113-113971135 CGATGCGGCTGGAGGCCCTGTGG - Intergenic
1115621329 14:35143392-35143414 CGAGGCGGCTGGATCACTTGAGG - Intronic
1116852479 14:49922311-49922333 CGAAGCGGGTGGATAACTTGAGG + Intergenic
1117124179 14:52603572-52603594 CGCTGAGGCTGGAGTACAAGTGG + Intronic
1118825987 14:69381921-69381943 CGAGGCGGCTGGATCACTTGAGG - Intronic
1118880356 14:69820210-69820232 CCCTGCGGCTGGGGTAGTTGGGG + Intergenic
1119749211 14:77065536-77065558 CGAGGCGGGTGGATAACTTGAGG + Intergenic
1126161679 15:45619729-45619751 GGCTGAGGCTGGATCACTTGAGG + Intronic
1130362009 15:83197932-83197954 GGCTGAGGCAGGAGAACCTGGGG + Intronic
1131388015 15:92023699-92023721 CGAGGCGGCTGGATCACTTGAGG - Intronic
1132276886 15:100574473-100574495 CGATGCGGGTGGATCACTTGAGG + Intronic
1132920318 16:2386214-2386236 CGATGCCGATGGAGAGCTTGCGG - Intergenic
1133122683 16:3620146-3620168 CGATGCGGGTGGATCACTTGAGG - Intronic
1133451530 16:5907981-5908003 CGAAGAGGGTGGAGAACTTGAGG - Intergenic
1133924246 16:10181106-10181128 CGCTGTGCCTGGGGAACTTGGGG + Intronic
1135167828 16:20156345-20156367 CCCTGGGGATGGAGAACTGGTGG - Intergenic
1135189756 16:20345244-20345266 CGAGGCGGGTGGATAACTTGAGG - Intronic
1139339795 16:66260980-66261002 GGCTGCGGCTGGGGAGCCTGGGG - Intergenic
1141570685 16:84931876-84931898 CGCTGCCGCTGGAGAAGCTCCGG + Intergenic
1142264430 16:89057298-89057320 CGCTGGGGCTGGTGACCTCGAGG - Intergenic
1142985647 17:3693995-3694017 CGCGGTGGCTGGATCACTTGAGG - Intronic
1142998928 17:3778328-3778350 CGAGGCGGCTGGATCACTTGAGG + Intronic
1143711949 17:8741543-8741565 CGCTGCGGCTGGAGCACCAGCGG - Exonic
1143810573 17:9468340-9468362 CGAGGCGGCTGGATCACTTGAGG - Intronic
1144481718 17:15635494-15635516 GGCTGTGGCTGGAGTAATTGAGG - Intronic
1144916582 17:18728278-18728300 GGCTGTGGCTGGAGTAATTGAGG + Intronic
1148112069 17:45150110-45150132 GGCTGCGGCTGGAGAGCAAGCGG + Exonic
1149928201 17:60723456-60723478 CGAGGCGGCTGGATCACTTGAGG - Intronic
1151510295 17:74554731-74554753 CGAAGCGGGTGGATAACTTGAGG + Intergenic
1151731502 17:75914182-75914204 AGCTGCGGCTGGAGAAGGAGAGG - Exonic
1152433895 17:80263723-80263745 CGCACTGGCTGCAGAACTTGGGG - Exonic
1153581614 18:6579570-6579592 CTCTGAGGCTGCATAACTTGAGG - Intronic
1153882437 18:9433231-9433253 CGAGGCGGGTGGATAACTTGAGG - Intergenic
1154448054 18:14450603-14450625 CGCTGCGGCCGGAGGAGCTGGGG - Intergenic
1157544496 18:48538769-48538791 CTCTGCGGTGGGAGAACTGGGGG - Intergenic
1158354325 18:56599789-56599811 CGAGGCGGCTGGATCACTTGAGG - Exonic
1158624092 18:59056857-59056879 GGCTGGGGCTGGAGGACCTGAGG - Intergenic
1160903080 19:1438839-1438861 CGCCGCGGTAGGTGAACTTGCGG - Exonic
1161011469 19:1961286-1961308 CGTGGCGGGTGGAGGACTTGAGG + Intronic
