ID: 934860365

View in Genome Browser
Species Human (GRCh38)
Location 2:97759486-97759508
Sequence GTGTGGATGAGGGAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1470
Summary {0: 1, 1: 0, 2: 7, 3: 150, 4: 1312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934860354_934860365 5 Left 934860354 2:97759458-97759480 CCTGGTCCACTGCCCCTCTGGGC 0: 1
1: 0
2: 4
3: 24
4: 319
Right 934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG 0: 1
1: 0
2: 7
3: 150
4: 1312
934860359_934860365 -8 Left 934860359 2:97759471-97759493 CCCTCTGGGCTGCTGGTGTGGAT 0: 1
1: 0
2: 3
3: 44
4: 256
Right 934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG 0: 1
1: 0
2: 7
3: 150
4: 1312
934860351_934860365 15 Left 934860351 2:97759448-97759470 CCGTGTCGAGCCTGGTCCACTGC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG 0: 1
1: 0
2: 7
3: 150
4: 1312
934860358_934860365 -7 Left 934860358 2:97759470-97759492 CCCCTCTGGGCTGCTGGTGTGGA 0: 1
1: 0
2: 3
3: 29
4: 288
Right 934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG 0: 1
1: 0
2: 7
3: 150
4: 1312
934860360_934860365 -9 Left 934860360 2:97759472-97759494 CCTCTGGGCTGCTGGTGTGGATG 0: 1
1: 0
2: 3
3: 53
4: 357
Right 934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG 0: 1
1: 0
2: 7
3: 150
4: 1312
934860355_934860365 -1 Left 934860355 2:97759464-97759486 CCACTGCCCCTCTGGGCTGCTGG 0: 1
1: 0
2: 4
3: 77
4: 587
Right 934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG 0: 1
1: 0
2: 7
3: 150
4: 1312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934860365 Original CRISPR GTGTGGATGAGGGAGGAAGA GGG Intronic
900384011 1:2401207-2401229 GGGAGGAGGAGGGAGGAGGAGGG - Intronic
900384027 1:2401247-2401269 GGGTGGAGGAGGGAGGAAGGAGG - Intronic
900384062 1:2401345-2401367 GGGAGGAGGAGGGAGGAAGGAGG - Intronic
900384070 1:2401366-2401388 GGGAGGAGGAGGGAGGAAGGAGG - Intronic
900384073 1:2401376-2401398 GGGAGGAGGAGGGAGGAGGAGGG - Intronic
900384077 1:2401386-2401408 GGGAGGAGGAGGGAGGAGGAGGG - Intronic
900391595 1:2436233-2436255 GAGGGGAGGAGGGAGGAAGGAGG - Intronic
900391677 1:2436467-2436489 GAGGGGAGGAGGGAGGAAGGAGG - Intronic
900821310 1:4891088-4891110 ATGTGCAAGAGAGAGGAAGAGGG + Intergenic
900874847 1:5334860-5334882 TTGTGAATGAGGCAGGAAGGAGG + Intergenic
900968478 1:5975993-5976015 GAGGGGTTGAGGGAGGAGGAGGG + Intronic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901118491 1:6869182-6869204 TTCTGGAAGAGAGAGGAAGATGG + Intronic
901465190 1:9416901-9416923 CTGTGGCTGAGGGAGGCACAGGG - Intergenic
901685280 1:10940365-10940387 GGGAGGAGGAGGGAGGAGGAAGG + Intergenic
902346043 1:15818435-15818457 GGGAGGCTGAGGGGGGAAGATGG + Intergenic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902729153 1:18357295-18357317 GTGGGGATGAGGGTGGAAATGGG + Intronic
902817604 1:18925239-18925261 CTGAGGAGGAGAGAGGAAGAGGG - Intronic
902904831 1:19548526-19548548 GGGAGGCTGAGGTAGGAAGATGG + Intergenic
903154868 1:21436549-21436571 GGGTAGAGGAGGGAGGCAGAAGG - Intergenic
903290832 1:22313330-22313352 GTGTGGAGGAGGGAGGGTCATGG - Intergenic
903331706 1:22600042-22600064 GAGTGGAGGAGGAAGGAAGGGGG + Intronic
903453491 1:23470794-23470816 GTGGGAAGCAGGGAGGAAGAGGG + Intronic
903488325 1:23708111-23708133 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
904340360 1:29830175-29830197 GGGTGGAGGAAGGGGGAAGAAGG + Intergenic
904455864 1:30647733-30647755 GGGTGGAGGAAGGGGGAAGAAGG - Intergenic
904480055 1:30787912-30787934 GTGTGGGTCAGGGAGAGAGAAGG - Intergenic
904910991 1:33934084-33934106 GTGTGCATGTGGCAGGAAGAAGG + Intronic
905459173 1:38111184-38111206 GAGTTGATGCTGGAGGAAGAAGG + Intergenic
905469435 1:38180791-38180813 ATCTGGATGGTGGAGGAAGAGGG + Intergenic
905966683 1:42104423-42104445 CAGTGGGCGAGGGAGGAAGAGGG - Intergenic
905973141 1:42155882-42155904 GTGTGGATTGAGGAGAAAGACGG + Intergenic
906075849 1:43051577-43051599 GAGTGGATGAGTGAGGAAAGAGG - Intergenic
906078570 1:43069120-43069142 GTGGGGCTGAAGGAGGGAGATGG + Intergenic
906093815 1:43206087-43206109 ATGTGCCTGAGGCAGGAAGATGG - Intronic
906172682 1:43740854-43740876 GAGTGAGGGAGGGAGGAAGAGGG + Intronic
906341792 1:44987132-44987154 GGGAGGCTGAGGGAGGAAAATGG - Intergenic
906414553 1:45610702-45610724 GAGAGACTGAGGGAGGAAGATGG - Intronic
906553343 1:46685589-46685611 GTTTGGATGAGGTAGGACAAAGG + Intronic
906747437 1:48231815-48231837 TTGGGGGTGAAGGAGGAAGATGG - Intronic
906782537 1:48585484-48585506 GTGTGTATGGGGCATGAAGAGGG + Intronic
906951836 1:50341105-50341127 GGGAGGAGGAGGGAGGAGGAGGG - Intergenic
907148680 1:52261340-52261362 GGGAGGCTGAGGCAGGAAGATGG - Intronic
907365939 1:53960023-53960045 GGGAGGCTGAGGCAGGAAGATGG - Intronic
907415351 1:54310583-54310605 GGGTGGGGGAGGGAGGAAGTGGG - Intronic
907416270 1:54316236-54316258 GGGAGGCTGAGGGAGGAGGATGG + Intronic
907527592 1:55062978-55063000 GGGTGGATGTGGGTGGGAGAGGG + Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
907972276 1:59394760-59394782 GTCTGGATAAGGGTTGAAGATGG - Intronic
907988978 1:59560789-59560811 GTGTGGTGGAAGTAGGAAGAAGG + Intronic
908302469 1:62775893-62775915 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
908502653 1:64759619-64759641 GGGAGGCTGAGGCAGGAAGATGG - Intronic
909442762 1:75716364-75716386 GGGAGGCTGAGGAAGGAAGATGG + Intergenic
909638753 1:77848261-77848283 GTGTGGAAAAGGGAGAAAGATGG + Intronic
909929376 1:81477925-81477947 GTGTGGCTCAGGAAGGAAGAGGG + Intronic
910755425 1:90685309-90685331 GGGAGGCTGAGGTAGGAAGATGG - Intergenic
911185723 1:94902707-94902729 GTGTGTATGAGGAAGGAAAATGG - Intronic
911471611 1:98326199-98326221 GTGAGGCTGAGGCAGGAGGATGG + Intergenic
912078304 1:105906359-105906381 ATTTGTATGAGGGAGGAAGAAGG + Intergenic
912219750 1:107659884-107659906 GTGCGGATGAGGGATGGAAAAGG - Intronic
912323067 1:108732876-108732898 GGGAGGATGAGGCAGGAGGATGG - Intronic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912850344 1:113118767-113118789 GGGAGGCTGAGGCAGGAAGATGG - Intronic
912961923 1:114203601-114203623 ATGTGAAATAGGGAGGAAGAGGG + Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913224964 1:116690969-116690991 GTGTAGAGGAGGTAGTAAGAGGG + Intergenic
913240479 1:116825715-116825737 GAATGGAGAAGGGAGGAAGAGGG - Intergenic
913252983 1:116927636-116927658 GGGAGGCTGAGGCAGGAAGATGG - Intronic
913502974 1:119488816-119488838 GAGAGGTTGAGGGAGGAAGAGGG + Intergenic
913693870 1:121305563-121305585 GTGTGGGAGATGGAGGAAGAGGG - Intronic
914143694 1:144974503-144974525 GTGTGGGAGATGGAGGAAGAGGG + Intronic
914312087 1:146475683-146475705 GGGAGACTGAGGGAGGAAGATGG + Intergenic
914502264 1:148257652-148257674 GGGAGACTGAGGGAGGAAGATGG - Intergenic
914695725 1:150077646-150077668 CTGTGGGTGAGAGAGAAAGATGG - Intronic
914837238 1:151217684-151217706 GTGAGGCTGAGGTGGGAAGATGG - Intronic
915350862 1:155224634-155224656 GGGTGGCTGAGGCAGGAGGATGG + Intergenic
915360584 1:155284259-155284281 GTGGGGAGGAGGGAGGAAAGGGG + Intronic
915389141 1:155525140-155525162 GGGAGGATGAGGCAAGAAGATGG + Intronic
915690370 1:157682879-157682901 GAGTGGAAGAATGAGGAAGAAGG + Intronic
916031438 1:160880927-160880949 GTGTGGATGGGTCAGGGAGAAGG - Intronic
916118638 1:161509314-161509336 GGGTGGATGAGGGATGATTAAGG + Intronic
916840002 1:168590282-168590304 GGCGGGATGAGGTAGGAAGAAGG + Intergenic
916889604 1:169103503-169103525 GTGTGGCTGGGCGTGGAAGAGGG - Intergenic
917621501 1:176801304-176801326 GTGTGCATCAGGGAAGAAGCTGG - Intronic
917735434 1:177915798-177915820 GTGGGGGTGAGGCAGGAGGAGGG - Intergenic
917744741 1:177996466-177996488 GGGTGGCTGAGGGAGGAGGAAGG + Intergenic
917918089 1:179724611-179724633 GAGTGGATGAGGCAGAAACAGGG - Intergenic
918138479 1:181699793-181699815 GTTGGGATGAGAAAGGAAGAAGG + Intronic
918196305 1:182225569-182225591 GTGGGGAGGAGGGATAAAGAGGG - Intergenic
918234661 1:182569240-182569262 GCGTAGAGGAGGGAGGAAAAAGG - Intergenic
918503820 1:185229140-185229162 ATGAGGGTGAGGCAGGAAGAGGG + Intronic
918530679 1:185517675-185517697 GTGGGGTTGAGGGAGGGGGAAGG + Intergenic
919434184 1:197536026-197536048 GGATGGGAGAGGGAGGAAGATGG + Intronic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919986073 1:202676168-202676190 GTGGGGGGAAGGGAGGAAGATGG - Intronic
920073610 1:203321237-203321259 TAGGGGACGAGGGAGGAAGAAGG + Intergenic
920313993 1:205065041-205065063 GGGTGGATGGGGGAGGAAATGGG - Intronic
920481194 1:206323942-206323964 GTGTGGGAGATGGAGGAAGAGGG - Intronic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
920613596 1:207467010-207467032 GTAATGATGAGGGTGGAAGAAGG + Intronic
920825667 1:209422404-209422426 AAATGGATGAGGTAGGAAGAAGG - Intergenic
920958479 1:210641883-210641905 TTGTGGAAGAGGGTGTAAGAAGG - Intronic
921239394 1:213162520-213162542 GAGAGGCTGAGGCAGGAAGATGG - Intronic
921339156 1:214117243-214117265 GAGTGAAAGAGGGAGGAAAAAGG + Intergenic
921695483 1:218204295-218204317 GTCTGGAAGAGGGAGCTAGAAGG - Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921966887 1:221099802-221099824 GTTTAGATGAGAGAGGAAGGAGG + Intergenic
922203364 1:223425814-223425836 GTGTGCATGAAGGAGGAAAGAGG - Intergenic
922429048 1:225528906-225528928 GTGGGGATGAGGGAAGGAGAGGG - Intronic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
922531686 1:226349920-226349942 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
922640196 1:227222392-227222414 GTGTGGCTGAGGCATGAGGAAGG + Intronic
922722617 1:227906443-227906465 GGGAGGAGGAGGGAGGAGGAGGG - Intergenic
922885141 1:229014154-229014176 GGGAGGAAGAGGGAGGAAGAAGG + Intergenic
923039327 1:230308600-230308622 GTGGGGAGGCGGGAGGAAGGAGG + Intergenic
923052151 1:230396405-230396427 GTGGGGATGGGGGAGGAGGGTGG - Intronic
923145495 1:231194877-231194899 GTGAGGATGAGGGAGGAAAGCGG + Intronic
923275179 1:232389208-232389230 GGGAGGCTGAGGGAGGAGGATGG + Intergenic
923482544 1:234397654-234397676 GAGGGGAGGAGGGGGGAAGAGGG + Intronic
923668109 1:236016372-236016394 GTGAGGAAGAGGCAAGAAGATGG + Intronic
924002440 1:239568716-239568738 GAATGGATGATGGAAGAAGAGGG - Intronic
924441806 1:244092519-244092541 GTGTTGGTGAGTGAGGTAGAGGG - Intergenic
924498122 1:244609799-244609821 GGGAGGCTGAGGCAGGAAGATGG + Intronic
924514483 1:244754596-244754618 GGGTGGATGAATGAGGAAGGGGG + Intergenic
924589287 1:245387864-245387886 AAGTGGATGAGGGAGAGAGATGG - Intronic
924807715 1:247374209-247374231 ATGAGGAAGAGGGAGGAATACGG - Intergenic
924907344 1:248470116-248470138 GTCTGGAGGATGGAGCAAGATGG - Intergenic
1062811578 10:470424-470446 GTGTGGAAGAGAGAGGCACATGG - Intronic
1063113399 10:3055575-3055597 GAGAGCATGAGGGAGTAAGAGGG + Intergenic
1063374983 10:5548880-5548902 GTGTGGATAAGGGAGAGGGAGGG - Intergenic
1063428246 10:5966103-5966125 GGGTGGGGGAGGGAGGAAGGTGG + Intronic
1063604428 10:7509750-7509772 GTGAGGAGGAGGGATGAATAGGG - Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064026633 10:11853798-11853820 GTGTGCAGTAGGGAGGAGGAAGG - Intronic
1064054742 10:12087870-12087892 GGGAGGATGAGGCAGGAGGATGG + Intronic
1064068208 10:12201866-12201888 GTGGGGTTGAGGGAGGAAGTGGG + Intronic
1064227822 10:13503172-13503194 GTGGCAATGAGGGAGGAAGGTGG + Intronic
1064231909 10:13536653-13536675 GGGAGGAGGAGGGAGGAGGAGGG + Intergenic
1064419692 10:15180074-15180096 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1064595597 10:16941735-16941757 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1064704853 10:18061028-18061050 GTGGGGAGGAGGGATAAAGAGGG + Intergenic
1065021893 10:21508566-21508588 GTGTGTAAGAGGGAGAGAGAGGG + Intergenic
1065586173 10:27219195-27219217 GCGAGGCTGAGGCAGGAAGACGG + Intronic
1065667764 10:28081288-28081310 GTGTGGGTGAGGGAGGGAGCAGG - Intronic
1065884557 10:30065604-30065626 AGGAGGCTGAGGGAGGAAGATGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066051775 10:31643181-31643203 GTGAAGACCAGGGAGGAAGAAGG - Intergenic
1067023989 10:42827594-42827616 GTGGGGATAAGGAAGCAAGAGGG - Intronic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1067456188 10:46420902-46420924 GTGGGGAAGAGGGAAGAAGGGGG + Intergenic
1067490832 10:46700338-46700360 GGGATGATGAGGGAGGAGGATGG + Intergenic
1067506344 10:46854171-46854193 GGGATGATGAGGGAGGAGGATGG + Intergenic
1067557814 10:47284881-47284903 AGGAGGAGGAGGGAGGAAGAAGG + Intergenic
1067603831 10:47640029-47640051 GGGATGATGAGGGAGGAGGATGG - Intergenic
1067631011 10:47963737-47963759 GTGGGGAAGAGGGAAGAAGGGGG - Intergenic
1067833192 10:49621945-49621967 GTGGGGATGAGGGAGGGAGGAGG + Intronic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1068099436 10:52533067-52533089 GTGGGGGAGAGGGAAGAAGAAGG - Intergenic
1068153549 10:53166575-53166597 GTGTGGATGGGGCAGGAAGGGGG - Intergenic
1068216421 10:53988317-53988339 GTGTGGAGGATGGAGGCTGAAGG - Intronic
