ID: 934858945

View in Genome Browser
Species Human (GRCh38)
Location 2:97748184-97748206
Sequence CACAGGGCAATGGCTACATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934858941_934858945 -4 Left 934858941 2:97748165-97748187 CCTGTTGAAAGTTTATTAGCACA No data
Right 934858945 2:97748184-97748206 CACAGGGCAATGGCTACATTAGG No data
934858939_934858945 15 Left 934858939 2:97748146-97748168 CCTGAGGCCATGTTTCTTACCTG No data
Right 934858945 2:97748184-97748206 CACAGGGCAATGGCTACATTAGG No data
934858940_934858945 8 Left 934858940 2:97748153-97748175 CCATGTTTCTTACCTGTTGAAAG No data
Right 934858945 2:97748184-97748206 CACAGGGCAATGGCTACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934858945 Original CRISPR CACAGGGCAATGGCTACATT AGG Intergenic
No off target data available for this crispr