ID: 934860571

View in Genome Browser
Species Human (GRCh38)
Location 2:97760960-97760982
Sequence GCCCCACACCTCCCCGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934860571_934860575 1 Left 934860571 2:97760960-97760982 CCTGTCTCGGGGAGGTGTGGGGC 0: 1
1: 0
2: 2
3: 23
4: 218
Right 934860575 2:97760984-97761006 GGCAGGACTGAGCCCTGAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 301
934860571_934860580 17 Left 934860571 2:97760960-97760982 CCTGTCTCGGGGAGGTGTGGGGC 0: 1
1: 0
2: 2
3: 23
4: 218
Right 934860580 2:97761000-97761022 GAGTGGGCTTCTCTGCAGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 149
934860571_934860574 0 Left 934860571 2:97760960-97760982 CCTGTCTCGGGGAGGTGTGGGGC 0: 1
1: 0
2: 2
3: 23
4: 218
Right 934860574 2:97760983-97761005 TGGCAGGACTGAGCCCTGAGTGG 0: 1
1: 0
2: 0
3: 26
4: 275
934860571_934860578 15 Left 934860571 2:97760960-97760982 CCTGTCTCGGGGAGGTGTGGGGC 0: 1
1: 0
2: 2
3: 23
4: 218
Right 934860578 2:97760998-97761020 CTGAGTGGGCTTCTCTGCAGCGG 0: 1
1: 2
2: 1
3: 30
4: 244
934860571_934860579 16 Left 934860571 2:97760960-97760982 CCTGTCTCGGGGAGGTGTGGGGC 0: 1
1: 0
2: 2
3: 23
4: 218
Right 934860579 2:97760999-97761021 TGAGTGGGCTTCTCTGCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934860571 Original CRISPR GCCCCACACCTCCCCGAGAC AGG (reversed) Intronic
900109603 1:999979-1000001 GCCCCGCGCCTCCCCGTGCCGGG + Exonic
900363067 1:2299241-2299263 GCCCCCCCCCTCCCCGAGGCAGG - Intronic
900463900 1:2814693-2814715 GCCCCACACAGCACCGAGCCGGG + Intergenic
901018412 1:6244273-6244295 CCCCCACACCTCCCGGGGAAGGG - Intronic
901403636 1:9031784-9031806 CCCCAACCCCTCTCCGAGACTGG + Intergenic
902620268 1:17646744-17646766 GCCCCTCACCTCCCCAGGGCTGG - Intronic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
904618806 1:31763635-31763657 GCCCCCCCCCTCCCCCAGCCTGG - Intronic
905012241 1:34755432-34755454 GCCCCACTCCTCCCCAAGTAGGG + Intronic
905670373 1:39787262-39787284 GCCCCACAGCTCCCCGACTTTGG + Intronic
906216396 1:44043449-44043471 GCCCCACACCTCTCCCAACCTGG - Intergenic
907166329 1:52414761-52414783 GCCCCTCCCCTCGCCGAGAAAGG + Exonic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907402043 1:54230184-54230206 GCGCCACCCCTCCCCCAGTCTGG - Intronic
909585230 1:77281908-77281930 GCTCCGCGCCTCCCCGAGCCGGG - Intergenic
915152855 1:153848973-153848995 ACCCCCCCCCTCCCCCAGACTGG + Intronic
915588886 1:156859716-156859738 GCCCCCCAAGTCCCCGAGACAGG - Intronic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916265733 1:162888274-162888296 CCTCCCCACCTCCCCGGGACAGG - Intergenic
917974235 1:180229335-180229357 GGCCCAAACCTCCCCGCGGCGGG - Intergenic
919362159 1:196609018-196609040 GCCCCCCTCCTCCCAGAGAAGGG - Exonic
921692383 1:218165310-218165332 GCCCCCCACCTCCCCCTGCCCGG - Intergenic
922757504 1:228104751-228104773 GCCCCACACCATCCTGAGATGGG - Intronic
922801393 1:228366279-228366301 CCCCCACATCCCCCCTAGACTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1062802480 10:390309-390331 TCTCCAAACCGCCCCGAGACTGG - Exonic