1068678604 10:59794356-59794378 GGATGGAGGAGGCAGGAAGAAGG + Intronic
1069189839 10:65473306-65473328 CTCTGGATGAGGGAGAAGGAAGG - Intergenic
1069251276 10:66270307-66270329 GTGGGGCTGAGGCAGGAGGATGG - Intronic
1069265648 10:66454084-66454106 GTTTGGATGATGGAGGAAAGAGG + Intronic
1069870423 10:71529608-71529630 GTGTGACGGAGGGAGGAATAGGG - Intronic
1069954656 10:72042638-72042660 GTGAGGATGGGGGAGGAACCAGG + Intergenic
1070029649 10:72664735-72664757 GGGTGGCTGAGGGAGGAGAATGG - Intergenic
1070051655 10:72895542-72895564 GGGGTGATGAGGGAGGAGGATGG + Intronic
1070431677 10:76346205-76346227 GAGTGGAAGAGAGTGGAAGAGGG + Intronic
1070724726 10:78780239-78780261 GTATGTCTGAGGGAGGAAGAGGG - Intergenic
1070776799 10:79114537-79114559 GTGTGAAGGTGGGAGGGAGAAGG + Intronic
1070957668 10:80474840-80474862 GGGGTCATGAGGGAGGAAGAGGG - Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071689811 10:87805188-87805210 GTGTGAATGTGGGAGGAGGAAGG - Intronic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072019629 10:91385296-91385318 GAGTGGGTGAGTAAGGAAGAGGG - Intergenic
1072281668 10:93871296-93871318 GGGTGGCTGAGGGAGGAGAATGG - Intergenic
1072288645 10:93941559-93941581 GTGTGGGTGAGAGAGGAAGGGGG - Intronic
1072548081 10:96456089-96456111 GTGAGGATTAGGTAGTAAGAAGG + Intronic
1072581236 10:96741785-96741807 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1072622733 10:97090684-97090706 GGGTGGAAAAGGGCGGAAGAGGG + Intronic
1072754922 10:98013026-98013048 GTGGGGATGGGGGAGGAAATGGG + Intronic
1072804350 10:98415207-98415229 GGGTGGAGCAGGGAGGAAGCAGG + Intergenic
1072922295 10:99586311-99586333 GTGAGGGTGAGGCAGGATGATGG - Intergenic
1072965594 10:99970040-99970062 GAGTGGTTGAGGGAGAAAGGTGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073597693 10:104817343-104817365 GGGTGGAAGAGGGGGGAGGAGGG - Intronic
1074026676 10:109642943-109642965 GTGGGGCTGGGGCAGGAAGAGGG - Intergenic
1074257933 10:111821920-111821942 CTGAAGATGAGGGTGGAAGATGG - Intergenic
1074341759 10:112637848-112637870 GTGTGGATTAGGGAGTAAAATGG + Intronic
1074524869 10:114254473-114254495 GGGTGGAAGAGGAAGGAATATGG - Intronic
1074789800 10:116875448-116875470 GAGAGGGTGAGGTAGGAAGATGG - Intronic
1074867674 10:117554280-117554302 GTGTGGGGTAGGGAGGAGGATGG - Intergenic
1074885752 10:117691880-117691902 GAGTGGAGGAAGGAGGAAGCAGG - Intergenic
1075185037 10:120248289-120248311 GTGGGGGTGAGGGAGGCAGGAGG - Intergenic
1075291800 10:121237106-121237128 CTGTGGATGTAGGAGGAAGTGGG + Intergenic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1076029364 10:127144299-127144321 GTGTGGATGAGGCAGGGGGGAGG - Intronic
1076126525 10:127978434-127978456 GGGTGGCTGAGGCAGAAAGACGG + Intronic
1076238531 10:128884285-128884307 GTTGTGATGAGGGAGGAGGAAGG - Intergenic
1076531545 10:131148258-131148280 GTGAGGAAGAGATAGGAAGATGG + Intronic
1076778132 10:132709385-132709407 GAGAGGAGGAGGGAGGAAGGAGG + Intronic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1077238381 11:1496352-1496374 GTGTGGAGGAGGCAGGAACCAGG + Intronic
1077238944 11:1500683-1500705 GTGTGGGTGAGGGACGTAGGGGG - Intronic
1077272257 11:1686833-1686855 GGGAGGAGGAGGGAGGAGGAAGG - Intergenic
1077290245 11:1786160-1786182 GTGGGGAAGAGGGGGGAACAGGG - Intergenic
1077346131 11:2055799-2055821 GTGTGGATAATGGAGTATGAAGG - Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077478900 11:2803774-2803796 GTGGGGATGAGAGGGGAGGAGGG - Intronic
1078443035 11:11383267-11383289 GGGTAGATGAGGAAGGGAGAAGG - Intronic
1078907342 11:15699885-15699907 GAATGAATGAAGGAGGAAGAAGG - Intergenic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079445542 11:20553561-20553583 GGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1079445545 11:20553571-20553593 GGGAGGGGGAGGGAGGAAGAGGG - Intergenic
1079929942 11:26545783-26545805 AGGAGGAAGAGGGAGGAAGAGGG - Intronic
1080520515 11:33064500-33064522 GTGTGGCTGAGGGAAGGAGAAGG - Intronic
1080903188 11:36514988-36515010 GTGTGGTTGAGGCAGGGAGAAGG + Intronic
1081096975 11:38948730-38948752 GTTTGAATGAGACAGGAAGAGGG + Intergenic
1081606449 11:44530085-44530107 ATGAGGATGATGGAGCAAGAGGG - Intergenic
1081693007 11:45090800-45090822 GTGTGAATGAGGCTGGCAGAGGG + Intergenic
1081727038 11:45337437-45337459 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
1081794569 11:45810733-45810755 GTGGGGAAGGGTGAGGAAGAGGG - Intronic
1081977496 11:47244954-47244976 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
1082069905 11:47930913-47930935 GAGTTGAAGAAGGAGGAAGAAGG - Intergenic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1082278791 11:50247613-50247635 GGCTGGGTGAGGGAGGAAGCAGG - Intergenic
1082812833 11:57489028-57489050 GTGTGGAGGCTGGAGGAAGGAGG + Intronic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1083296174 11:61716850-61716872 GTGTGGGTGGGGGAAGAAGGAGG + Intronic
1083401177 11:62424489-62424511 GGGAGGCTGAGGTAGGAAGATGG + Intergenic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1083762058 11:64824126-64824148 GTTGGGATGAGGGATGGAGAGGG - Exonic
1083763293 11:64830255-64830277 GTCTGGTAGAGGGAGGCAGAGGG + Exonic
1084149090 11:67279822-67279844 GTATGGCTAAGGGAGGAAGCTGG - Exonic
1084155069 11:67308654-67308676 GTGTGGATGGGGGAGGAGAGTGG - Intronic
1084178909 11:67437107-67437129 GTGGTGGGGAGGGAGGAAGAGGG - Intronic
1084716322 11:70876453-70876475 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1084919556 11:72458127-72458149 GTGAGGGAGAGGGAGGAAGGAGG + Intergenic
1085008965 11:73122608-73122630 GTGTTAATGAGGGAAAAAGAAGG + Intronic
1085189628 11:74607684-74607706 GGGGGGTTGAGGCAGGAAGATGG - Intronic
1085403734 11:76249599-76249621 GTGGGGGTTAGGGAGGAAGGTGG - Intergenic
1085410519 11:76287898-76287920 GTGTGGAACAGGGTGGAAGGTGG + Intergenic
1085557313 11:77436051-77436073 GTTTGGATTATAGAGGAAGAAGG - Intronic
1085574944 11:77594053-77594075 GTGGGGAGGAGGGAGGAATGGGG + Intronic
1085648798 11:78247902-78247924 GTGTGGATGAGGGAATGAGAGGG - Intronic
1085886406 11:80527375-80527397 GGGAGGATGAGGCAGGAAAATGG + Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086144962 11:83541610-83541632 GTGGAGATGAGGGAAGAAGAAGG - Intronic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1087026699 11:93657037-93657059 GTGTATATTAGGGAGAAAGAGGG + Intergenic
1087039651 11:93785897-93785919 GGGAGGCTGAGGGAGGAGGATGG + Intronic
1087112304 11:94483736-94483758 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1088074275 11:105827037-105827059 TTCTGGATGAGGAAGGATGAAGG - Intronic
1088447168 11:109944092-109944114 ATGAGGGAGAGGGAGGAAGAAGG + Intergenic
1088458516 11:110058508-110058530 GGGGGCATGAGGGAGGAAGGCGG - Intergenic
1088470190 11:110181992-110182014 GGGTGGCCGAGGGAGGAACAGGG - Intronic
1088537042 11:110872652-110872674 GTCTGGATGTGGGGGTAAGATGG - Intergenic
1088870760 11:113888651-113888673 GTGTGGCTGAGGCAGGAGAATGG - Intergenic
1089047674 11:115517450-115517472 GGGAGGCTGAGGTAGGAAGATGG - Intergenic
1089053106 11:115563084-115563106 GTGTGGATTTTGGAGTAAGAAGG + Intergenic
1089329747 11:117681023-117681045 GTCCGAATGAGGGAGGATGAGGG - Intronic
1089490300 11:118879140-118879162 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1089760673 11:120720698-120720720 GTGGGGGTTAGGGAGGAATAGGG + Intronic
1089786688 11:120912426-120912448 ATGTTCAAGAGGGAGGAAGACGG + Intronic
1089860198 11:121583353-121583375 GTTTGCATGAGGTAGGAATAAGG - Intronic
1090225237 11:125067216-125067238 GGGAGGATGAGGTAGGAGGATGG - Intronic
1091079976 11:132657335-132657357 GAGTGGTGGAGGGAGGAAGAAGG + Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091446472 12:546617-546639 GTGTGGAAGAGAGAAGAGGAGGG - Intronic
1091465343 12:678995-679017 GAATGGACGAGGAAGGAAGAGGG - Intergenic
1091769377 12:3141248-3141270 GGGAAGCTGAGGGAGGAAGAAGG - Intronic
1091805469 12:3352951-3352973 GTGTGCAGGAGGGATGAAGAGGG + Intergenic
1091972441 12:4798666-4798688 GTGTGCATGAGAGAGAGAGAGGG - Intronic
1092045478 12:5429716-5429738 GAGGGAAGGAGGGAGGAAGAGGG - Intergenic
1092045799 12:5431344-5431366 GTGTGGAAGGGAGAGGGAGATGG - Intergenic
1092103086 12:5902343-5902365 GGGTGGCTGAGGCAGGAGGATGG + Intronic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1092247496 12:6871791-6871813 GTGTGGCTGAGGAAGGAAGTAGG + Intronic
1092322901 12:7497298-7497320 GAGTGGATCAGGCAAGAAGATGG + Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092527569 12:9318486-9318508 GAATGAATGAGGGAGGGAGACGG + Intergenic
1092539693 12:9413269-9413291 GAATGAATGAGGGAGGGAGACGG - Intergenic
1092581219 12:9844645-9844667 GTGTCGATGATGGAGGGAGAAGG - Exonic
1092651542 12:10640426-10640448 GTGTGGGTGAGGCAGGGAGGAGG + Intronic
1092813356 12:12291698-12291720 GTGAGGCTGAGGCAGGAGGATGG + Intergenic
1092845355 12:12579889-12579911 GTTTTGAAGATGGAGGAAGAAGG - Intergenic
1092976680 12:13751816-13751838 GAATGGATGAGAAAGGAAGAGGG + Intronic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1093161621 12:15753727-15753749 GTGAGCATGAGAGAGGAAGTGGG - Intronic
1093199958 12:16174621-16174643 TTGTGAATGAGGGAGGATTAGGG + Intergenic
1094499190 12:31007596-31007618 GAGGGGATGAGGGTGGCAGAGGG - Intergenic
1094524599 12:31223183-31223205 GAGTGAATGAGGGAGGGAGGGGG + Intergenic
1094631585 12:32180660-32180682 GTGAGGATTAGGAAAGAAGAAGG - Intronic
1095102847 12:38201815-38201837 GTGTGGATGAGGGTGGGGGTGGG + Intergenic
1095192174 12:39270368-39270390 GTGTGGATGGGGGAGACACAGGG - Intergenic
1095611039 12:44128352-44128374 TTGTGCATGAGAGAGGAAGTGGG - Intronic
1095654009 12:44648289-44648311 TTTGGGCTGAGGGAGGAAGAAGG - Intronic
1095951824 12:47785724-47785746 GCATGGATGGGGGAGGGAGACGG + Intronic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1096199411 12:49671113-49671135 GGGTGGCTGAGGGAGGAAGTTGG - Intronic
1096521428 12:52186870-52186892 GTGGGGAGGAGGGAGGCAGGGGG - Intronic
1096791722 12:54049094-54049116 GCTGGGATGAGGGAGGAAGGTGG + Intronic
1096887266 12:54730606-54730628 GGATGGATCTGGGAGGAAGAGGG - Intergenic
1097509505 12:60519514-60519536 GTGGGGATGAGGGATGGAGATGG + Intergenic
1097702799 12:62837866-62837888 GTGTTCCTGAGGGAGGCAGAGGG - Intronic
1098067553 12:66635177-66635199 GGGAGGCTGAGGTAGGAAGATGG + Intronic
1098157832 12:67618526-67618548 GTGTAGAGGTGTGAGGAAGATGG - Intergenic
1098244319 12:68500642-68500664 GTGTGGATGAGGGAGGTCGGCGG + Intergenic
1098537277 12:71607227-71607249 ATGTGAATGATGGTGGAAGATGG + Intergenic
1099064926 12:77963973-77963995 GGGAGGAGGAGGGAGGAGGAAGG - Intronic
1099195708 12:79613081-79613103 GAGAGAAAGAGGGAGGAAGAGGG - Intronic
1099951308 12:89307543-89307565 GTTTGGAGGGGGGAGGAACAGGG - Intergenic
1100201954 12:92308155-92308177 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1101246299 12:102886922-102886944 ATGTGAATGAGAGAGGAAGTTGG + Intronic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1102230375 12:111257662-111257684 GGGAGGAAGAGGGGGGAAGAGGG - Intronic
1102230380 12:111257672-111257694 GGAAGGAGGAGGGAGGAAGAGGG - Intronic
1102426243 12:112846521-112846543 ATGGGGAGGAGGGAGGAAGATGG + Intronic
1102465615 12:113129390-113129412 GTGGGAATGGGGGAGGGAGAGGG + Intronic
1102702525 12:114851887-114851909 GGGTGAGTGAGGGAGGAAGATGG + Intergenic
1102792344 12:115657926-115657948 ATGAGGAGGAGGGGGGAAGATGG - Intergenic
1102851233 12:116246892-116246914 GTGGGGAGGCGGGAAGAAGAGGG + Intronic
1102923998 12:116813058-116813080 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1103012757 12:117469900-117469922 GAATGGATGATGGAGGAATATGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103147686 12:118609626-118609648 GAGTGGAGCAGGGAGAAAGAGGG + Intergenic
1103172307 12:118832225-118832247 GTGTGTGGGAGGCAGGAAGAGGG - Intergenic
1103238988 12:119397945-119397967 GTGTGGGAGGGGGAGGAAGGGGG + Intronic
1103486751 12:121288320-121288342 GTGGGGAGGAGGGAGGGAGAGGG - Intronic
1103797788 12:123516712-123516734 TGGTGGATGAGGGGGGATGAGGG + Intronic
1103985620 12:124765560-124765582 GTTTGGCTGAGGGAAGAATAAGG - Intergenic
1104371599 12:128228515-128228537 GTAGGAGTGAGGGAGGAAGAAGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104521517 12:129480193-129480215 GTGTGCAAGGGAGAGGAAGAAGG + Intronic
1104844578 12:131840438-131840460 GTGGGGAGGAAGGCGGAAGATGG + Intronic
1105258350 13:18760200-18760222 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1105774587 13:23645874-23645896 GTTTGGTGGAGGGAGGAAGGAGG - Intronic
1105864613 13:24448103-24448125 TGGGGGATGAGGGAGGAAGATGG + Intronic
1106028371 13:25976166-25976188 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1106091702 13:26601474-26601496 GTATGGATGATGGGGGATGATGG + Intronic
1106243166 13:27925842-27925864 CTGGGGGTGAGGGAGAAAGATGG + Exonic