1161258367 19:3322144-3322166 CGCTGAGTCTGGAGACCTTGAGG + Intergenic
1163401014 19:17092491-17092513 CGAGGCGGCTGGATCACTTGAGG + Intronic
1163533094 19:17862110-17862132 CCCTGCGGGTGAAGAACTTCGGG + Exonic
1167143942 19:47671221-47671243 CACTGGGGATGGAGGACTTGGGG + Intronic
1167532385 19:50026132-50026154 CGCTGGGGCTGAGGGACTTGCGG + Intronic
1168184517 19:54690760-54690782 CGAGGCGGGTGGATAACTTGAGG - Intronic
1168312512 19:55468007-55468029 GGGTGCGGCCCGAGAACTTGGGG + Intergenic
927104071 2:19809270-19809292 CCCTGAGGCTGGAGGACTTGGGG - Intergenic
928360048 2:30655420-30655442 CGCTGTGGCTGGAGGCCGTGAGG + Intergenic
932091616 2:68810972-68810994 CAAGGCGGGTGGAGAACTTGAGG - Intronic
934857389 2:97737813-97737835 CGCTGCGGCTGGAGAACTTGCGG - Exonic
937325636 2:120988395-120988417 AGCGGCGGCTGGAGAAGTAGGGG - Exonic
938053295 2:128194497-128194519 CGATGCGGGTGGATCACTTGAGG - Exonic
941986690 2:171517659-171517681 CGCCGCGGTAGGTGAACTTGCGG + Intergenic
944561618 2:200944770-200944792 CGAGGCGGGAGGAGAACTTGAGG - Intronic
947619014 2:231576679-231576701 TGCTGGGGCTGGGGCACTTGGGG + Intergenic
948886730 2:240888509-240888531 CGCTGCGGGTGGAGGAAGTGGGG + Exonic
949043598 2:241860250-241860272 CTCTGGGGCTGGAGAACTGTTGG + Intergenic
1172315841 20:33953608-33953630 GGCTTGGGCTGGAGAACTTCTGG - Intergenic
1172584958 20:36076724-36076746 CGCAGCGCCTGCAGAACTTTCGG - Intergenic
1172897246 20:38308990-38309012 CGTTGCTGATGGAGAACTTAAGG - Exonic
1173633551 20:44534699-44534721 CGATGCGGGTGGATCACTTGAGG - Intronic
1174554480 20:51383947-51383969 CCTGGAGGCTGGAGAACTTGGGG + Intergenic
1175562304 20:59940427-59940449 CGCTGCGGCAGGGGAGCTGGAGG - Intronic
1175620939 20:60446973-60446995 AGCAGAGGCTGGAGGACTTGAGG + Intergenic
1175888794 20:62306977-62306999 CGGTGGGGCTGGAGGACTGGAGG + Intronic
1176149332 20:63581332-63581354 TGCTGGGGCTGGAGATGTTGGGG + Intergenic
1179527584 21:41992879-41992901 CGATGCGGTTGTAGCACTTGAGG + Exonic
1180063991 21:45404046-45404068 GGCTGCGGCTGGAGAGCTCCAGG + Intergenic
1180832503 22:18913214-18913236 TGCTGTGGCTGGAGCTCTTGAGG - Exonic
1181067344 22:20313155-20313177 TGCTGTGGCTGGAGCTCTTGAGG + Intergenic
1181098478 22:20522613-20522635 GGCTGTGGCAGGAGAACTGGTGG - Intronic
1182424210 22:30263651-30263673 CACTGGGCCTGGGGAACTTGGGG + Exonic
1182488164 22:30651929-30651951 GGCTGGGGCTGGAGGATTTGTGG + Intronic
1182561067 22:31159939-31159961 CGCGGCGGATGGATCACTTGAGG - Intergenic
1184125170 22:42481682-42481704 CGAGGCGGGTGGATAACTTGAGG + Intergenic
1203282589 22_KI270734v1_random:138519-138541 TGCTGTGGCTGGAGCTCTTGAGG - Intergenic
950489529 3:13295177-13295199 CCCAGTGGCTGGAGGACTTGGGG - Intergenic
950527483 3:13532881-13532903 CCCTGAGGCTGGAGACATTGGGG + Intergenic