1063187378 10:3663640-3663662 GCCCCACACCTTCCACAGATGGG + Intergenic
1069358190 10:67611992-67612014 CCCCCTCTCCTCCCCGAGACTGG - Intronic
1075967010 10:126621951-126621973 GCCCCACACCACCCCCTAACTGG + Intronic
1083153821 11:60810384-60810406 GCCTCCCACCTCCCCTAGAAAGG + Intergenic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1087701532 11:101441321-101441343 GCCCCCCATTTCCCCAAGACTGG + Intergenic
1087701542 11:101441358-101441380 GCCCCCCATCTCCCCAAGACTGG + Intergenic
1087762019 11:102111347-102111369 TCCCCACTCCTCCCAGAGTCCGG + Intronic
1088243850 11:107797736-107797758 GCCACAGCCCTCCCCAAGACAGG + Intronic
1088376302 11:109145462-109145484 CCCCCCCATCTCCCAGAGACAGG - Intergenic
1088893100 11:114059805-114059827 GCAACACCCCTCCCCGACACAGG + Exonic
1089448474 11:118572674-118572696 GCCACACTGCTCCCCGAGCCCGG - Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1091971887 12:4794281-4794303 GCCCCACATCCCCACAAGACAGG - Intronic
1098003031 12:65965514-65965536 GCCACATACCTCTCTGAGACTGG + Exonic
1101422130 12:104558541-104558563 CCCCCCCGCCCCCCCGAGACAGG + Intronic
1101680106 12:106956147-106956169 GCCCCTCACCTCCCAGTGCCCGG + Intronic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1102150715 12:110687841-110687863 GCCCCTGCCCTCCCCGACACAGG - Intronic
1104152218 12:126094778-126094800 GACCCACACCTCCTAGAGAGGGG - Intergenic
1105546912 13:21357457-21357479 GCCCCACCCATCTCCGAGTCTGG + Intergenic
1106409113 13:29498812-29498834 TCCCCACACGTCCCCAAGAGAGG - Intronic
1107038400 13:35923754-35923776 GCCACACACCTGTCCGAGAAGGG + Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1107946013 13:45418312-45418334 GCCCCACACCTCCTCCAACCCGG + Exonic
1109617086 13:64849244-64849266 GCCTCACACCTCCACAAGATGGG + Intergenic
1113120343 13:106917870-106917892 GCCCCGCACATCGCCGAGAGAGG + Intergenic
1113963778 13:114140218-114140240 GCCCCACCCCTCCCTGAAGCAGG - Intergenic
1117341889 14:54798705-54798727 CTTCCACACCTCCCTGAGACTGG - Intergenic
1118148852 14:63166223-63166245 GCCCCTCACCTCCCGGAGACGGG - Intergenic
1119768302 14:77204615-77204637 TCCCCACACCTCCCCGCAAAGGG - Intronic
1119821078 14:77616659-77616681 CCCACCCACCTCCCCGAAACCGG + Exonic
1122113289 14:99515892-99515914 GCCCCCCACCCCCCCGGGACTGG - Intronic
1122343741 14:101045381-101045403 GCCCCACCCCTGCCAGAGGCTGG - Intergenic
1122608460 14:102964265-102964287 GCACCACACCCCCCCGCGGCAGG + Intronic
1122999205 14:105283259-105283281 GCCCCACACCCCACCCAGGCAGG + Intronic
1123450273 15:20355593-20355615 GCCCCTCCCCTCCCTGACACTGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124405716 15:29389905-29389927 CCCCCACCCCTCCCTGATACCGG + Intronic
1126580539 15:50238626-50238648 TCCCCACACCTCCCTGAATCTGG + Intergenic
1127390807 15:58503728-58503750 GCCCTGCACCTGCCAGAGACAGG + Intronic
1127709915 15:61586613-61586635 GCCCCCCACCTCCAACAGACTGG - Intergenic
1128678474 15:69628969-69628991 GCCTCGCACCTGCCAGAGACTGG - Intergenic