1106741939 13:32653602-32653624 CTTAGGATGAGGGAGGTAGAGGG + Intronic
1106833769 13:33612510-33612532 GTGTGGATGAGGCAGGGAGTAGG - Intergenic
1107309714 13:39063192-39063214 AGGTGGAAGAGGGAGGAAGTTGG - Intergenic
1107601082 13:42013157-42013179 GGGAGGTTGAGGTAGGAAGATGG - Intergenic
1107669631 13:42731507-42731529 GTGTGAATGAGGAAGGAAAAAGG + Intergenic
1107932292 13:45316271-45316293 GGGAGGAGGAGAGAGGAAGAGGG + Intergenic
1107978857 13:45715368-45715390 GAGATGATGAGGGAGCAAGAAGG - Intergenic
1108167878 13:47711684-47711706 TAGGGGATGAGGGAGGAAGGAGG - Intergenic
1108199707 13:48031086-48031108 GTGTGCATGAGAGAGAGAGAAGG + Intergenic
1108422205 13:50262555-50262577 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1108730138 13:53226581-53226603 GTGTAGAAGAGAGAGGAAGGAGG - Intergenic
1109472837 13:62833211-62833233 GTGAGGCTGAGGCAGGAAAATGG + Intergenic
1109923197 13:69097998-69098020 GTGTGTGAGAGGGAGAAAGAGGG + Intergenic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110305933 13:73986704-73986726 ATGTGAAGGAGGGAGGTAGAAGG + Intronic
1110619733 13:77581904-77581926 GTGTGGAGGGGAGTGGAAGATGG + Intronic
1112009146 13:95279591-95279613 GTGGGGAGCAGAGAGGAAGATGG + Intronic
1112817638 13:103291582-103291604 ATCTGGTTGAGGGAGGAAGCAGG + Intergenic
1112829317 13:103429157-103429179 GTGAGGTTTGGGGAGGAAGAAGG - Intergenic
1113519430 13:110929205-110929227 GGGAGGATGAGGCAGGAGGATGG - Intergenic
1113554145 13:111217791-111217813 GTGTGGAAGAGGGAGGCTGGTGG + Exonic
1113677243 13:112215283-112215305 GACTGGAGGAGGGAGGGAGATGG + Intergenic
1113866498 13:113529340-113529362 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1113913302 13:113854924-113854946 GCGGGGAGGAGGAAGGAAGAGGG + Intronic
1113974839 13:114219854-114219876 CTGTGTGTGAGGGAGGAAGGAGG + Intergenic
1114070311 14:19099929-19099951 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1114091950 14:19300073-19300095 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1114552614 14:23542057-23542079 GAGAAGAGGAGGGAGGAAGAAGG + Intronic
1114618283 14:24080052-24080074 GTGTGGGAGAGGGAGAGAGAGGG - Intergenic
1115250571 14:31342145-31342167 GTGGGGCTGAGGCAGGAGGATGG + Intronic
1115403430 14:32989836-32989858 ATGTGGAGGAGAGAGGAAGGAGG + Intronic
1115426868 14:33270477-33270499 GTGTGTAAGAGAGAGGGAGAAGG + Intronic
1115498249 14:34027372-34027394 GAGAGGGGGAGGGAGGAAGAAGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116411141 14:44625509-44625531 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1117242611 14:53850056-53850078 GTGAGGTTGGGGGAGAAAGATGG + Intergenic
1117574199 14:57081755-57081777 GTGTGGATGAAGGAGGAGGGAGG - Intergenic
1117880366 14:60307513-60307535 GGGAGGTTGAGGCAGGAAGATGG - Intergenic
1117954599 14:61112784-61112806 GTGTGAATGAGGCTGGATGAGGG - Intergenic
1118054187 14:62062300-62062322 GGGGGGATGAGGGAGAATGAAGG + Intronic
1118407562 14:65441939-65441961 GTGGGGTTGTGGGAGGAGGAGGG - Intronic
1118492378 14:66273719-66273741 GTGTGGATGAGGGTGGAAAGTGG - Intergenic
1118623383 14:67634487-67634509 GGGAGGCTGAGGTAGGAAGATGG + Intronic
1118624226 14:67642905-67642927 GGGAGGCTGAGGTAGGAAGATGG - Intronic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1119045492 14:71315064-71315086 GTGTGGCTGGGGTAGAAAGAGGG + Intergenic
1119296330 14:73536401-73536423 GAGAGGCTGAGGCAGGAAGATGG + Intronic
1119364260 14:74078456-74078478 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1119758188 14:77133375-77133397 GAATGGATGAGCCAGGAAGAGGG + Exonic
1120117730 14:80639810-80639832 GTTTTGATGAAGGAGTAAGAAGG + Intronic
1120193424 14:81459945-81459967 GGGTGGATGGTGGAGGAGGAAGG - Intergenic
1120540473 14:85744321-85744343 GTGGGGATGAGGGTGGAATTTGG - Intergenic
1120612051 14:86654071-86654093 AGGAGGATGAGGGAGAAAGATGG - Intergenic
1120756018 14:88245319-88245341 GTGTGGGGGAGGGAGGACAAGGG - Intronic
1120764470 14:88316101-88316123 GTGGGGATGAGGCTGGGAGATGG - Intronic
1121001872 14:90456839-90456861 ATGTGGAGTGGGGAGGAAGAGGG + Intergenic
1121021532 14:90583133-90583155 GTGAAGATGAGGGAGGCAGATGG - Intronic
1121067202 14:90979296-90979318 GGAAGGAAGAGGGAGGAAGAAGG + Intronic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121338092 14:93089327-93089349 GTGTGGAGAGGGGAGGAACAGGG - Intronic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1122625100 14:103081091-103081113 GAGTGGATGATGAATGAAGATGG + Intergenic
1122655888 14:103258996-103259018 GAGAGGCTGAGGCAGGAAGATGG + Intergenic
1122735022 14:103833704-103833726 GTTTGGAAGATTGAGGAAGAGGG - Intronic
1122755258 14:103973569-103973591 GGGTGGATGAGGGAGGCTGGTGG + Intronic
1122811654 14:104292255-104292277 GTGTGGGTGGGGGAGGGAGGGGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123153793 14:106206004-106206026 GTGTGAATGTGGGAGGACAAAGG - Intergenic
1202835036 14_GL000009v2_random:71603-71625 GTGTGGGTGAGGGTGAAACATGG + Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1124016978 15:25885873-25885895 GGGAGGCTGAGGTAGGAAGACGG - Intergenic
1124136788 15:27042406-27042428 GTGTGGAAGAGGGATGGAGGAGG - Intronic
1124165034 15:27318768-27318790 GAGAGGAGGAGGGAGGCAGAAGG - Intronic
1124323931 15:28740178-28740200 GGGAGGATGAGGCAGGAAAATGG - Intergenic
1124490848 15:30154128-30154150 ATGGGGATGAGAGGGGAAGAGGG + Intergenic
1124752685 15:32384202-32384224 ATGGGGATGAGAGGGGAAGAGGG - Intergenic
1125416943 15:39463652-39463674 GTGTAGATACTGGAGGAAGATGG - Intergenic
1125636725 15:41195145-41195167 GGGTGGCTGAGGCAGGAGGATGG + Intronic
1125660620 15:41391946-41391968 GTGTGGAGGAAGGAGGTAGGAGG + Intronic
1125924388 15:43550238-43550260 GAGAGGCTGAGGGAGGAGGATGG - Intronic
1126441874 15:48698006-48698028 GTGGGGATGGAGGAGGAACACGG + Intergenic
1126454294 15:48844394-48844416 CTGGGGAGGAGAGAGGAAGAAGG - Intronic
1126868501 15:52962296-52962318 GCGTGTATGAGGGAAGAAGAAGG - Intergenic
1127037640 15:54936215-54936237 TTGGGGATGAGGGAGAGAGAGGG + Intergenic
1127125884 15:55811746-55811768 GAGGGGATGAGTCAGGAAGATGG - Intergenic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127318195 15:57817340-57817362 GTGTGGCTGAGGGCGGATGAAGG - Intergenic
1127646175 15:60961638-60961660 GAAAGGAGGAGGGAGGAAGAGGG + Intronic
1127833579 15:62772030-62772052 GGGAGGCTGAGGCAGGAAGAAGG - Intronic
1127979680 15:64025377-64025399 GTGTGGCTGGGGTAGGAAGAAGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128314684 15:66653226-66653248 GTGTGGGTGAGAGAGGCAGTGGG + Intronic
1128559679 15:68656226-68656248 GGAGGGATGTGGGAGGAAGAAGG + Intronic
1128609425 15:69062122-69062144 GATTGGCTGAAGGAGGAAGATGG - Intronic
1128859011 15:71049284-71049306 GAGTAGATGGGGGAGGAATAGGG + Intronic
1128913328 15:71536801-71536823 GTGTGTATGTGGGAGGAAGTAGG + Intronic
1129246861 15:74284455-74284477 GTGGTGATGAGGGATGGAGAAGG - Intronic
1129310385 15:74704137-74704159 GGGAGGATGAGGCAGGAGGATGG + Intergenic
1129680815 15:77657464-77657486 GTGTGCAGGAGGGATCAAGATGG - Intronic
1130000932 15:80045974-80045996 GGGTGGCTGAGGCAGGAAAATGG - Intergenic
1130253340 15:82314618-82314640 GAGTGCATGAGGGAAGATGATGG + Intergenic
1130449215 15:84034123-84034145 TTATGGATGAGGGATGAAGTTGG + Intronic
1130558085 15:84936946-84936968 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1130721067 15:86386179-86386201 AGGAGGAAGAGGGAGGAAGAGGG - Intronic
1130839303 15:87682744-87682766 CTGTGGCAGAGGGAGGAATAAGG - Intergenic
1130858705 15:87866226-87866248 GTGTGGTAGAGGGAGGATAATGG - Intronic
1130894067 15:88157212-88157234 GTGTGAGAGAGGGAAGAAGAGGG - Intronic
1131036246 15:89224215-89224237 AGGAGGCTGAGGGAGGAAGATGG - Intergenic
1131530127 15:93183786-93183808 GTGTGCTGGAGGGAGGACGAGGG + Intergenic
1131593571 15:93773989-93774011 GTGTGGATGGGGGAGGAGGGGGG - Intergenic
1131667387 15:94585079-94585101 GTTTGGAGGAAGAAGGAAGAGGG - Intergenic
1131708197 15:95021443-95021465 GTGTGTAGGAGGGAGGGGGAAGG - Intergenic
1131747874 15:95469221-95469243 GTGGGGATGAGGAAGGAGCACGG + Intergenic
1131852132 15:96554685-96554707 AGGAGGAGGAGGGAGGAAGAAGG - Intergenic
1132248022 15:100312225-100312247 CTTTAGATGAGGGAGGCAGAGGG + Intronic
1132383243 15:101381257-101381279 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1133062802 16:3185878-3185900 GATTGGAGGAGGGAGGAACAGGG + Intergenic
1133230456 16:4364237-4364259 GTGTCGCTGAGGGAGGATGGGGG + Intronic
1133279503 16:4657200-4657222 GTGAGGCTGCGGCAGGAAGAGGG - Intronic
1133375925 16:5287063-5287085 GGGAGGATGAGGCAGGAGGACGG + Intergenic
1133455124 16:5935346-5935368 GTGTGGCAGAGGGTGGAAGGAGG + Intergenic
1133520164 16:6549212-6549234 GAGGGGAGGAGGGAGGAAGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133646188 16:7766869-7766891 GTGTTGAGGAGGGGGTAAGATGG - Intergenic
1133760265 16:8792957-8792979 GTGCGGATGAGGGAGGGAAGGGG + Intronic
1134451348 16:14365629-14365651 GGGAGGCTGAGGGAGGAGGATGG + Intergenic
1134622342 16:15698987-15699009 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1134777378 16:16864964-16864986 GTAGGGAGGAGGGAGGCAGACGG - Intergenic
1135163700 16:20120166-20120188 AGGTGGAGGAGGGAGGGAGAGGG - Intergenic
1135250693 16:20899593-20899615 GTGTGCATGGGGGAGGATGAGGG + Intronic
1135511289 16:23086093-23086115 CTTTGGAGGAAGGAGGAAGAAGG - Intronic
1135711571 16:24721700-24721722 GTGAGGCTGAGGTGGGAAGATGG + Intergenic
1136364384 16:29802719-29802741 GTGGTGATGAGGGAGGAGGTAGG + Intronic
1136599706 16:31276878-31276900 GGGTTGATGAGGAAGGAAGAAGG - Intronic
1136618987 16:31415510-31415532 GTGTGGATGGAGGTGGGAGAAGG - Intronic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137603098 16:49769774-49769796 TTGGAGATGAGGGAGGGAGACGG - Intronic
1137626681 16:49913293-49913315 GTGAGGCTGAGGCAGGAGGATGG - Intergenic
1137671838 16:50283795-50283817 GTGTGGGTGAGGGAGTGACAGGG + Intronic
1137813431 16:51375210-51375232 GTGTGGATGATGAAGTATGATGG + Intergenic
1137929405 16:52572611-52572633 ATGTGGGTCAGGGAGAAAGAAGG + Intergenic
1138015926 16:53428671-53428693 GTGAGGATGAAGGGGCAAGAGGG + Intergenic
1138044159 16:53703770-53703792 GGGAGGATGGGGGAGGATGAGGG - Intronic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1138785390 16:59839472-59839494 GGGTGGCTGAGGCAGGAAAATGG + Intergenic
1138929143 16:61631196-61631218 GTGTGTATGAGAGAGAGAGAAGG + Intergenic
1139059549 16:63232143-63232165 GAGAGGATGAAGCAGGAAGATGG + Intergenic
1139253518 16:65519499-65519521 GAGTGGAGAAGAGAGGAAGAAGG - Intergenic
1139359209 16:66387120-66387142 CTGGGGATGAGGGAGGGAGGAGG - Intronic
1139425057 16:66874043-66874065 GGGAGGAGGAGGGAGGAGGAGGG - Intergenic
1140034648 16:71363077-71363099 GAGAGGCTGAGGCAGGAAGATGG + Intronic
1140716368 16:77728934-77728956 GGGTGGAGGAGGGTAGAAGAGGG - Intronic
1140810062 16:78568266-78568288 ATGAAGATGAGGGAGGAAAATGG + Intronic
1140986209 16:80160196-80160218 GTGAGAGTGAGGGTGGAAGATGG + Intergenic
1141028350 16:80568497-80568519 GTGTGGTTGAGTGAGGAGGGTGG - Intergenic
1141150968 16:81564499-81564521 GAGTTGATGTGGGGGGAAGAAGG + Intronic
1141177526 16:81730640-81730662 GTGAGGCTGAGGGAAGCAGAGGG + Intergenic
1141211711 16:81987130-81987152 CTGGAAATGAGGGAGGAAGATGG - Intergenic
1141372454 16:83500505-83500527 GGGAGGAGGAGGGAGGAGGAGGG - Intronic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141618998 16:85226809-85226831 GTGTGTGTGAAGGAGGACGAAGG + Intergenic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1141766668 16:86063697-86063719 GGGAGGAAGAGGGAGGGAGAGGG + Intergenic
1142008633 16:87702324-87702346 GTCAGGCTGAGAGAGGAAGATGG + Intronic
1142099649 16:88264563-88264585 AGGAGGATGTGGGAGGAAGATGG - Intergenic
1142099664 16:88264603-88264625 AGGGGGATGTGGGAGGAAGATGG - Intergenic
1142156823 16:88536274-88536296 GGGAGGCTGAGGCAGGAAGATGG - Exonic
1142200814 16:88760309-88760331 TTGTCCATGAGGCAGGAAGAGGG - Intronic
1142280953 16:89147287-89147309 GTGTGAGTGAGGGAGGAGGGAGG + Intronic
1142284366 16:89165719-89165741 GGGTGGAAGAGGGAGCAGGAAGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142889898 17:2936469-2936491 GAGAGGAAGAGGGAGGAAGAAGG - Intronic
1143037436 17:4007421-4007443 AGGTGGCAGAGGGAGGAAGAGGG + Intronic
1143154460 17:4827392-4827414 GGGTGGGTGAGGCATGAAGAGGG + Intergenic
1143169626 17:4920651-4920673 GGGTGGCTGAGGCAGGAGGATGG + Intergenic
1143442396 17:6985467-6985489 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143636089 17:8164365-8164387 GGGTGGGGGAGGGAGGAAGCTGG - Intergenic
1143651502 17:8266611-8266633 GTAGGGATCAGGGAGGATGAGGG - Intronic
1143799986 17:9370969-9370991 GTGGGGTTGAGGGAGGAAAAGGG + Intronic
1143953549 17:10652235-10652257 AGGTGGATGGGGCAGGAAGAAGG - Intronic