951851895 3:27150976-27150998 TGCTGCAGCTGGAGCATTTGGGG - Intronic
954025040 3:47776367-47776389 CGCGGCGGGTGGACCACTTGAGG + Intronic
954224137 3:49171843-49171865 AGGGGTGGCTGGAGAACTTGGGG + Intronic
954404464 3:50337707-50337729 TGCAGCGGGTGGAGTACTTGCGG + Intronic
956408196 3:68950628-68950650 CGATGCGGGTGGATCACTTGAGG + Intergenic
961210399 3:125120795-125120817 AGCTGCAGCTGGAGGGCTTGCGG - Intronic
963969413 3:151413263-151413285 CTCTGCTGCTGTCGAACTTGCGG - Exonic
968050084 3:195648217-195648239 CCGTGCGGCTGGAGACCTGGTGG + Intergenic
968186116 3:196634520-196634542 TGCTGAGGCTGGAGAAGTGGGGG + Intergenic
968903851 4:3442976-3442998 GGCTGCGGCTGGAGGTCCTGAGG + Intronic
969021790 4:4143887-4143909 TGGAGCGGCTGGAGAAGTTGAGG - Intergenic
969732078 4:8963528-8963550 TGGAGCGGCTGGAGAAGTTGAGG + Intergenic
969791671 4:9497613-9497635 TGGAGCGGCTGGAGAAGTTGAGG + Intergenic
974048232 4:56915153-56915175 CGCGGCGGGTGGATCACTTGAGG - Intronic
981697321 4:147572340-147572362 CGAGGCGGGTGGATAACTTGAGG - Intergenic
982240499 4:153295307-153295329 AGCTGCGACTGGAGGACCTGCGG - Exonic
982456700 4:155618643-155618665 CGCTGGGGCTGCAGATCTTTTGG + Intergenic
985818597 5:2144952-2144974 TGCTGTGGCTGGACAACCTGTGG - Intergenic
985967272 5:3347341-3347363 AGCTGGCGCTGGAGAAATTGTGG - Intergenic
987391607 5:17381442-17381464 CGAGGCGGGTGGATAACTTGAGG + Intergenic
988255129 5:28810030-28810052 CGCTGGGACTCGAGAACTGGAGG - Intergenic
988747713 5:34158337-34158359 CGCGGCGGGTGGATCACTTGAGG - Intergenic
990824970 5:59888992-59889014 CGAGGCGGGTGGATAACTTGAGG + Intronic
991642526 5:68769285-68769307 CTTTGCGGCTGGAGAATCTGAGG - Intergenic
991936902 5:71810976-71810998 CGCTGCAGCTGCAGAGCCTGAGG - Intergenic
992808307 5:80360397-80360419 CGAGGCGGGTGGATAACTTGAGG - Intergenic
994640216 5:102398408-102398430 CGTTGCGGATGGATCACTTGAGG - Intronic
995727844 5:115201489-115201511 TGCTGCTGCTGGAGAAGGTGAGG - Intergenic
996380156 5:122855170-122855192 GGCTGAGGCAGGAGAAATTGTGG - Intronic
998204650 5:140149859-140149881 GGCTGCTGCTGGATAACCTGCGG - Intergenic
999249576 5:150174306-150174328 CTCTGAGGCCGAAGAACTTGAGG - Intronic
999358144 5:150956726-150956748 CCCAGCCGGTGGAGAACTTGTGG - Intergenic
999935250 5:156479326-156479348 CGAGGCGGCTGGATCACTTGAGG - Intronic
1001570254 5:172726047-172726069 CCCTGCGGCTGGGGAACTGGTGG - Intergenic
1002845636 6:942095-942117 ACCTGGGGCTGGGGAACTTGAGG + Intergenic
1003106380 6:3219581-3219603 TCCTGCAGCAGGAGAACTTGAGG + Intergenic
1003887519 6:10534744-10534766 CTCAGCTGCTGGAGAAGTTGAGG + Intronic
1004937516 6:20522419-20522441 CGCTGAGGCTGGAGAAGGTTAGG - Intergenic
1005006294 6:21290511-21290533 GGCTGAGGCAGGAGAACCTGTGG + Intergenic