1131257029 15:90869750-90869772 GCCCCACCCATCCTGGAGACTGG - Intronic
1132640103 16:974345-974367 GCCTCACACCAACCCGAGGCGGG + Intronic
1132702238 16:1226794-1226816 GCCTCACACCCCCCTGTGACGGG + Intergenic
1132766527 16:1537160-1537182 GCCCCACCCCGACCCTAGACTGG - Intronic
1132903709 16:2271738-2271760 GGCCCACACCTCACAGACACTGG - Intergenic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1133270347 16:4608288-4608310 GCCTCACAGCTCCCCAAGAGTGG - Intergenic
1135295625 16:21277397-21277419 GCCCCATTCCACCCCGGGACAGG + Intronic
1136480851 16:30540765-30540787 GCACCACACCTGACCGAGACTGG - Intronic
1136551755 16:30985759-30985781 GACCCGCAGCTCCCCGAGCCGGG - Exonic
1138176237 16:54900732-54900754 GCCCCCTACCTCCCCATGACTGG - Intergenic
1138659582 16:58509372-58509394 ACCCCACACCACCTAGAGACCGG + Intronic
1141725979 16:85788643-85788665 GCCCAACACCACCCCTAGTCTGG + Intronic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1142867147 17:2797905-2797927 GCTCCACACCTCCCAGAGAAAGG - Intronic
1144682436 17:17204842-17204864 GCCCCACACCACCCAGAGCAGGG + Intronic
1146842215 17:36163985-36164007 CCCCCACACCTCCCCTCGTCCGG + Intergenic
1146854525 17:36251944-36251966 CCCCCACACCTCCCCTCGGCCGG + Intronic
1146866094 17:36336432-36336454 CCCCCACACCTCCCCTCGGCCGG - Intronic
1146870426 17:36375836-36375858 CCCCCACACCTCCCCTCGTCCGG + Intronic
1146877783 17:36426917-36426939 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147073309 17:37976460-37976482 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147080488 17:38016581-38016603 CCCCCACACCTCCCCTCGGCCGG - Intronic
1147084830 17:38055998-38056020 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147100778 17:38179964-38179986 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1148838531 17:50479479-50479501 GCCACACAACTCCCCAAGGCAGG - Intronic
1149486531 17:57046641-57046663 GGCCCACGCCTTCCCGAGCCAGG - Intergenic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1150083711 17:62263011-62263033 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1151556263 17:74848189-74848211 GCCCCCCACTTCCCTGGGACAGG + Intronic
1151894723 17:76972298-76972320 GCCCCATACCTGCCCCAGGCTGG + Intergenic
1152044179 17:77925020-77925042 GACCTCCACCTCCCCGAGTCTGG + Intergenic
1152338211 17:79709842-79709864 GCCCCTCCCCTCCCTGACACTGG + Intergenic
1152338269 17:79710017-79710039 GCCCCTCCCCTCCCTGACACTGG + Intergenic
1152338353 17:79710279-79710301 GCCCCTCCCCTCCCTGACACTGG + Intergenic
1152658983 17:81533801-81533823 GCCCCACACCCCCTTCAGACAGG - Intronic
1154181421 18:12142774-12142796 GCTCCATACCTCCCTGGGACAGG - Intergenic
1154182483 18:12148810-12148832 GCTCCATACCTCCCTGGGACAGG + Intergenic
1160614032 18:80109948-80109970 GCCCGCCGCATCCCCGAGACCGG + Intronic
1160693070 19:469010-469032 GCTCCAGACCTCCCCGCCACAGG + Intronic
1160820003 19:1053518-1053540 GCCTCACACCTCCTCGAGGCTGG - Exonic
1161305330 19:3564210-3564232 TCCCCACCCCACCCCGAGGCTGG - Intronic
1161312907 19:3604590-3604612 CCACCCCACCTCCCCCAGACAGG + Intronic