1144235964 17:13260723-13260745 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1144660436 17:17064544-17064566 GGGTTGATGTGGGAGGGAGAAGG - Intronic
1144877926 17:18412039-18412061 GAGTGGAAGAGGGGAGAAGAGGG - Intergenic
1145154303 17:20532386-20532408 GAGTGGAAGAGGGGAGAAGAGGG + Intergenic
1145258323 17:21339858-21339880 GGGTGGCTGAGGGAGGAGAATGG - Intergenic
1145739413 17:27260225-27260247 GAGAGGCTGAGGGAGGAGGATGG - Intergenic
1145867033 17:28248032-28248054 GTGTGGTGGGGGGTGGAAGAGGG + Intergenic
1146097914 17:29950332-29950354 GTGGGGAGGAGGAAGGAAGGAGG - Intronic
1146505273 17:33399439-33399461 GTGTAGAAGAGGGAGACAGAGGG - Intronic
1146667081 17:34712351-34712373 GGGAGGCTGAGGTAGGAAGATGG + Intergenic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1147217512 17:38909221-38909243 ATGAGGATGGGGGAGGAAGCGGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147478878 17:40740103-40740125 GAGAGGCTGAGGGAGGAGGATGG - Intergenic
1147708179 17:42442801-42442823 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1147917536 17:43897716-43897738 GAGTGGAAGAATGAGGAAGAGGG - Intronic
1148145553 17:45362423-45362445 GGGTGGCTGAGGGAGGAGGGAGG - Intergenic
1148443934 17:47726453-47726475 GGATGAATGAGAGAGGAAGAGGG - Intergenic
1148488768 17:48009602-48009624 GGGAGGCTGAGGTAGGAAGATGG - Intergenic
1148633387 17:49129215-49129237 AGGAGGATGAGGGAGGAGGAGGG + Intergenic
1149451209 17:56751375-56751397 GTGCGGACGGAGGAGGAAGAGGG + Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149666580 17:58369052-58369074 GTGTGTATGAGAGAGAGAGATGG - Intronic
1149673942 17:58441938-58441960 GTGTGAGTGAGGGGGGAGGATGG + Intronic
1149753451 17:59168059-59168081 GTGGGGAGGAAGGAGGAATAGGG - Intronic
1149962550 17:61127802-61127824 GAGTGGAATAGGGAGGAAGGGGG + Intronic
1149969331 17:61200847-61200869 GTTTGGATGAGGCAGGAAAGAGG - Intronic
1149973386 17:61241612-61241634 GGGAGGATGAGGCAGGAAAATGG + Intronic
1150227710 17:63532826-63532848 ATGAGGCTGAGGGAGGAGGAGGG + Intronic
1150286341 17:63956344-63956366 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1150293094 17:63993085-63993107 GAGGGAATGAGGGAGGAAGGTGG + Intergenic
1150582703 17:66489883-66489905 GGGTGGCTGAGGCAGGAGGACGG - Intronic
1151153839 17:72110747-72110769 GTGTGTATGAGAGAGACAGAGGG + Intergenic
1151296234 17:73188377-73188399 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1151576291 17:74954077-74954099 GTGTGGCTGGGGGAGGGACATGG - Intronic
1152167612 17:78720633-78720655 GAGAGGCTGAGGGAGGGAGATGG + Intronic
1152266272 17:79296824-79296846 GGGAGGAGGGGGGAGGAAGAAGG - Intronic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1152680057 17:81662892-81662914 GTGTGGCTGAGGCAGGAGAATGG + Intronic
1152710122 17:81867226-81867248 CTGTGGCTGAGGCAGGAAGTAGG - Intergenic
1203169599 17_GL000205v2_random:135697-135719 GTGTGGAAGAGGTAAGAAGCAGG - Intergenic
1153203085 18:2666348-2666370 GTTGGGATGAGGGAGGAAACTGG + Intronic
1153460044 18:5323049-5323071 GTGTGGAACAGGGAGGGAGGAGG + Intergenic
1153544966 18:6195970-6195992 GAGGGGATGAGGAATGAAGAGGG - Intronic
1153544970 18:6195988-6196010 GTGTGGGTGAGACAGGGAGAGGG - Intronic
1153641941 18:7165093-7165115 GTGAGGAAGAGGGAAGCAGAAGG - Intergenic
1153679284 18:7485043-7485065 TTGTGGATGAGGCAGAAAGCAGG + Intergenic
1153732618 18:8029556-8029578 GTGGGGATGTGGGAGGATGGTGG - Intronic
1153827774 18:8892396-8892418 GTGTGGAAGATGTAGGAAGTAGG + Intergenic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1153887550 18:9480157-9480179 GAGTGGCTGAGGTAGGAGGATGG - Intronic
1153919264 18:9773761-9773783 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1154370937 18:13762603-13762625 GTGTGGATGGGGGAGCAGGCTGG - Exonic
1154427730 18:14284693-14284715 GTGTGGGTGAGGGTGAAACATGG + Intergenic
1154501893 18:15001400-15001422 GGGTGAAAGAGGGAGAAAGAGGG - Intergenic
1155066554 18:22273814-22273836 GGGAGGAGGAGGGAGGAGGAAGG - Intergenic
1155178458 18:23322225-23322247 TTGTGGTTTAGGGAGGAGGATGG + Intronic
1155344822 18:24847908-24847930 ATGGGGATGAGGGAGACAGAGGG - Intergenic
1155401564 18:25445557-25445579 GTGTGGAGCAGGAAGGCAGAGGG + Intergenic
1155653851 18:28175049-28175071 GTTAGGCTGAAGGAGGAAGAAGG - Intronic
1155829244 18:30492227-30492249 GTGGGGAAGAGGGAGGGAGAGGG + Intergenic
1155878089 18:31111703-31111725 ATGTAGAGGAGGGAGGCAGACGG + Intergenic
1156453325 18:37279028-37279050 GTGTGGATGGAGGAGGAGGGTGG - Intronic
1156499345 18:37547312-37547334 CTGTGGCTGAGTGAGAAAGAAGG - Intronic
1157197694 18:45632780-45632802 GTGTGGCTGAGGCAGGAGAATGG - Intronic
1157422097 18:47555918-47555940 GTGGGCATGAGGCAGGAACAAGG - Intergenic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157867841 18:51201375-51201397 GTGTGACTGAGGGAGATAGAAGG - Intronic
1158259199 18:55588605-55588627 GTGTGGATGTGTGAGTGAGAGGG - Intronic
1158614023 18:58969336-58969358 GGGTGGTTCAGGGAGGAAGATGG + Intronic
1158863957 18:61619527-61619549 GGGAGGATGAGGGAGGAGAAAGG - Intergenic
1158877363 18:61745931-61745953 GTGTGGTGGAGGGAAGAAAACGG + Intergenic
1159116848 18:64124147-64124169 GTGTGGATAAGTGAGGAGCAAGG - Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160348226 18:78152116-78152138 GAGTGGATGAAGGAGGGAGGAGG - Intergenic
1160392675 18:78546958-78546980 GGGTGGAGGGGGGAGGAAGGGGG + Intergenic
1160448677 18:78947124-78947146 GGGAGGAGGAGGGAGGAGGAGGG + Intergenic
1160486293 18:79296118-79296140 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1160689856 19:456486-456508 GTGTTGCTGAGGGAGGAGGAGGG - Intronic
1160831713 19:1107499-1107521 ATGTGGATGAGAGGGGACGAGGG - Intergenic
1161012571 19:1967728-1967750 CTGGGGAGGAGGGAGGAAGGAGG - Intronic
1161012592 19:1967789-1967811 CTGGGGAGGAGGGAGGAAGGAGG - Intronic
1161094691 19:2383410-2383432 GAGAGGCTGAGGCAGGAAGATGG + Intergenic
1161289965 19:3488423-3488445 GTGAGGATGAGGGAGGTTGGAGG + Intergenic
1161404591 19:4084376-4084398 GTGGGAGGGAGGGAGGAAGAAGG - Intergenic
1161522034 19:4730087-4730109 GGGTGGAGGAGGGAGGAGGCTGG - Intergenic
1161816240 19:6501766-6501788 GCGAGGATGAGGCAGCAAGAAGG + Intronic
1162072978 19:8165930-8165952 GGGAGGAGGAGGGAGGAGGAAGG + Intronic
1162085155 19:8244249-8244271 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1162180738 19:8867157-8867179 GAGTGGAGGAGTGAGCAAGATGG + Intronic
1162203453 19:9038075-9038097 CTGAGGATGAGGGAAGAAGATGG - Intergenic
1162249938 19:9433861-9433883 GGGTGGCTGAGGCAGGAGGATGG + Intronic
1162446652 19:10727291-10727313 TTCTGGATGAGGGCGGAAGATGG + Intronic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1163090273 19:15014657-15014679 GTGGGGAGGAGGGGAGAAGAAGG + Intronic
1163090461 19:15016075-15016097 GTGGGGAGGAGGGGAGAAGAAGG + Intronic
1163153023 19:15425816-15425838 GGGAGGAGGAGGGAGGAGGAGGG + Intronic
1163290031 19:16373248-16373270 GCGTGGCTGAGTGAGGAGGAAGG - Intronic
1163324996 19:16597825-16597847 GTGAGGCTGAGGTGGGAAGATGG - Intronic
1163361732 19:16851154-16851176 TTATGGATAAGGGAGGGAGAAGG - Intronic
1163658394 19:18561711-18561733 CAGGGGATGAGGGAGGAAGCTGG + Intronic
1163744987 19:19041071-19041093 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1164231919 19:23296888-23296910 CTGAGGATGATGGAGGAAGGGGG + Intergenic
1164733646 19:30524688-30524710 GGGTGGAGGAGGGGAGAAGATGG - Intronic
1164744181 19:30599210-30599232 GGGAGGGGGAGGGAGGAAGAAGG - Intronic
1164860358 19:31557819-31557841 GTGTTGATGGGAGAGAAAGATGG - Intergenic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165407139 19:35637822-35637844 GTGTGGAAGAGGTTTGAAGAGGG - Intergenic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1166008108 19:39921092-39921114 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1166026325 19:40089003-40089025 ATGTGGGTGAGGGAGGAAGGAGG + Intronic
1166200022 19:41231335-41231357 TTGTGGATGTGGGTGGAAGGAGG - Intronic
1166549468 19:43655609-43655631 TTGTGAATGAGGGACTAAGATGG + Intronic
1166556364 19:43702738-43702760 GAGGTGAGGAGGGAGGAAGAGGG - Intergenic
1166635774 19:44450782-44450804 GTTTGTATGAGGTAGGATGAAGG - Intergenic
1166758602 19:45210883-45210905 GGGAGGATGAGGCAGGAGGATGG + Intronic
1167138697 19:47634272-47634294 GCTGGGATGAGGGAGGAAGGGGG + Intronic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167555979 19:50196002-50196024 ATGTGGGTGAGGGATGAAGTGGG - Intronic
1167601986 19:50459759-50459781 GAGTGGAGGAGAGATGAAGATGG + Intronic
1167607306 19:50488345-50488367 GAGAGGAAGAGGGAGAAAGAAGG + Exonic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168061898 19:53897974-53897996 GAGGGGATGGGAGAGGAAGAGGG - Exonic
1168270290 19:55246059-55246081 GTTTGGAGGAGGGAGGCAGGAGG - Intronic
1168415274 19:56163803-56163825 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1168527440 19:57100181-57100203 GGGGGGATGGGGGAGGGAGATGG + Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
1168629562 19:57946611-57946633 GGGGGGTTGAGGGAGGAGGAAGG - Intronic
1168724985 19:58576101-58576123 GTGTGAATGTGGGAGAGAGAAGG + Intergenic
1202637590 1_KI270706v1_random:55745-55767 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
924994349 2:343216-343238 GTGTTGGTAAAGGAGGAAGAAGG + Intergenic
925001898 2:409886-409908 GTGTGGATGGGGGAGGATGGTGG - Intergenic
925436892 2:3846219-3846241 GTGGGGAGGAGAGAAGAAGAGGG - Intronic
925658846 2:6181321-6181343 ATGGGGAGGAGGGAGGAAGACGG - Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
925904796 2:8534123-8534145 GTGAGGAGGTGGGTGGAAGAGGG - Intergenic
926086126 2:10021430-10021452 GTGAGGCTGAGGCAGGAAAATGG + Intergenic
926266823 2:11330828-11330850 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926266832 2:11330850-11330872 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926266855 2:11330924-11330946 GAGAGGAGGAGGGAGGAAGGGGG + Intronic
926266889 2:11331022-11331044 GGGAGGAGGAGGGAGGAGGAGGG + Intronic
926414565 2:12636451-12636473 GGGTGGAGGAGGGAGATAGATGG - Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926584228 2:14668476-14668498 GTGGGTATGAGGGATGGAGAAGG - Intergenic
926756778 2:16242918-16242940 GTGGAAATGAGGGAGGAAGAAGG - Intergenic
927083163 2:19650242-19650264 GTGGGGAGGAGGGATGGAGAAGG + Intergenic
927412271 2:22840478-22840500 GTGTGAAGGATGGATGAAGAGGG + Intergenic
927467803 2:23350349-23350371 GTGGGGAGGCGGGAGGCAGAAGG - Intergenic
927631055 2:24774402-24774424 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
927784581 2:25964874-25964896 ATGGGGAAGAGGGAGGAAGGAGG - Intronic
927931378 2:27047340-27047362 GGGTGGCTGAGGTGGGAAGATGG - Intronic
928135527 2:28684859-28684881 GGGTGGGGCAGGGAGGAAGAAGG - Intergenic
928179351 2:29057021-29057043 TTGTGATGGAGGGAGGAAGATGG + Exonic
928317174 2:30255399-30255421 GTGTGGGTCACGGAGGCAGAGGG - Intronic
928550146 2:32362418-32362440 GGGAGGCTGAGGGAGGAAAATGG - Intronic
928947457 2:36784318-36784340 GTAGGTATGAGGCAGGAAGATGG - Intronic
928981658 2:37142233-37142255 GTGAGGCTGAGACAGGAAGATGG - Intronic
929417646 2:41760074-41760096 GTGTGGGTGAGGCAGAAACAAGG - Intergenic
929542550 2:42833625-42833647 GAGAGGTTGAGGCAGGAAGATGG - Intergenic
929571657 2:43026761-43026783 GTGGGGATGAGGGAGGCTCAGGG - Intergenic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
929942080 2:46341967-46341989 GTGTGGTGGGGGGAGGCAGATGG - Intronic
929950872 2:46408777-46408799 GTGTGAGAGAGTGAGGAAGAAGG + Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930271660 2:49264406-49264428 GTGTGTATGAGGGTGCAAGAGGG - Intergenic
930589598 2:53311771-53311793 GTGTGTATGAGAGAGAAGGAGGG - Intergenic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
930965015 2:57311982-57312004 GTGTGTGTGAGGGAGAAAGAAGG - Intergenic
931058997 2:58505096-58505118 GTGTGGCTGAGGGCAAAAGATGG + Intergenic
931313789 2:61106923-61106945 GGGAGGTTGAGGCAGGAAGATGG + Intronic
931347502 2:61459955-61459977 GGGTGGCTGAGGGAGGAGAATGG + Intronic
931975351 2:67638002-67638024 GAGTAGAAGAGGGAGGGAGAAGG + Intergenic
932140566 2:69273670-69273692 GTGTGGGTGGGGGAGGAGGTGGG - Intergenic
932153317 2:69392591-69392613 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
932221134 2:69999887-69999909 GGGTGGGAGAGGGAGGAAGGAGG - Intergenic
932285005 2:70524689-70524711 GAGTCCAGGAGGGAGGAAGAAGG + Intronic
932385189 2:71325807-71325829 GAGTGGGTGAGGGAAGAAGGTGG + Intronic
932460834 2:71880898-71880920 GATTGGAAGAGGGAGGAAGCTGG + Intergenic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
932743859 2:74314820-74314842 CTGTGGATGAGTCAGGAAAAGGG + Intronic
932976150 2:76602253-76602275 GTCTGGAGGAGGGAGGATGGTGG + Intergenic
933648282 2:84829751-84829773 GTGTGGATGTGTGTGGAACATGG - Intronic
934071967 2:88392664-88392686 GGGAGGCTGAGGTAGGAAGACGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