1007280785 6:40710720-40710742 CCCTGCGGCTGGAGAAACTGAGG + Intergenic
1007371616 6:41429896-41429918 CGCAGGGGCTGGAGAGCCTGTGG - Intergenic
1008931001 6:56939790-56939812 CGAGGCGGCTGGATCACTTGAGG + Intronic
1009170810 6:60396377-60396399 CGATGCGGGTGGATCACTTGAGG + Intergenic
1010123506 6:72406935-72406957 CTCTGCTCCTGGAGAAATTGGGG - Intergenic
1011603576 6:89081337-89081359 GGCTGCGGCTGCAGGACTCGGGG - Exonic
1012989430 6:105910146-105910168 CTTTGCTGCTGGAGAATTTGAGG - Intergenic
1017182298 6:151564938-151564960 CCCTGCTGCTGGAGAAGGTGGGG + Intronic
1017584972 6:155910262-155910284 CGAGGCGGGTGGATAACTTGAGG - Intergenic
1017878654 6:158544568-158544590 CACTGAGGCTGAAGAAATTGGGG - Intronic
1018021474 6:159765346-159765368 CGAGGCGGGTGGATAACTTGAGG - Intronic
1019343105 7:517681-517703 GGATGCGGGTGGAGAATTTGGGG - Intronic
1019469848 7:1213460-1213482 CGAGGCGGCTGGATAACCTGAGG - Intergenic
1021548565 7:21844178-21844200 AGCTGAGGCTGGATCACTTGAGG + Intronic
1023071075 7:36434629-36434651 CGAGGCGGCTGGATCACTTGAGG + Intronic
1024798697 7:53050634-53050656 CTCAGCGACTGCAGAACTTGGGG + Intergenic
1025948906 7:66127876-66127898 GGCTGAGGCTGGATCACTTGAGG + Intronic
1027893269 7:84005713-84005735 CGATGCGGGTGGATCACTTGAGG + Intronic
1030142412 7:106318720-106318742 AGCTGGGACTGGAGAAGTTGGGG + Intergenic
1031048432 7:116920571-116920593 GTCTGGGGCTGGAGAAATTGAGG + Exonic
1032032676 7:128497581-128497603 GGCTGAGGCAGGAGAACTTCTGG - Intronic
1034494476 7:151411351-151411373 CCCTGCGGCTGCAGCCCTTGGGG + Intergenic
1034648376 7:152669141-152669163 GGCTGAGGCAGGAGTACTTGAGG + Intronic
1036505589 8:9352360-9352382 CGAGGCGGGTGGAGCACTTGAGG - Intergenic
1042067339 8:64892602-64892624 GGCTGAGGCTGGATCACTTGAGG - Intergenic
1046131330 8:109972325-109972347 CGCAGGAGCTGGAGAACGTGGGG - Exonic
1050731367 9:8713525-8713547 CGCTGCGGGTGAAGAACTTCGGG + Intronic
1052192755 9:25678016-25678038 GGCTGCGGCTCGAGAACCGGCGG - Exonic
1052922604 9:33984002-33984024 CGCTGAGGCACGAGAACTGGGGG - Intronic
1052963311 9:34319186-34319208 TGATGAGGCTGGAGAGCTTGTGG - Intronic
1060353939 9:122886120-122886142 CGAGGCGGGTGGATAACTTGAGG - Intronic
1060621976 9:125075795-125075817 CGAGGCGGTTGGAAAACTTGAGG - Intronic
1060743603 9:126115317-126115339 GGCTGCTGATGGAGAAGTTGAGG - Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062718517 9:138023064-138023086 AGCTACGGCTGCAGAACCTGCGG + Exonic
1185465334 X:351085-351107 CGCTCCGGCTGGCGCACCTGTGG + Intronic
1186325808 X:8475614-8475636 CGATGCGGGTGGATCACTTGAGG + Intergenic
1186436520 X:9547550-9547572 CAAGGCGGGTGGAGAACTTGAGG - Intronic
1189418287 X:40833375-40833397 CGCAGCGGGTGGATCACTTGAGG + Intergenic