1161330333 19:3683873-3683895 GTCCCACACCTCCCCCACACTGG + Intronic
1161450595 19:4343513-4343535 GCCCCTCCCCTCCCCGGGGCGGG + Exonic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1161983428 19:7642105-7642127 CCCCCTCACCTCGCCCAGACTGG - Exonic
1162022506 19:7874219-7874241 GCCCGACCCCTCCCCCAGCCGGG + Intronic
1162231578 19:9270978-9271000 TCCCAACCCCTCTCCGAGACTGG - Intergenic
1162967895 19:14164586-14164608 GCCCCCCACCTCCCCTGGCCCGG + Intronic
1162994613 19:14326235-14326257 GCCCCACACCCCAGGGAGACAGG + Intergenic
1163503306 19:17688479-17688501 GCCCCACACCTCCTCGTTGCAGG + Intergenic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163679386 19:18672023-18672045 GCCCGGCACCGCCCCGAGCCTGG + Intergenic
1163829537 19:19541123-19541145 GGCCCACAGCTCCCCGAGCAGGG - Exonic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1166943736 19:46384518-46384540 TCCCCGCACCTCCCCGCCACTGG + Intronic
1166944908 19:46390609-46390631 GCCCCACCCCACCCCGAGGACGG - Exonic
1167088212 19:47324810-47324832 ACCCCACACCTCTCAGAGCCAGG + Intergenic
1167368299 19:49065920-49065942 CCCCCCCACCCCCCCGAGAAGGG + Intergenic
927914614 2:26927160-26927182 GCCCCACATCTCCCCCATGCTGG + Intronic
928722151 2:34133144-34133166 GCCCCCCACCTCCCCCGGACGGG + Intergenic
931249203 2:60515281-60515303 GCCTCACACCTTCCCTGGACAGG + Intronic
932414702 2:71566605-71566627 TCCCCTGTCCTCCCCGAGACGGG - Intronic
932891060 2:75597881-75597903 GCCCCACCCCACCCCGATTCTGG - Intergenic
934846337 2:97663603-97663625 CCCCGACCCCTCCCCGAGTCGGG - Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
938413395 2:131084193-131084215 CCCCCACCCCACCCCAAGACAGG + Intronic
943350472 2:186791295-186791317 CCCCCACCCCTCCCCCTGACAGG - Intergenic
943639530 2:190343608-190343630 CCCCCACGCCTGCCCGAGCCGGG - Exonic
946031500 2:216708582-216708604 GCCCCACACCTCCCAGGAGCTGG - Intergenic
946602907 2:221371518-221371540 CCACCACCCCTCCCGGAGACGGG + Intergenic
947593982 2:231399599-231399621 GCCCTACCCCACCCCGACACAGG + Exonic
947732340 2:232438389-232438411 CCTCCACCCCTCCCCCAGACAGG + Intergenic
948188792 2:236042730-236042752 GGCCCACACCTCCCCTGCACTGG - Intronic
948671122 2:239569561-239569583 GCCCCACACCTCCTGGAAATGGG + Intergenic
948906998 2:240984318-240984340 GCCCCTCATCTCCCCGCGAATGG - Intronic
948990442 2:241551338-241551360 GCCCTAGACCTCCCAGAGAGAGG + Intergenic
1170195009 20:13680729-13680751 GCCCAACACCTCAGCGGGACTGG + Intergenic
1170827314 20:19808270-19808292 GCCCCTCTCCTCCCTGAGCCTGG + Intergenic
1170924773 20:20712661-20712683 GCCCCGCCCCTCGCCGTGACCGG - Intergenic
1172602905 20:36195919-36195941 GTCCTACACCTCCCCCAGGCAGG + Intronic
1173831463 20:46091829-46091851 CCTCCACACCTCCCCGAAAGCGG - Intergenic
1174193226 20:48754898-48754920 GCCCCACACAGCCCAGAGTCTGG + Intronic
1174285970 20:49473839-49473861 GCGCCTCACCTCTCTGAGACTGG - Intronic
1175117690 20:56694607-56694629 CCCCAACACCTCCCAAAGACTGG - Intergenic
1175932920 20:62501832-62501854 GCCCCTCACCACCCCGAGTATGG + Intergenic