935362907 2:102262797-102262819 GTGGGGATGAGGGAGGAGATGGG + Intergenic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935428909 2:102951593-102951615 GTGAAGATAAGGGAGGAAAAGGG + Intergenic
935521831 2:104116150-104116172 GTGTGGAGGAAGGGAGAAGAGGG + Intergenic
935540883 2:104347352-104347374 GGGTGGCTGAGGGAGGAGGATGG + Intergenic
935737764 2:106120050-106120072 GTGCTGAGGAGGGAGGAAAATGG - Intronic
935753542 2:106259961-106259983 GTGTCGATGATGGAGGAGAAGGG - Intergenic
936487388 2:112937963-112937985 GAGTGGGTGATGGAGGAAGGAGG + Intergenic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
937276754 2:120689785-120689807 GTTTTCATGAGGGATGAAGAGGG + Intergenic
938164150 2:129011460-129011482 GAGAGAATGAGGGAGGGAGAGGG + Intergenic
938572232 2:132571100-132571122 GTGGGGATGAAGGTGGAAGTGGG - Intronic
938826168 2:135007606-135007628 GTGGGGAGTAGGGAGGAAGGGGG - Intronic
939517642 2:143189222-143189244 ATGTGGAAGAGAGAGGAAGGGGG - Intronic
939990902 2:148875967-148875989 GTGGGGATGGGGGGCGAAGACGG + Intronic
940330312 2:152466977-152466999 GACTGGAGGAGGCAGGAAGAAGG - Intronic
940360990 2:152795376-152795398 GTGAGGATGGGGGAGGAAAGAGG + Intergenic
940616873 2:156059789-156059811 GTGGGGAGGAGGAAGGAACAAGG + Intergenic
940778057 2:157905270-157905292 GTGAGGCTGAGGTAGGAAGATGG - Intronic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941393943 2:164951518-164951540 GGGTGGAGGTGGTAGGAAGAAGG + Intronic
941399941 2:165018368-165018390 GTGTGGTAGAGAGAGGGAGAGGG + Intergenic
941494136 2:166180491-166180513 AGGTGGAAGAGGGAGGAAGCTGG + Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
941590342 2:167412057-167412079 GTGGGGATGAAGGAGAAAAAAGG + Intergenic
941591659 2:167427871-167427893 TTGTGGAAGAGGGAAAAAGAAGG - Intergenic
942871657 2:180741924-180741946 GGGAGGCTGAGGTAGGAAGATGG - Intergenic
943043729 2:182833097-182833119 GGGAGGCTGAGGAAGGAAGACGG - Intergenic
943709151 2:191070853-191070875 GTGTGGGGGTGGGACGAAGAAGG + Intronic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
943890665 2:193282249-193282271 GGGAGGCTGAGGCAGGAAGACGG - Intergenic
944238360 2:197461587-197461609 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
944272393 2:197797762-197797784 GGGTTGATGTGGGTGGAAGAGGG + Intergenic
944287387 2:197966953-197966975 GTATGGATGAGGCAGGAGAATGG - Intronic
944750761 2:202707287-202707309 GGGAGGCTGAGGGAGGAGGATGG - Intronic
945231233 2:207592552-207592574 GTGGGGATGGGGGAGGAAGGAGG - Intronic
945769807 2:214029277-214029299 GAGTGGATGAGTGAGGAAAGAGG + Intronic
946058682 2:216922637-216922659 GTGAGGGTGAGGGAGGTGGAAGG + Intergenic
946295282 2:218778980-218779002 GGGTTGATGAGGGAGGGAGGAGG + Intergenic
946517466 2:220429096-220429118 GTTAGGATCAGGGAGGAACAGGG - Intergenic
946716219 2:222556929-222556951 GGGTGGATGGGGGAGGACTAAGG - Intronic
947049946 2:226031072-226031094 GAGGGGAGGAGGGAGGAAGAGGG - Intergenic
947271613 2:228342713-228342735 GTGAGGATAAGGGAGGGAGGGGG + Intergenic
947824157 2:233092889-233092911 GTGGGGCTGAGGAATGAAGATGG - Intronic
947976088 2:234367748-234367770 GGGAGGCTGAGGGGGGAAGATGG - Intergenic
948237188 2:236400080-236400102 ACGTGGAGGAGGGAGGCAGATGG - Intronic
948577721 2:238965226-238965248 GTAAGGAGGAGGGAGGAGGAAGG - Intergenic
948670484 2:239565344-239565366 GTGTGAAGGAGGGATGCAGAAGG + Intergenic
948670492 2:239565410-239565432 GTGTGAAGGAGGCATGAAGAAGG + Intergenic
948670499 2:239565501-239565523 GTGTGAATGAGGCATGAAGGAGG + Intergenic
948670541 2:239565883-239565905 GTGTGAAGGAGGCATGAAGAAGG + Intergenic
948670551 2:239565974-239565996 GTGTGAAGGAGGCATGAAGAAGG + Intergenic
948836275 2:240627569-240627591 GGGAGGCTGAGGCAGGAAGACGG - Intronic
948856488 2:240732700-240732722 GAGGGGATGAGGGGGGATGAGGG + Intronic
948856554 2:240732912-240732934 GAGGGGATGAGGGAGGGATAAGG + Intronic
948888628 2:240896419-240896441 GTGGGGAGGAGGGTGGAAGGAGG - Intronic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169046622 20:2538353-2538375 GAGTGGATGAGGCAGGCAGGTGG - Intronic
1169448907 20:5694705-5694727 GTGTTGAGGATGGAGGAATAGGG - Intergenic
1169554743 20:6737232-6737254 ATGGAGATGTGGGAGGAAGAAGG + Intergenic
1169805649 20:9556807-9556829 GCTTGGAGGAGGGAGGAAAATGG - Intronic
1170234984 20:14093183-14093205 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1170706120 20:18746068-18746090 AGAAGGATGAGGGAGGAAGATGG + Intronic
1170842383 20:19934494-19934516 GGGTGGATGAGTGGGGAGGAGGG - Intronic
1170993296 20:21325561-21325583 GTGTTGACAAGGGAGGAAGAAGG + Intronic
1171370915 20:24661470-24661492 GGAGGGAAGAGGGAGGAAGAAGG + Intronic
1171865211 20:30484321-30484343 GTGTGGGTGGGCGAGGAGGACGG + Intergenic
1171871387 20:30529012-30529034 GAAGGGAAGAGGGAGGAAGAGGG - Intergenic
1172629781 20:36370258-36370280 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1172841773 20:37906248-37906270 GAGTGGAGGTGGGAGGGAGATGG - Intronic
1172910508 20:38405890-38405912 GTGTGGCTGAGGTGGGAGGATGG + Intergenic
1172939575 20:38645240-38645262 GGGTGTATGAGGGAGGAGTAGGG - Intronic
1172972285 20:38882308-38882330 GTGTTGATGAGGGAGGCTCAAGG + Intronic
1172979187 20:38928040-38928062 CTGGGGATCAAGGAGGAAGAAGG + Intronic
1173208276 20:41011818-41011840 GAGTGGATGGGGGAGAAAGAGGG + Intergenic
1173403837 20:42747943-42747965 GAGTGGAGCAGGGAGGAAGCTGG + Intronic
1173406669 20:42772153-42772175 GAGCGGAAGAGGGAGGAAAAGGG + Intronic
1173443154 20:43095776-43095798 GTGTGGAAGAGAGAGGAAAAGGG - Intronic
1173537685 20:43828546-43828568 GTGGAGAAGAGGGAGGAAAAGGG + Intergenic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173605518 20:44328208-44328230 ATGTGGAGGAGGGGGGAAGATGG - Intergenic
1173823978 20:46035588-46035610 GGGAGGATGGGGGAGGAAAATGG + Intronic
1173999341 20:47362931-47362953 GTGGGGAAGAGAGAGGAAAAAGG - Intergenic
1174079840 20:47962936-47962958 GTGGGGATGAGGGAGGACTTGGG - Intergenic
1174130816 20:48342188-48342210 GTGAGGATGACGAGGGAAGAAGG - Intergenic
1174137856 20:48392991-48393013 GTGGGGATGAGGGAGGACTTGGG + Intergenic
1174236315 20:49095552-49095574 GGGAGGCTGAGGGAGGAGGATGG - Intronic
1174658788 20:52192699-52192721 GAGTGGTTGGGGGAGGAGGAGGG - Intronic
1174869660 20:54171383-54171405 GGGTGGAGGAGGGAGAAATAAGG + Intronic
1174970687 20:55271971-55271993 GGGAGGATGAGGCAGGAGGACGG + Intergenic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175684631 20:61019199-61019221 TTATGGAAGAGGGAGGGAGATGG + Intergenic
1175949891 20:62577750-62577772 GTGTGGAGGAGGGAGTACGAGGG + Intergenic
1175974297 20:62702625-62702647 ATGTGGAAGAGAGAGGCAGAAGG - Intergenic
1175978584 20:62725833-62725855 GTGAGGGGGAGGGAGGAGGAGGG + Intronic
1176057100 20:63154718-63154740 AGGAGGAGGAGGGAGGAAGAGGG - Intergenic
1176057117 20:63154770-63154792 GGGAGGAGGAGGGAGGAAGAGGG - Intergenic
1176057181 20:63154945-63154967 GTGGGGAGGAGGGAGGAGGGAGG - Intergenic
1176221524 20:63971340-63971362 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1176264778 20:64203508-64203530 GAGGGGAAGAGGGAGGAAGAGGG - Intronic
1176550624 21:8219306-8219328 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1176569554 21:8402347-8402369 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1176577466 21:8446576-8446598 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1176672234 21:9745283-9745305 GAGCAGAGGAGGGAGGAAGAGGG + Intergenic
1176844341 21:13865217-13865239 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1177350339 21:19931456-19931478 GGCTGGAGGAGTGAGGAAGAGGG - Intergenic
1177377877 21:20297569-20297591 GTTGGCCTGAGGGAGGAAGAGGG - Intergenic
1177803755 21:25854038-25854060 GCAGGGCTGAGGGAGGAAGAAGG + Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178400545 21:32281360-32281382 GTGAGGCTGAGGCAGGAGGATGG + Intergenic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1178882480 21:36460453-36460475 GTGGGGACGTTGGAGGAAGACGG - Intergenic
1178932798 21:36834333-36834355 GTGTGCATGAGGGGAGAAAAGGG + Intronic
1178947158 21:36958136-36958158 GGGTGGCTGAGGCAGGAGGATGG + Intronic
1179084946 21:38207858-38207880 GAGGGGAGGAGGGAAGAAGAGGG - Intronic
1179111594 21:38450951-38450973 GTGAGGATGAGGCAGAAACAGGG + Intronic
1179184916 21:39078116-39078138 GTGAGGATGAGCAAGGGAGACGG + Intergenic
1179240081 21:39582132-39582154 AAGTGGAGGAGGGAGGCAGAAGG + Intronic
1179254138 21:39700236-39700258 GTGTGGAGGAGAGAGAATGAGGG - Intergenic
1179262054 21:39766016-39766038 GAGAGCATGAGGGAGGAAGGAGG - Intronic
1179291381 21:40020935-40020957 GTGAGGGTGAGGGATGGAGAAGG + Intronic
1179352531 21:40626212-40626234 GCAGGGATGAGGCAGGAAGATGG - Intronic
1179812015 21:43877886-43877908 GTGTGGGAGATGGAGGAAGGGGG - Intronic
1179962047 21:44773053-44773075 GTGTTGATGAGGTAGGAGGGAGG - Intronic
1180236685 21:46464643-46464665 GTGTGGACGAGAGAGGAAGGGGG + Intronic
1180488782 22:15822491-15822513 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1180613856 22:17114800-17114822 GTGCAGATGTGGGAGGAAGAAGG + Exonic
1180732739 22:17994208-17994230 TGGTGGAGGAGGGAGGAATATGG + Intronic
1181112145 22:20608486-20608508 GAGTGGATGAGGGCAGGAGAAGG + Intergenic
1181376404 22:22461947-22461969 GGGAGGATGAGGCAGGAAAATGG + Intergenic
1181500294 22:23312154-23312176 GTGAGGATGCGGCAGGCAGAGGG + Intronic
1182082062 22:27536567-27536589 GGGAGGCTGAGGGAGGACGACGG - Intergenic
1182251528 22:29004726-29004748 GGGTGGAGGAGGGAGGAGGGCGG + Intronic
1182561508 22:31163430-31163452 GGGTGGCTGAGGTGGGAAGATGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182754425 22:32667228-32667250 GAGTGAGTGAGTGAGGAAGAAGG - Intronic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182845968 22:33431134-33431156 GGATGGAGGAGGGAGGCAGAAGG + Intronic
1182961434 22:34479075-34479097 GAGTGGAGGAAGGAGGAAGAGGG - Intergenic
1183288350 22:36982111-36982133 GTGGGGAAGAGAGAGAAAGAAGG - Intergenic
1183289505 22:36990984-36991006 GTGTGCAGGAGGGAGGACTAGGG + Intergenic
1183666548 22:39249428-39249450 GTGAGGGTGAGGCAGGCAGAGGG - Intergenic
1183733132 22:39629388-39629410 ATATGGATGTAGGAGGAAGAGGG - Intronic
1184119012 22:42438389-42438411 GCGGGGAGGAGGGAGGAAGTGGG - Intergenic
1184272888 22:43394903-43394925 GGGTGGATGTGGGAGCAAAAAGG - Intergenic
1184350018 22:43937319-43937341 TTGTGCATTATGGAGGAAGATGG + Intronic
1184386823 22:44181424-44181446 GTGTGGAGGTGGGAGGACGGCGG + Intronic
1184408528 22:44313538-44313560 GTGGGGATGGGGCAGGAACAGGG + Intergenic
1184449766 22:44575987-44576009 AGGAGGAGGAGGGAGGAAGAAGG + Intergenic
1184631431 22:45783623-45783645 GTGGGGATAAGGGAGAGAGAAGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184852353 22:47128078-47128100 GTGGGGTGGAGGGAGGATGAGGG - Intronic
1184882489 22:47318539-47318561 GGGTGAAGGAGGGAGGGAGATGG - Intergenic
1184980303 22:48090850-48090872 GTGGGGATGAGAGAGAAAGCAGG + Intergenic
1185015872 22:48342232-48342254 GTGAGGATGAGGAGGGAAGGAGG + Intergenic
1185110134 22:48896202-48896224 GTGAGGGTGAGGGAGGAGGGAGG + Intergenic
1185169490 22:49284406-49284428 AAGTGGAAGAGGGAGGCAGAAGG + Intergenic
1185196081 22:49470308-49470330 GTGAGAATGTGGGTGGAAGATGG + Intronic
1185272543 22:49935721-49935743 GTGGGGATGTGGGAGGAGCAGGG + Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
1185377040 22:50487486-50487508 GTGTGGATGGGGGAGAAGGGGGG - Intronic
1203255523 22_KI270733v1_random:135649-135671 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
949127955 3:469118-469140 GTGTGAAAGAGGGAGAGAGATGG - Intergenic
949345018 3:3068468-3068490 GGGAGGGTGAGGGAGGAGGATGG + Intronic
950047289 3:9956545-9956567 GGGTGGCTGAGGCAGGAAAACGG - Intergenic
950200059 3:11036389-11036411 AGGTGGATGTGCGAGGAAGAGGG + Intronic
950273422 3:11638539-11638561 GTGGGGGTTAGGGAGGAAGGGGG - Intronic
950644719 3:14370228-14370250 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
950763423 3:15255411-15255433 GTGGGGATGCGGGGGGATGAGGG - Exonic
950882767 3:16336372-16336394 GTGAGGTGGAGGGAGGGAGAAGG + Intronic
950892770 3:16419396-16419418 GTGTGTATGATGTAGGAAGGGGG + Intronic
951084337 3:18493177-18493199 GGGAAGATGAGGGAGGCAGAAGG - Intergenic
951194147 3:19804728-19804750 GGGAGGAGGAGGGAGGAGGAGGG + Intergenic
951360822 3:21722349-21722371 GAGAGGACGAGAGAGGAAGAAGG - Intronic
951515220 3:23551685-23551707 GTGGGGATGAGAGAGTAAAAAGG + Intronic
951777839 3:26329185-26329207 GTGGGGATGGGGGAGAAACATGG + Intergenic
952534596 3:34296290-34296312 GTCTGGAGAAGGGAGGCAGATGG + Intergenic
952579454 3:34814914-34814936 GTTTGGAGGAGGGGGCAAGACGG + Intergenic
952647616 3:35680760-35680782 GGGAGGAGGAGGAAGGAAGAGGG - Intronic
952710477 3:36427005-36427027 TTGTGGATGAGGCAAGAAGGAGG - Intronic
952902708 3:38120631-38120653 ATGTGGAGGAGGGTGGAAGTGGG + Intronic