1176080540 20:63270629-63270651 GCCCCAGACCTCCCAGAGTCCGG + Intronic
1176222089 20:63974569-63974591 GCCCCAAACCACCCAGAGAGGGG + Exonic
1178138113 21:29651140-29651162 GCCCCACCCAGGCCCGAGACTGG - Exonic
1178200554 21:30398357-30398379 GCCCCACACCCGGCCGAGATTGG + Intronic
1181026670 22:20131259-20131281 GCCCCCATCCTCCCCGAGGCGGG - Intronic
1182395888 22:30035710-30035732 GCCCCCCACCACCCCAACACTGG + Intergenic
1183268923 22:36848874-36848896 GCCCCCCACCCCCCCGCCACAGG + Intergenic
1183662789 22:39231348-39231370 GCTCCACACCTCGCCCAGCCCGG + Intronic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184700875 22:46171762-46171784 GGCCCCGACCTCCACGAGACTGG - Intronic
950195249 3:11005128-11005150 GCCCCACACCCCTCAGAGGCAGG + Intronic
950430774 3:12949724-12949746 GTCCCATCCCTCCCCGAGACGGG - Intronic
950706302 3:14784517-14784539 GCTCCCCACCTCCCAGAGCCAGG - Intergenic
954447342 3:50553815-50553837 GCCTCCCACCTCCCCGTGCCTGG + Intergenic
954593244 3:51802117-51802139 GCCCCACACCTCATCAGGACTGG - Intergenic
955412856 3:58667139-58667161 GCCCCACACCTCCCAGCGCCTGG - Intergenic
955870561 3:63433958-63433980 ACCACACACCTCCCTAAGACTGG + Intronic
958141717 3:89570914-89570936 CCCCCCCACCTCCCCGTGACTGG - Intergenic
959398364 3:105869040-105869062 GCCCCGCCCCGCCCCGAGCCTGG - Exonic
961171801 3:124802514-124802536 GCCCCTCAACTCCCCGTGCCAGG + Intronic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
967607975 3:191470911-191470933 TCACCTCACCTCCCTGAGACAGG + Intergenic
968051439 3:195657845-195657867 GCCCAACATCTCCCCGAAATAGG + Intergenic
968104380 3:195990488-195990510 GCCCAACATCTCCCCGAAATAGG - Intergenic
968267386 3:197372730-197372752 GCCCCAAACATCCCCGACCCAGG - Intergenic
968514891 4:1011820-1011842 GCGCCGCCCCGCCCCGAGACCGG + Intronic
968520818 4:1033956-1033978 GCCCCGCCCCTCCCCGAGCCTGG - Intergenic
975554330 4:75645812-75645834 GCCCCCCACCCCCCAGAGATAGG + Intronic
978788617 4:112637460-112637482 GCCCCAAACCTCCCCACGCCGGG - Intronic
979785737 4:124712941-124712963 CCCCCACGCCGCCCCGAGACAGG - Intergenic
983931129 4:173454373-173454395 GCCCCTAACCTCCCCGACTCTGG - Intergenic
985497498 5:218059-218081 GCCCACCACCTCCCCGGAACAGG + Intronic
985599677 5:820544-820566 GCCCCACCCCTCACAGACACCGG - Intronic
985639726 5:1058022-1058044 GCCCCAAGCCTCCCTGAGACGGG - Intronic
985737811 5:1594686-1594708 GCCCAACACCTCCCCGGAATAGG - Intergenic
985768645 5:1795528-1795550 GCACCACACCTTCAGGAGACAGG + Intergenic
985949286 5:3210994-3211016 GCTCCAGACCTCCCAGTGACTGG + Intergenic
988800308 5:34690429-34690451 GCCACAGACCTCCCAGACACAGG - Intronic
989180092 5:38567911-38567933 TCCCTACACCTCACAGAGACTGG + Intronic
996750004 5:126878807-126878829 GCCCCGCACATTCCCAAGACAGG + Intronic
999607610 5:153333265-153333287 GCCCCCCACCACCCCTGGACAGG + Intergenic
1001572238 5:172737360-172737382 ACCTCACACCACCCAGAGACAGG - Intergenic
1002438634 5:179251482-179251504 GCCCCCCACCCCACAGAGACAGG + Intronic