953563465 3:44012497-44012519 GTGTGGGTGAGGGAGGGAAGAGG - Intergenic
954022853 3:47757677-47757699 GGGAGGCTGAGGGAGGAAAACGG + Intronic
954528357 3:51294571-51294593 GGGAGGCTGAGGCAGGAAGATGG + Intronic
954696312 3:52429095-52429117 GTGTGCATGTGGGAGGAGGGTGG - Intergenic
954786144 3:53093907-53093929 GGGAGGCTGAGAGAGGAAGAAGG + Intronic
954876403 3:53805731-53805753 GGGAAGATGAGGGAGGAGGAGGG - Intronic
954876409 3:53805751-53805773 GGGAAGATGAGGGAGGAGGAGGG - Intronic
954876415 3:53805771-53805793 GGGAAGATGAGGGAGGAAGAGGG - Intronic
955111142 3:55951120-55951142 GGGTGGATGTGGGTGGGAGATGG + Intronic
955411759 3:58660059-58660081 GTGTGCATGAGTGCGGGAGATGG + Intronic
955671805 3:61410251-61410273 AGGTGCGTGAGGGAGGAAGAAGG + Intergenic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955848294 3:63192292-63192314 GGGTGGGTGGGGGAGGGAGATGG - Intergenic
955868279 3:63409002-63409024 GGGTAGAAAAGGGAGGAAGAGGG - Intronic
956050262 3:65240501-65240523 GTGGGAATGAGGGAGGTAGGGGG - Intergenic
956114658 3:65906320-65906342 GTTAGGATGAGGCAGGCAGATGG + Intronic
956345207 3:68270694-68270716 CTGTGGATGAAGGAACAAGAGGG + Intronic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
956957791 3:74360853-74360875 GAGAGGAAGAGGGAGGCAGAAGG - Intronic
957046298 3:75377752-75377774 GGGAGGATGAGGCAGGAAAATGG + Intergenic
957218851 3:77356321-77356343 GTGTGCATGAGAGAGAGAGAGGG + Intronic
957541592 3:81577179-81577201 GGGAGGCTGAGGGAGGAGGATGG - Intronic
957887480 3:86307268-86307290 GAATGGATGCGGGAGGAAGAGGG - Intergenic
958017933 3:87964451-87964473 TTGTGGCTCAGGGAGGAGGAGGG - Intergenic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958960179 3:100502569-100502591 GAGAGGTTGAGGCAGGAAGATGG - Intronic
959017036 3:101146472-101146494 GTGGGGTTGAGGGAGGGGGAGGG + Intergenic
959993436 3:112654220-112654242 GTGGGTGTGAGGGAGGGAGAGGG + Intergenic
960266157 3:115623532-115623554 GTGTGTGTGAGGGAGAGAGAGGG + Exonic
960404580 3:117244327-117244349 GTATGCATGAGGAAGGAGGAAGG - Intergenic
960504821 3:118479688-118479710 GGGAGGAAGAGAGAGGAAGAGGG - Intergenic
960700619 3:120435856-120435878 GTGTGGATTAGAGAGCAAGCTGG - Intronic
961162119 3:124736540-124736562 GGGAGGATGAGGCAGGAGGATGG - Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961195941 3:125001559-125001581 GTGTTGATGTGGGAGGGGGAGGG - Intronic
961345273 3:126260070-126260092 GAATGGAGGAGGGAGGAAGAGGG - Intergenic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961449640 3:126996714-126996736 GTGTTGTTGAGGGAGGGACAAGG + Intronic
961524864 3:127490389-127490411 GTGTGGGTGGTGGAGGGAGATGG - Intergenic
961766732 3:129217398-129217420 GGGAGGTTGAGGCAGGAAGATGG + Intergenic
961878361 3:130041991-130042013 GGGAGGATGAGGCAGGAAAATGG + Intergenic
962042474 3:131721498-131721520 GTGAGGCTGAGGCAGGAGGATGG - Intronic
962165953 3:133048110-133048132 GAGTGGATGAGGCAGAAAGAAGG + Intronic
962193157 3:133332371-133332393 CAGTGTATGAGGGAGGAAAATGG + Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
962840403 3:139227335-139227357 GGGTGGAGGAGCCAGGAAGACGG + Intronic
963217553 3:142766503-142766525 AGGAGGATGAGGCAGGAAGATGG - Intronic
963357384 3:144226348-144226370 GTTTGAATAAGGGAGGAAGCAGG + Intergenic
963525623 3:146411029-146411051 GTGTGGATGGGGGAGGACAAGGG - Intronic
963534702 3:146513147-146513169 GGGAGAAGGAGGGAGGAAGAAGG - Intergenic
963560087 3:146854123-146854145 GTTTGGAAGATGGAGGAGGAGGG + Intergenic
963843569 3:150132334-150132356 GTGTTGGAGAGGGAGGAAGAAGG - Intergenic
964671345 3:159229718-159229740 GGGAGGATGGGGGAGGAGGAGGG - Intronic
965127712 3:164650928-164650950 GTGGGGATTAGGGAGTATGATGG - Intergenic
965166153 3:165196152-165196174 GTGTAGATGAGAGAAGAAAAGGG + Intronic
965331519 3:167380207-167380229 GGGTGGATGAGAGGGGAGGATGG - Intronic
965476185 3:169158406-169158428 GTATGGATGAGAGAGAAAGAGGG + Intronic
965604716 3:170486468-170486490 GAGTGGCTGAGGGAGTAACATGG + Intronic
965947326 3:174259391-174259413 GTGAGGGTGAGGGAGAATGAGGG - Intronic
966200846 3:177358769-177358791 GTGTGGGTGAAGGTGGAAGTGGG + Intergenic
966318234 3:178672836-178672858 GAGTGGCTGAGATAGGAAGATGG - Intronic
966666083 3:182472355-182472377 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967116209 3:186341405-186341427 GGGAGGCTGAGGAAGGAAGATGG + Intronic
967158539 3:186715238-186715260 GTGTGTGTGAGGGAGGAGTAGGG + Intergenic
967303399 3:188038413-188038435 GTGGGGATGACTGAGGAAGCTGG + Intergenic
967948271 3:194821035-194821057 CTGTGGTTGAGGGAAGCAGAGGG + Intergenic
968032833 3:195517314-195517336 GTGTGAATGGGGGAGGAAAGGGG + Intronic
968422288 4:496115-496137 GTATGGTTGGGGGAGGAAAACGG - Intronic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
968718179 4:2177476-2177498 GCATGGATGAGGGTGGGAGATGG - Intronic
968744440 4:2352400-2352422 GATAGGAGGAGGGAGGAAGAGGG + Intronic
968929548 4:3571447-3571469 GTGGGGGTGAGGGAGGAAGCTGG + Intergenic
968990583 4:3908868-3908890 GGGAGGATGAGGCAGGAAAATGG + Intergenic
969065298 4:4474638-4474660 ATGTGGAAGTGGGAGGCAGAAGG + Intronic
969274682 4:6127438-6127460 CTGTGCCTGAGGGAGCAAGAAGG + Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
969495245 4:7522821-7522843 GGGGGGAGGAGGGAGGGAGAAGG - Intronic
969524839 4:7699147-7699169 GTGTGGGGGAGGCAGGAAAAGGG + Intronic
969529494 4:7722929-7722951 GTGCCGGCGAGGGAGGAAGAGGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969575972 4:8036023-8036045 GTGTGGGTGAGTGGTGAAGATGG + Intronic
969824745 4:9748473-9748495 GGGAGGATGAGGCAGGAAAATGG - Intergenic
969840854 4:9880636-9880658 GTGTGCATGGGTGGGGAAGAAGG + Intronic
969853354 4:9979621-9979643 GTGGGGAGGAGAGAGGCAGAGGG - Intronic
969926988 4:10594294-10594316 GTGGGGTGGAGGGAGGAAGATGG - Intronic
970497804 4:16644887-16644909 ATGAGGATGAGAGTGGAAGAGGG - Intronic
971177174 4:24292734-24292756 GTGGGGGTGAGGGAGTAGGAAGG - Intergenic
971273879 4:25176987-25177009 GTGGGGCTGAGGCAGGAGGATGG - Intronic
971309183 4:25509626-25509648 GGGAGGCTGAGGGAGGCAGACGG - Intergenic
971366280 4:25979592-25979614 GGGTGGATGCGGCAGGAAAAAGG - Intergenic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
972494531 4:39621919-39621941 GGGAGGCTGAGGCAGGAAGATGG - Intronic
972802569 4:42492522-42492544 CTGTGCATGATGGAAGAAGAAGG - Intronic
972942406 4:44213040-44213062 GGGTGGCTGAGGCAGGAGGATGG - Intronic
973393223 4:49573319-49573341 GTGTGGGTGAGGGTGAAACATGG + Intergenic
973538470 4:51909185-51909207 GTATTGATGATGGTGGAAGAAGG + Intronic
973805941 4:54526356-54526378 GGGTGGCTGAGGCAGGAGGATGG + Intergenic
973811239 4:54572227-54572249 TGGGGGAGGAGGGAGGAAGAGGG + Intergenic
974090872 4:57310147-57310169 GTGTGTATGAGAAAGGATGAAGG - Intergenic
974146404 4:57953392-57953414 GGGAGGAAGAGAGAGGAAGAAGG + Intergenic
974177192 4:58339314-58339336 GTGGGGTTGGGGGAGGAGGAAGG + Intergenic
974568133 4:63606202-63606224 GTGAGAATGAGGGAGAGAGAGGG + Intergenic
974631646 4:64498194-64498216 GTGAGGATGAGAGAGAAAGCAGG - Intergenic
974736324 4:65938149-65938171 GTGTTGATTAGAGAGGTAGAGGG - Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975053583 4:69898297-69898319 GTGTGCATGGTGGAGGAAGATGG - Intergenic
975314290 4:72933505-72933527 TTGTGGTTGAGGAAAGAAGAGGG - Intergenic
975600829 4:76097862-76097884 GTGGGGATGAGGGTGGCAGTGGG - Intronic
975780673 4:77836340-77836362 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
976267519 4:83198045-83198067 GTAAGGAAGAGGGAAGAAGACGG + Intergenic
976829591 4:89299391-89299413 GTGTGCATGAGGAAGGAAAGTGG + Intronic
977307332 4:95341840-95341862 GTGTCCTTGGGGGAGGAAGAGGG + Intronic
977493455 4:97742213-97742235 GTGGGGTTGGGGGAGGAAGGAGG + Intronic
977990721 4:103438281-103438303 GTGAGGCTGAGGTAGGAGGATGG + Intergenic
978007528 4:103635982-103636004 GTGCCTATGAGAGAGGAAGAAGG - Intronic
978133342 4:105226637-105226659 GAGAGGAAGAGGGAGGAAGAGGG - Intronic
978291389 4:107145044-107145066 GTGGGGAGGAGGGAGTAAAAGGG + Intronic
978624981 4:110675043-110675065 GTCAGGAGGAAGGAGGAAGAAGG + Intergenic
978695438 4:111571344-111571366 GTAGGGATGGGGGAGGAAGGTGG - Intergenic
979472648 4:121118809-121118831 GTCTGGAAGTAGGAGGAAGAGGG - Intergenic
979619847 4:122786692-122786714 ATGTGGACGAGGGAGGGAAAGGG - Intergenic
979696655 4:123620435-123620457 GAGTGGATGAGGGAAGAAGAAGG + Intergenic
979848900 4:125552210-125552232 GTGCGCATGAGAGAGAAAGAAGG + Intergenic
980070273 4:128236211-128236233 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
980318075 4:131231766-131231788 GTGTGTATGAGGGTGAGAGAAGG - Intergenic
980368837 4:131840908-131840930 TTGAGGTTGAGGGAGGAAAAAGG - Intergenic
980773520 4:137409624-137409646 GGGAGGCTGAGGGAGGAAAATGG - Intergenic
980884996 4:138752637-138752659 GGGTGGAGGAGGAAGGAAGGGGG - Intergenic
980928673 4:139164062-139164084 GTGGGGGTGAGAGAGAAAGAGGG + Intronic
981011960 4:139934345-139934367 GTGTTGAGGAGGGAGGGAAAAGG + Intronic
981616389 4:146648362-146648384 TTGTGGACGAGGAAGGAAGGTGG + Intergenic
981919645 4:150073604-150073626 GTGGGGTTGAGGGAGTAAGCAGG + Intergenic
981975160 4:150719260-150719282 GTGTGAATGAGAGAGAATGATGG - Intronic
981982462 4:150810704-150810726 GGGAGGCTGAGGCAGGAAGACGG - Intronic
982315872 4:154031281-154031303 GTATGGTTGAGGGAGGAATGGGG + Intergenic
982737292 4:159019721-159019743 GTGTGGCTGTGGCAGGAACAAGG + Intronic
982743548 4:159082841-159082863 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
983029583 4:162783145-162783167 GAGAGGATGAGGGAGGGAGGAGG - Intergenic
983151337 4:164285545-164285567 GTGAGGCTGAGGCAGGAAAATGG - Intronic
983634197 4:169881305-169881327 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
983908385 4:173208521-173208543 GTGCGGAGGAGGGGGTAAGAAGG - Intronic
983970465 4:173865041-173865063 GTGTGCCTAAGGGAGGAAGTTGG + Intergenic
984432231 4:179664277-179664299 GTGTGGGTGAGGGTGAATGAGGG - Intergenic
984494301 4:180475268-180475290 GTGTGGGTGAGGGTGGGTGAAGG + Intergenic
984501853 4:180566910-180566932 GTGTGGGTGAGGGTGAATGAAGG + Intergenic
984573726 4:181423362-181423384 GGGAGGCTGAGGTAGGAAGAGGG + Intergenic
984985960 4:185329704-185329726 GAGAGGATGAGGGAGGAGGAGGG + Intronic
985160278 4:187036804-187036826 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985338228 4:188919004-188919026 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
985402500 4:189606565-189606587 GAGCAGAGGAGGGAGGAAGAGGG - Intergenic
1202764908 4_GL000008v2_random:141600-141622 GTGTGGGTGAGGGTGAAACATGG - Intergenic
985701386 5:1375207-1375229 GAGGGGATGAGGTAGGAAGGTGG + Intergenic
986690264 5:10307952-10307974 GGGTGGGGTAGGGAGGAAGAGGG + Exonic
987129104 5:14844004-14844026 TTGTGGATGATGCAGGAACACGG - Intronic
987390244 5:17368564-17368586 GGGTGGATGAGGGAAGATGCTGG + Intergenic
987739839 5:21893257-21893279 TTGTGGTTGAGGGAAAAAGAGGG + Intronic
988499356 5:31771493-31771515 GTGTGGTTGGGGGAGACAGAGGG + Intronic
989323540 5:40164863-40164885 GGGTTGAAGAGGGAGGAAGGTGG + Intergenic
989770880 5:45143970-45143992 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
991068676 5:62452855-62452877 GTGAGGCTGAGGTAGGAGGATGG - Intronic
991085725 5:62646913-62646935 GTGTGGCAGAGGGAGGAAGGAGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
991777441 5:70098978-70099000 GTCTGGAGGAGCGAGGAAGACGG - Intergenic
991856729 5:70974422-70974444 GTCTGGAGGAGCGAGGAAGACGG - Intronic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
992128303 5:73665639-73665661 GAGAGCATGAGAGAGGAAGAGGG + Intronic
992918992 5:81492952-81492974 GTGTGGGTGAGGCAGGGAGTGGG + Intronic
993252513 5:85547845-85547867 GTGTGCTTGTGGGAGGGAGAAGG + Intergenic
993339757 5:86709005-86709027 GTGTGGATAAGTGAGGTAGAGGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993515396 5:88827258-88827280 GAGGGAAGGAGGGAGGAAGAGGG - Intronic
994140115 5:96332861-96332883 GTGTGGAGGAGGGAAAAACAGGG - Intergenic
994436465 5:99740889-99740911 GTGTTGATGACGGTAGAAGAAGG - Intergenic
994556453 5:101312559-101312581 GGAAGAATGAGGGAGGAAGAAGG - Intergenic
995560993 5:113381546-113381568 GGGAGGCTGAGGCAGGAAGATGG + Intronic
996537007 5:124587985-124588007 GTGTGCATGCTGGGGGAAGATGG - Intergenic
996759325 5:126971342-126971364 GGGTGGCTGAGGCAGGAAAATGG + Intronic
996845881 5:127898566-127898588 GTGAGAAGGAGGGAGGAGGAAGG + Intergenic
996853369 5:127977680-127977702 GAGGGGGTGAGGGAGGAAGGAGG - Intergenic
997166131 5:131661598-131661620 GTGTGGGGGAGCGAGGGAGAGGG - Intronic
997196128 5:131981121-131981143 GTGTGGGTGGGGGAGAAAGGAGG - Intronic
997342459 5:133155448-133155470 AAGTGGAAGAGGGAGGCAGAGGG + Intergenic
997616372 5:135248967-135248989 GTGTGGAGGAGGGAGCCACAAGG + Intronic
997715036 5:136036214-136036236 GTCTGGATGAGGTGGGGAGATGG + Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
998380056 5:141717865-141717887 GTGGTGATGGGGGAGGAACAGGG + Intergenic
998470880 5:142382820-142382842 GAGTGGAGGAGGTAGGAAAAGGG - Intergenic
998499551 5:142620311-142620333 GGGAGGCTGAGGGAGGAAAATGG + Intronic
998852136 5:146361292-146361314 GTGTGAAAGAGAGAGAAAGAGGG + Intergenic
999192587 5:149759657-149759679 GTGAGGATGAGGGAAGGAGCCGG - Intronic
999295498 5:150457266-150457288 GTGCTAATGAGGAAGGAAGACGG + Intergenic
999379442 5:151109989-151110011 TTGTGCTTGAGGAAGGAAGAGGG - Intronic
999573289 5:152944892-152944914 GTGGGGTTGGGGGAGGGAGAAGG + Intergenic
999902850 5:156104996-156105018 GTGGGGTTGGGGGAGGGAGAGGG + Intronic
1000126047 5:158245125-158245147 GGGAAGATGAGGGAGAAAGATGG - Intergenic
1000177314 5:158770210-158770232 GTGGGGATGAGGGAGACAGAGGG - Intronic
1000444866 5:161307119-161307141 GTGGTGAGGAAGGAGGAAGAAGG - Intronic
1000641360 5:163706278-163706300 GTGTGGCTGAAGTACGAAGAGGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000829394 5:166084299-166084321 GTGTGAAGGAGAAAGGAAGAAGG - Intergenic
1000907908 5:166985710-166985732 CTGTGGATGAGTGTGGAAAACGG + Intergenic
1001132977 5:169079784-169079806 AGGAGGAGGAGGGAGGAAGAGGG + Intronic
1001381794 5:171310501-171310523 GTGTGTTTGGGGGAGGCAGAGGG - Intronic
1001738008 5:174022865-174022887 GATTGGATGTAGGAGGAAGAAGG + Intergenic
1002085111 5:176769756-176769778 GAGTGGATGAGCCAGGGAGAGGG + Intergenic
1002113112 5:176934412-176934434 GTATGTTTGAGGCAGGAAGACGG - Intronic
1002308404 5:178297795-178297817 GAATGGATGAGGGCTGAAGAGGG + Intronic
1002582180 5:180215583-180215605 ACGTGGAAGAGGGAGGCAGAAGG + Intergenic
1002857948 6:1054995-1055017 GGGTGGAGGAGGCAGGAAGATGG - Intergenic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003269791 6:4598040-4598062 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
1003600444 6:7512058-7512080 GGGAGGATGAGGTGGGAAGATGG + Intergenic
1003727342 6:8780161-8780183 GGGAGGCTGAGGTAGGAAGAGGG - Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004178925 6:13364630-13364652 GTGGGGATCAGGGAGGTGGAGGG - Exonic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1004522707 6:16377434-16377456 GGAAGGATGAGGGAAGAAGAAGG - Intronic
1004686570 6:17952197-17952219 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1005148538 6:22721201-22721223 GGGAGGATGAGAGAGGAAAATGG + Intergenic
1005318206 6:24624958-24624980 AGGAGGCTGAGGGAGGAAGATGG + Intronic
1005361258 6:25033097-25033119 GGGAGGCTGAGGTAGGAAGACGG + Intronic
1005424298 6:25684994-25685016 ATATGGAAGAGGGAGGCAGAAGG + Intronic
1005805282 6:29468538-29468560 GTGTGGATGTGGGGAGAGGAGGG + Intergenic
1006131374 6:31871256-31871278 TAGAGGATCAGGGAGGAAGAAGG + Intronic
1006164313 6:32055824-32055846 GTGTTTGTGAGTGAGGAAGATGG - Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006373565 6:33659607-33659629 GGGTGGAGAAGGCAGGAAGAGGG - Intronic
1006388288 6:33744530-33744552 GTGTGGCTGAGGGAGAATGCAGG + Intronic
1006442204 6:34059685-34059707 GAGTGGGTGATGGAGGGAGATGG + Intronic
1006514027 6:34536162-34536184 GTTTGGAGGAGTAAGGAAGATGG - Intergenic
1006735953 6:36272622-36272644 GTGTGTTTGAGGGAGCAAGGTGG + Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1007089227 6:39171945-39171967 GGGTGGATTATGGAGCAAGATGG - Intergenic
1007447029 6:41914753-41914775 GTGTGGATGATGGGGGATGATGG - Intronic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007600353 6:43077125-43077147 CTGCGGGTGAGGGCGGAAGAAGG + Intronic
1007610646 6:43146710-43146732 GAGTGAAGGAGGGAGGGAGAGGG + Intronic
1007616520 6:43182705-43182727 GTGAAGAGGAGGGAGAAAGATGG - Intronic
1007620793 6:43213361-43213383 GTAAGGATGAAGGAGGAACAGGG - Intronic
1007634045 6:43287431-43287453 GTTTGGAGCTGGGAGGAAGAAGG + Exonic
1007636699 6:43304004-43304026 AAGAGGATGAGGGAGGCAGATGG - Intronic
1007697760 6:43744534-43744556 CTTGGAATGAGGGAGGAAGATGG + Intergenic
1007755775 6:44098484-44098506 TTGGGGAGGAGGGAGGTAGAAGG - Intergenic
1007773422 6:44209201-44209223 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1007817258 6:44533371-44533393 GTGGGGATGGGGGAGGAAGCAGG + Intergenic
1007912745 6:45532407-45532429 GTGTGGGTCAGGGAGGGAAAGGG + Intronic
1008408665 6:51147560-51147582 GTGGGGTGAAGGGAGGAAGAAGG + Intergenic
1008613964 6:53208505-53208527 GTGAGACTGAGGGATGAAGAAGG + Intergenic
1008863258 6:56176978-56177000 GGGAGGAAGAGGGAGGAGGAAGG + Intronic
1009308892 6:62125202-62125224 GTGTGCTTGCGAGAGGAAGAGGG + Intronic
1009640435 6:66328509-66328531 GTGTTGAAGAGGGTGGAATATGG - Intergenic
1009870682 6:69449581-69449603 GGGTGGCTGAGGCAGGAAAATGG + Intergenic
1010253316 6:73730987-73731009 GTGTGTATGAGAGAGAAAAAGGG + Intronic
1011356031 6:86474121-86474143 GTGTGGATGTGGGAGGACAAAGG + Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012393875 6:98773278-98773300 GTGAGACAGAGGGAGGAAGAAGG - Intergenic
1012420200 6:99056479-99056501 GTGGGTAGGAGGGAGGAAGATGG + Intergenic
1012776505 6:103500842-103500864 GTGGGGATGAGGGGAGAGGATGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013056602 6:106589213-106589235 GGGAGGAGGAGGGAGGAGGAGGG + Intronic
1013082639 6:106825561-106825583 GTCTGGATGGTGGAGGAAGCTGG - Intergenic
1013084562 6:106845548-106845570 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1013299377 6:108789482-108789504 GTGGGGTTGAGGGAGGGGGAAGG - Intergenic
1013972647 6:116039601-116039623 GTTTGGATGAGGCCGCAAGAGGG - Intronic
1013986553 6:116200880-116200902 GAGTGGGTGGGGGAAGAAGAAGG - Intronic
1014541242 6:122678935-122678957 GTCAGCATGATGGAGGAAGAGGG + Intronic
1014633961 6:123821719-123821741 GTGTGGCTGTGGGAGGATGAGGG + Intronic
1015101016 6:129480515-129480537 GGGAGGAGGAGAGAGGAAGATGG + Intronic
1015214632 6:130735482-130735504 GTGTGGATGCAATAGGAAGAAGG + Intergenic
1015270216 6:131330213-131330235 GGGTGGGTCAGGGAGGATGAGGG + Intergenic
1015328608 6:131951480-131951502 GAGTTGATGAGGCAGGAAGGTGG - Intergenic
1015374213 6:132491677-132491699 GTGTGGCTGAGGGAGGGTGGAGG - Intronic
1015380471 6:132561511-132561533 GTGTGTATGTGGGTGGAGGAGGG + Intergenic
1016446294 6:144135798-144135820 GTGTAGATGAGAGAAGATGAGGG + Intergenic
1016700710 6:147050763-147050785 GTGTGTATTGGGGAGAAAGAAGG - Intergenic
1016940187 6:149477074-149477096 ATGAGGATGAGGGAGAAAGGTGG - Intronic
1017031768 6:150230180-150230202 GTTTAGATGAGTGAGGAAAATGG - Intronic
1017238231 6:152139464-152139486 GTGGGGCTGAGGCAGGAGGATGG + Intronic
1017362781 6:153595502-153595524 GTGACTATAAGGGAGGAAGAGGG - Intergenic
1017479745 6:154840452-154840474 GTGTGGATTAGGTAAGAATATGG - Intronic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017741799 6:157413074-157413096 CGGTGAATGAGGGAGGAAGTGGG + Intronic
1017865780 6:158442043-158442065 GGGAGAATGAGGGAGGAGGAGGG - Intronic
1017866590 6:158449248-158449270 ATGTGGAGGAGGGAGGGTGAAGG + Intronic
1017888493 6:158620486-158620508 GTGAGGAAGAGAGAGGGAGAGGG + Intronic
1018033794 6:159865188-159865210 GTGGGGATGTGGGGTGAAGAGGG + Intergenic
1018493885 6:164327598-164327620 GTATGAAAGAGAGAGGAAGATGG + Intergenic
1018641588 6:165908868-165908890 GTGTGGTGGGTGGAGGAAGACGG - Intronic
1018699564 6:166415992-166416014 GTGGGGGTGATGGAGGAGGATGG - Intronic
1018767433 6:166945135-166945157 GTGTGGACGTGGGTGGATGAGGG - Intronic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019320786 7:414393-414415 AGGGGGAGGAGGGAGGAAGAGGG - Intergenic
1019609375 7:1929217-1929239 GGATGGAGGAGCGAGGAAGAGGG - Intronic
1019626532 7:2018741-2018763 GGCTGGGTGAGGGAGGAAGATGG - Intronic
1019712126 7:2522580-2522602 GGGTGGATGAGGGTGGACGGGGG - Intronic
1019805401 7:3120110-3120132 GTGAGGATGATGGAGGCATATGG - Intergenic
1019913736 7:4117361-4117383 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1020027984 7:4912654-4912676 GTGGTGATGACTGAGGAAGAGGG + Intronic
1020084760 7:5304183-5304205 GGGTGGATCAGGGAGCAGGAGGG + Exonic
1020190150 7:5989560-5989582 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1020434866 7:8151718-8151740 ATGTGGAGGTGGGTGGAAGAAGG + Intronic
1020820157 7:12957179-12957201 GTGAGTATCAGGGAGGAAGAAGG + Intergenic
1021007340 7:15415199-15415221 GTGAGGCTGAGGCAGGAGGATGG - Intronic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1021515615 7:21481328-21481350 GTGTGGAAACGGGAGGAAGTAGG + Intronic
1021943798 7:25705290-25705312 GTGGGGATGGGGGAGAAGGAGGG + Intergenic
1022249402 7:28592489-28592511 TTTTGGATGAGGGAGCAAGGGGG + Intronic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022383780 7:29884065-29884087 GTTTTGATGGGGGAGGAAGAGGG - Exonic
1022414744 7:30168251-30168273 GTGTGGGAGAGTGAGGAAGAGGG + Intergenic
1022733420 7:33053554-33053576 GGGAGGCTGAGGGGGGAAGACGG + Intronic
1023058320 7:36307250-36307272 GTTTGGAAGAGGGAGGAGGGAGG - Intergenic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023399201 7:39779561-39779583 AAGTGGAAGAGGGAGGCAGAAGG - Intergenic
1023598021 7:41853128-41853150 TTGTAGATTAGGGAGAAAGAAGG - Intergenic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1023743718 7:43303073-43303095 GTGTGGGAGAGGGAGGAAGGTGG - Intronic
1023931844 7:44711053-44711075 GGGTGGGTGAGGGTGAAAGAGGG + Intergenic
1023965650 7:44962002-44962024 GAGGGGCTGAGGGAGGCAGAGGG + Intergenic
1023989330 7:45118817-45118839 GAGCTGATGAGGGAGGCAGAAGG + Intergenic
1024064013 7:45718157-45718179 GCTTGGATGAGGAAGGAAGGAGG + Exonic
1024172969 7:46809470-46809492 GAGAGGATGAGAGAGGCAGAGGG - Intergenic
1024264210 7:47594298-47594320 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1024651242 7:51405144-51405166 AAGTGGAAGAGGGAGGCAGAAGG + Intergenic
1024779861 7:52835418-52835440 GTGTGTATAAGGGAGGAATTGGG - Intergenic
1025055375 7:55760725-55760747 AAGTGGAAGAGGGAGGTAGAAGG + Intergenic
1025133447 7:56390954-56390976 AAGTGGAAGAGGGAGGCAGAAGG + Intergenic
1025209545 7:57013017-57013039 GGGTGGATCAGGGAGCAGGAGGG - Intergenic
1025662403 7:63563833-63563855 GGGTGGATCAGGGAGCAGGAGGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026040128 7:66861316-66861338 GAGAGGCTGAGGCAGGAAGATGG + Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026180687 7:68037200-68037222 GAGTGGAGGAGAGAGGAAAAAGG - Intergenic
1026185382 7:68078957-68078979 GTGTTGGCGAGGAAGGAAGAAGG + Intergenic
1026290073 7:68998232-68998254 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1026312778 7:69202148-69202170 CTGTGGATGAGAGAGGGACAGGG - Intergenic
1026796978 7:73372396-73372418 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027277016 7:76567505-76567527 GGGTGGCTGAGGTGGGAAGATGG + Intergenic
1027919237 7:84370982-84371004 GAATGGATGATGGAGGGAGAGGG + Intronic
1027955121 7:84868130-84868152 GTGTGTGTGAGAGAGAAAGAAGG - Intergenic
1028064742 7:86369287-86369309 GTGGGGTTGGGGGAGGAGGAAGG + Intergenic
1028177572 7:87675184-87675206 GGGTGGAAGAGGGAGGAAGCCGG - Intronic
1028320410 7:89452443-89452465 GTGTGGAGGGGGGAGGGAAATGG + Intergenic
1028396992 7:90380791-90380813 GGGTGCTTGGGGGAGGAAGATGG - Intronic
1028513460 7:91650482-91650504 GTGTGGGTTAGGAATGAAGATGG - Intergenic
1028658547 7:93238840-93238862 GTGTGCCTGAGAGAGGGAGACGG + Intronic
1028830100 7:95318300-95318322 GTATGTATGTGAGAGGAAGAAGG - Intronic
1028853043 7:95557976-95557998 GTCTGGAAGAGTGAGGAAAATGG + Intergenic
1029130631 7:98327844-98327866 GTGTGGTTGAGGGAGGTAAGGGG + Intronic
1029170404 7:98626039-98626061 GGGAGGCTGAGGCAGGAAGATGG + Intronic
1029190553 7:98768943-98768965 GGGAAGCTGAGGGAGGAAGATGG - Intergenic
1029519481 7:101051047-101051069 GTGTGGATCATGGCAGAAGAGGG + Intronic
1029692503 7:102191583-102191605 TTTTGGAAGAGGGAAGAAGAGGG - Intronic
1030630350 7:111888723-111888745 GTGAGGAAGAGGGGGGAAGATGG - Intronic
1031167039 7:118241413-118241435 GTGGGGATGGGGGATGGAGAGGG - Intronic
1032061327 7:128727727-128727749 GAGTGGATGGGGGATGAAGGAGG - Intronic
1032227220 7:130042196-130042218 GAGAGGCTGAGGGAGGAGGATGG + Intronic
1032332561 7:130993829-130993851 GGGAGGGTGAGGGAGGAGGATGG + Intergenic
1032417948 7:131752682-131752704 GGGAGGCTGAGGTAGGAAGATGG - Intergenic
1032538565 7:132684883-132684905 TGGTGGATGAGTGGGGAAGAGGG - Intronic
1032625157 7:133583975-133583997 GTGTGGGTCGGGGAAGAAGAAGG + Intronic
1032644995 7:133813836-133813858 GTGTGGTGGGGGGATGAAGATGG - Intronic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033724808 7:144103618-144103640 GTGAGGATGAGGGACCAGGAGGG - Intergenic
1033818970 7:145110254-145110276 GTCTGCTTGAGGGAGGAGGATGG - Intergenic
1033890428 7:146006394-146006416 GGGAGGATGGGGGAGGAGGAGGG - Intergenic
1034119880 7:148617505-148617527 GAAGGGAGGAGGGAGGAAGAAGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034468586 7:151244030-151244052 GTGGGGATGAGGGAGGACAAAGG + Intronic