1002634514 5:180600516-180600538 GCCCCAAACCTCCCCCAAGCAGG + Intergenic
1003819171 6:9876894-9876916 GCGCCACTCCTCCCCCAGGCTGG + Intronic
1005885882 6:30097418-30097440 CCCCCACTCCTCTCCGACACTGG - Intergenic
1007403249 6:41616598-41616620 GCCCCTCACCTCCCCGGGTGGGG - Intergenic
1007591058 6:43021182-43021204 GGTCCCCACCTCCCCAAGACGGG - Exonic
1007928381 6:45668495-45668517 GCCACATACCTCCCAGGGACTGG + Intergenic
1008899561 6:56595780-56595802 CCCCCACCCCACCCCGAGAAGGG + Intronic
1010017046 6:71116966-71116988 CCCCCACACCTCCCCCACTCTGG - Intergenic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1014085369 6:117336320-117336342 CCCCCACCCCTCCCCCTGACAGG + Intronic
1014489223 6:122041913-122041935 GGACCACACCTCCCCAAGACAGG + Intergenic
1016416439 6:143839358-143839380 GCCCCAAACCATCCCGAGATGGG - Intronic
1019262794 7:91560-91582 GCACCACATCTGCACGAGACAGG - Intergenic
1019265131 7:110949-110971 GCCCCACACAGCCCCAAGACAGG + Intergenic
1019559402 7:1648453-1648475 GCCACCCCCCTCCCCGGGACAGG - Intergenic
1019568092 7:1694589-1694611 ACCCCCCACCTCCCTGAGACAGG + Intronic
1019998831 7:4743023-4743045 GCCCCCCACCTTCCCGGGCCCGG + Intronic
1020217788 7:6207942-6207964 TCCCCCCACCCCCCCAAGACAGG - Intronic
1021840268 7:24716842-24716864 GCCCTTCACCTTCCAGAGACAGG + Intronic
1023081078 7:36527026-36527048 GCACCACACCTCCCCAACAGAGG - Intronic
1026187189 7:68091117-68091139 CCCCCACACCTCCCAGATAATGG + Intergenic
1026968474 7:74454385-74454407 GCCCCCCACCTGCCCGGGAGGGG + Intronic
1032526183 7:132579694-132579716 GCCCCTCACCTGCCCGTGGCTGG - Intronic
1034911806 7:155003362-155003384 GCTCCCCTCCTCCCCGGGACCGG - Intergenic
1038451347 8:27641278-27641300 TCCCCATCCCTCCCCCAGACTGG + Intronic
1039475824 8:37838966-37838988 GCCCCCCACCTCCCTGGGAAAGG - Exonic
1040982141 8:53254855-53254877 GCCCCACACCACCACGTGTCAGG - Intergenic
1041193187 8:55374110-55374132 GCTACACACCTCCCAAAGACAGG + Intronic
1045703715 8:104896484-104896506 CCCCCAAAACTCCCTGAGACTGG + Intronic
1053075735 9:35132863-35132885 GCCCTACACCTTCCCTATACAGG + Intergenic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1060937993 9:127527034-127527056 GCCCCTCCCCTCCCCCAAACTGG - Intronic
1061206068 9:129164082-129164104 CCTCCCCACCTCCCTGAGACAGG - Intergenic
1061538956 9:131267037-131267059 GCACCACACCTCCCTGGGGCCGG + Intronic
1061856034 9:133442510-133442532 GCCCCACAGCTCACCGAGCAGGG - Exonic
1062430124 9:136523220-136523242 GCCTCACTGCTCCCCGAGGCCGG + Intronic
1062472809 9:136713637-136713659 GCACCCCACCTCCCAGCGACTGG - Intronic
1185750827 X:2608924-2608946 GGCCCACACCTCTCCAAGAAGGG + Intergenic
1187067289 X:15854171-15854193 GCACCACAATTCCTCGAGACTGG + Intronic
1187503493 X:19859609-19859631 GCTCCACACCACCCAGAGCCAGG - Intronic
1190303230 X:49068077-49068099 CCCCCATACCTGCCAGAGACAGG - Exonic
1192260800 X:69504996-69505018 GCCCCGCACCGCCCCCAGCCGGG + Intergenic
1192373786 X:70538456-70538478 GCCTCACGTCTCCCTGAGACTGG - Intronic
1193056539 X:77158115-77158137 GCCACACACCTGCCCAAGATAGG + Intergenic