1034471475 7:151256900-151256922 GTGTGGAGGAGGGACGGAGCTGG - Intronic
1034478047 7:151300077-151300099 GTGTGCATGGGTGAGGAAGCAGG + Intergenic
1034629642 7:152521209-152521231 GGGAGGATGAGGGAGGATGGAGG - Intergenic
1034780707 7:153879291-153879313 GTGTGGATGCTGGGGGTAGAGGG + Intergenic
1035100106 7:156389426-156389448 GTGTTGGTGAGGAATGAAGAAGG - Intergenic
1036191107 8:6671185-6671207 GAGTGGATGTGGGAGGAATCAGG + Intergenic
1036561979 8:9905854-9905876 GGGTGGAGGAGGGAGGGGGAGGG + Intergenic
1036665389 8:10734059-10734081 GAGGAGAAGAGGGAGGAAGAGGG + Intronic
1036733836 8:11289611-11289633 TTGTGGATGAGGCAGGAAACGGG - Intronic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1036784007 8:11673347-11673369 ATGTGGAGGAGGGAGGCAGTGGG + Intergenic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038311502 8:26449330-26449352 GTGCGGAGGAGGGGGGAGGACGG + Intronic
1038542622 8:28402236-28402258 GTGGGGAGGAGGGAGGGAGGGGG + Intronic
1038569350 8:28647207-28647229 GGGAGGATGAGGGAGGACAATGG - Intronic
1038592833 8:28856237-28856259 ATATGGAGCAGGGAGGAAGAGGG + Intronic
1038817207 8:30916825-30916847 GTGAGGCTGAGGCAGGAGGATGG - Intergenic
1038969989 8:32622505-32622527 GGGAGGCTGAGGAAGGAAGATGG - Intronic
1039218638 8:35302083-35302105 GGGGGAAGGAGGGAGGAAGAAGG + Intronic
1039399473 8:37257012-37257034 GTTTGGATGATGGAGAAAGGAGG + Intergenic
1039566766 8:38557527-38557549 GTAGGGGTGGGGGAGGAAGAGGG + Intergenic
1039812188 8:41058999-41059021 GGGAGGCTGAGGTAGGAAGATGG + Intergenic
1039908095 8:41800817-41800839 GGGAGGATGAGGCAGGAGGATGG - Intronic
1040293740 8:46138625-46138647 GTAAGGTTGAGGGAGGCAGAAGG - Intergenic
1040301829 8:46191980-46192002 GTGAGGTTGAGGCAGGCAGAGGG + Intergenic
1040428015 8:47308640-47308662 GTGGGGATGGGGGTGGGAGAGGG + Intronic
1040453149 8:47568581-47568603 ATGAGGTTGAGGGTGGAAGATGG - Intronic
1040598743 8:48864176-48864198 AGGTGGAGGAGGGATGAAGAGGG - Intergenic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1041568006 8:59302730-59302752 GAAGGGAAGAGGGAGGAAGATGG + Intergenic
1041607658 8:59802194-59802216 GTGTGTGTGAGGGAGGTGGAAGG - Intergenic
1041908269 8:63057668-63057690 GTATGGGTGTGGGAGGAGGATGG + Intronic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042395580 8:68287951-68287973 GTTGGGGTGAGGGAGGAGGATGG + Intergenic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1042875066 8:73434176-73434198 GTTTTGAAGATGGAGGAAGAGGG + Intronic
1042927668 8:73983066-73983088 ATGTGTATGAGGGAGGTTGATGG + Intergenic
1043510895 8:80949222-80949244 GTGTGGATGTGGGAGTGGGATGG + Intergenic
1043914089 8:85900231-85900253 TTCTGGATGATGCAGGAAGAGGG - Intergenic
1044369121 8:91388349-91388371 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1044682497 8:94796255-94796277 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
1045162338 8:99562383-99562405 GGGAGGATGAGGCAGGAAAATGG - Intronic
1045321703 8:101086638-101086660 GTGTTGATGTGGGAGGAAGCTGG + Intergenic
1046619601 8:116514406-116514428 GTGTTGAAGAGACAGGAAGAAGG - Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046892917 8:119442636-119442658 GTGAGGAGGAGAGAAGAAGAGGG + Intergenic
1047073144 8:121370552-121370574 GTGAGGCTGAGTGAGGAAAATGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047658352 8:127003743-127003765 GAGTGGAGGAAAGAGGAAGAAGG - Intergenic
1047773436 8:128049314-128049336 GAGTGAATGAGGAAGGAAGGCGG + Intergenic
1048010155 8:130448867-130448889 GTGGGCAGGAGGGAGGCAGAGGG + Intergenic
1048242951 8:132762336-132762358 GGCTGGAAGAGGGAGGATGAGGG - Intergenic
1048317925 8:133375616-133375638 GTCTCCATGTGGGAGGAAGATGG - Intergenic
1048977911 8:139683324-139683346 GAGGGGAGGAGGGAGGGAGAAGG - Intronic
1049083184 8:140458084-140458106 GGGTGGAGGAGGGAGGAGGGAGG + Intronic
1049097628 8:140558227-140558249 GTGAGGCTCAGGAAGGAAGAGGG + Intronic
1049231723 8:141488266-141488288 TTGAGGGGGAGGGAGGAAGATGG - Intergenic
1049645637 8:143734418-143734440 GAGGGGGTGAGGGAGAAAGATGG - Intergenic
1050184681 9:2960478-2960500 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1050298891 9:4236426-4236448 ATGTGGAAAAGGGAGGAAAAGGG - Intronic
1050331949 9:4554632-4554654 GAGGGGATGAGACAGGAAGATGG + Intronic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051444834 9:17129177-17129199 GTGGGTATGAGGGAAGAAGTTGG + Intergenic
1051531415 9:18108302-18108324 GGGAGGATGAGGTGGGAAGATGG - Intergenic
1051715253 9:19976121-19976143 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1051785992 9:20744158-20744180 GGGTGGTTGTGGGAGGAGGAGGG + Intronic
1052651973 9:31316127-31316149 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1053036182 9:34828207-34828229 TTGTGGATAAGGGAAGAAAAAGG - Intergenic
1053054715 9:34987794-34987816 GTGAGGAGGAGTGAGGAAGGGGG - Intergenic
1053461991 9:38278360-38278382 GTGAGGATGGGGGAGGAACAGGG - Intergenic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1054460730 9:65461019-65461041 GTGGGGGTGAGGGAGGAAGCTGG - Intergenic
1055068223 9:72140352-72140374 GTGTGGAAGAGAGAAGGAGAAGG + Intronic
1055124483 9:72703364-72703386 GGGAGGCTGAGGTAGGAAGATGG - Intronic
1055516401 9:77037892-77037914 GTGTGATTGTGGGAGGAAAATGG - Intergenic
1055825867 9:80323881-80323903 GTGAGGATGAGGAAGGTAGCTGG - Intergenic
1055831028 9:80379096-80379118 GTTGGGATGTGGGTGGAAGAGGG - Intergenic
1056075174 9:83030941-83030963 ATGAGGATGAGGGAGAAAGTGGG - Intronic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1056678968 9:88700659-88700681 GGGTGGCTGAGGCAGGAGGATGG + Intergenic
1056773997 9:89498233-89498255 GCGAGGAGGAGGGAGGAGGAAGG - Intergenic
1056811926 9:89771731-89771753 GTCAGGCTGAGGGTGGAAGATGG + Intergenic
1056911783 9:90707713-90707735 GGGTGGATGTGTGGGGAAGATGG - Intergenic
1057070949 9:92099582-92099604 GGGAGGATGAGGTGGGAAGATGG - Intronic
1057114176 9:92504776-92504798 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1057120069 9:92563758-92563780 GTAGGGAGGGGGGAGGAAGAGGG - Intronic
1057387139 9:94614193-94614215 GGGAGGAGGAGGGAGGGAGAAGG + Intronic
1057497998 9:95575304-95575326 GAGGAGAAGAGGGAGGAAGAAGG + Intergenic
1057537476 9:95926902-95926924 GTGTGGAGGAGGTTGGAAGTAGG + Intronic
1057865858 9:98680408-98680430 GTGAGGCTGAGGCAGGAAAATGG - Intronic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1058464126 9:105211235-105211257 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1058579698 9:106441481-106441503 TTGTAGATGGGGGAGGAAAAAGG + Intergenic
1058656713 9:107228928-107228950 CGGGGGATGGGGGAGGAAGAGGG + Intergenic
1059846462 9:118282730-118282752 GTGTTGATGAGTGAGGTACAAGG + Intergenic
1060398000 9:123329587-123329609 GTCTGGATGAGGGAAGAATTTGG - Intergenic
1060469036 9:123931880-123931902 GTGTTGGAGAGGGAGGTAGAAGG + Intergenic
1060683005 9:125582500-125582522 GTTTGGATGAGGGTGGAGGGTGG - Intronic
1060732895 9:126049316-126049338 GTCTGGAGGAGGGAGGAAGGAGG + Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061035976 9:128114613-128114635 GTCTGAATGCTGGAGGAAGAAGG - Intergenic
1061246144 9:129402114-129402136 GTGGGGAGGAGGGAGGAGGGAGG - Intergenic
1061275776 9:129568848-129568870 GGGAGGAGGAGGGAGGAGGAGGG + Intergenic
1061451267 9:130668084-130668106 GTGTGGATGTGCCTGGAAGATGG + Intronic
1061553036 9:131349006-131349028 TGGGGGATGAGGGAGGCAGAGGG - Intergenic
1061799396 9:133105752-133105774 GTGTGCGTGAAGGGGGAAGAGGG - Intronic
1061900030 9:133668297-133668319 GTGGGGGAGAGGGAGGGAGAGGG - Intronic
1061900399 9:133669303-133669325 GGGAGGGTGAGGGAGGATGAGGG - Intronic
1062183212 9:135202339-135202361 GTGTGGGTGAGTAAGGATGAGGG - Intergenic
1203471919 Un_GL000220v1:118784-118806 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1203545658 Un_KI270743v1:126488-126510 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1185550680 X:980847-980869 GCTGGGATGATGGAGGAAGAGGG + Intergenic
1185608543 X:1380672-1380694 GGGTGGAGGAGGGAGGAAAAGGG + Intronic
1186107952 X:6226868-6226890 GCGGGGATGAGGTAGGGAGAGGG - Intronic
1186333443 X:8560830-8560852 GAGTGGATGAGGGAGAAATTTGG - Intronic
1186550936 X:10504698-10504720 TTTTGGATGGGGGAAGAAGAAGG + Intronic
1186597803 X:11002818-11002840 GTGTGGATGTTGGGGGAGGAGGG - Intergenic
1186624968 X:11283659-11283681 ATGTGGAACAGGGAGGCAGAAGG + Intronic
1187110053 X:16288783-16288805 GAGGGAAAGAGGGAGGAAGAGGG - Intergenic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187247708 X:17567804-17567826 GAGGGGAGGAGGGAGGAAGAAGG + Intronic
1187566180 X:20451721-20451743 GTGTGGCTGAGGCGGGGAGAAGG - Intergenic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1187889955 X:23924663-23924685 GTGGGGATGAGGGAGGGGGGAGG + Intronic
1188079133 X:25815164-25815186 GGGAGGAAGAGGGAGGGAGAGGG - Intergenic
1188079137 X:25815174-25815196 GGGAGGAAGAGGGAGGAAGAGGG - Intergenic
1188079140 X:25815184-25815206 GAGAGGGAGAGGGAGGAAGAGGG - Intergenic
1188087098 X:25913021-25913043 GTGGAGATGAAGGAGGAACATGG - Intergenic
1188136072 X:26496900-26496922 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1188236630 X:27739729-27739751 GTGAGGATTAGGGATGAGGATGG - Intronic
1188333720 X:28902274-28902296 GGGAGGCTGAGGTAGGAAGATGG - Intronic
1188340824 X:28999211-28999233 GTGTGTAGGCGGGAAGAAGATGG - Intronic
1188469313 X:30519488-30519510 GTGTGGATGAGCAAAGAAAATGG + Intergenic
1188590847 X:31833252-31833274 GTGTAGATGGGGGAGGAAGGGGG + Intronic
1189288197 X:39866885-39866907 GTGGGGGTGGGGGAGGAAAAGGG - Intergenic
1189324251 X:40103406-40103428 GTCTAGAGGAGGGAGGATGAAGG + Intronic
1189827821 X:44938078-44938100 GAGAGGCTGAGGTAGGAAGATGG - Intronic
1190019371 X:46859241-46859263 GGGTGGCTGAGGCAGGAGGATGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190463807 X:50705771-50705793 GTGTGGAGTAGGGGGGCAGAAGG - Intronic
1190515924 X:51223519-51223541 GGGAGGATGAGGAAAGAAGAGGG + Intergenic
1190892123 X:54579486-54579508 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
1190933062 X:54966725-54966747 GTGAGGATGAGAGAGGGAGAGGG - Intronic
1190945496 X:55089280-55089302 GCTGGGATGAGGGAGGAAGGTGG + Intronic
1191912337 X:66164286-66164308 GGGAGGATGAGGGAGGGGGAAGG - Intronic
1192141541 X:68650697-68650719 GTGGGGCTGAGGCAGGAGGATGG + Intronic
1192191485 X:68994019-68994041 GTGAGGATGAGGGAAGAGGATGG + Intergenic
1192387537 X:70687139-70687161 GTGTGAATGAGGTGGAAAGATGG - Intronic
1192457361 X:71287944-71287966 GGGAGGCTGAGGCAGGAAGATGG - Intronic
1192537667 X:71942061-71942083 GGGTGGATGAGGGAAGGAAAGGG + Intergenic
1192637334 X:72832160-72832182 TGGTGGAAGAGGGAGGAAGCAGG + Intronic
1192644380 X:72888654-72888676 TGGTGGAAGAGGGAGGAAGCAGG - Intronic
1192764764 X:74129322-74129344 GAGTGGATGGGAGAGAAAGAAGG + Intergenic
1193325997 X:80179150-80179172 TTATGCATGAGGGAGTAAGAAGG + Intergenic
1193966298 X:87990962-87990984 GTATGGATGAGGGAAGGAAATGG - Intergenic
1194153594 X:90359257-90359279 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
1194239293 X:91423868-91423890 CTGTGGATGAGGGATGGACAAGG + Intergenic
1195643292 X:107201352-107201374 GGCTGGAGGAGGGAGGAAAAGGG - Intronic
1195702110 X:107713409-107713431 CTGTGGATGAGGGATGAACAAGG - Exonic
1196083663 X:111660498-111660520 GGGAGGCTGAGGTAGGAAGATGG - Intergenic
1196196248 X:112840908-112840930 GGGTGGACGAGGGAGGAAGGCGG + Intergenic
1196202028 X:112897201-112897223 GGGAGGATGAGGGAGGAGAATGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197892484 X:131280544-131280566 ATGGGGATGAGAGAGGCAGATGG + Intronic
1198109393 X:133489266-133489288 GGGAGGCTGAGGCAGGAAGATGG + Intergenic
1198451191 X:136768047-136768069 CTGGGGGTGAGGGAGGAAGCAGG - Intronic
1198779634 X:140221251-140221273 GGGCGGAAGAGGGAGGAAGCTGG + Intergenic
1198910666 X:141610005-141610027 GTGTGGCGGGGGGAGGAAGGTGG + Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199386875 X:147233172-147233194 GGGTGGAAGAGGGAGAGAGAAGG - Intergenic
1200065052 X:153500262-153500284 GTGTGAGTGAGGGAGGAGGCTGG - Intronic
1200068710 X:153517581-153517603 GTGAGGAGGAGGGAGGGAGGAGG - Intergenic
1200368320 X:155692141-155692163 GTGGGGAGGAGGGATAAAGAGGG + Intergenic
1200499934 Y:3936050-3936072 GGGAGGCTGAGGGAGGAGGATGG - Intergenic
1201239782 Y:11947561-11947583 GTCTGGGTCAGGGAGGAAGCGGG + Intergenic
1201341034 Y:12934700-12934722 AAGTGGGTGAGGGAGGAATATGG - Intergenic
1201512219 Y:14777619-14777641 GTGAGTGTGAGGGGGGAAGAGGG + Intronic
1202083533 Y:21110590-21110612 GGGAGGCTGAGGCAGGAAGATGG - Intergenic
1202266444 Y:23023502-23023524 GTGAGGCTGAGACAGGAAGACGG + Intergenic
1202419437 Y:24657245-24657267 GTGAGGCTGAGACAGGAAGACGG + Intergenic
1202451349 Y:25012839-25012861 GTGAGGCTGAGACAGGAAGACGG - Intergenic