ID: 934862848

View in Genome Browser
Species Human (GRCh38)
Location 2:97779063-97779085
Sequence GGCCTAGACCCTGAGGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934862848_934862860 25 Left 934862848 2:97779063-97779085 CCCGACCCCTCAGGGTCTAGGCC 0: 1
1: 0
2: 1
3: 20
4: 152
Right 934862860 2:97779111-97779133 AACAGTTCTGGATAGAACCTAGG 0: 1
1: 0
2: 2
3: 14
4: 174
934862848_934862861 26 Left 934862848 2:97779063-97779085 CCCGACCCCTCAGGGTCTAGGCC 0: 1
1: 0
2: 1
3: 20
4: 152
Right 934862861 2:97779112-97779134 ACAGTTCTGGATAGAACCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 112
934862848_934862859 13 Left 934862848 2:97779063-97779085 CCCGACCCCTCAGGGTCTAGGCC 0: 1
1: 0
2: 1
3: 20
4: 152
Right 934862859 2:97779099-97779121 AGATTCTGACTCAACAGTTCTGG 0: 1
1: 1
2: 32
3: 264
4: 1025

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934862848 Original CRISPR GGCCTAGACCCTGAGGGGTC GGG (reversed) Intronic
900276472 1:1832671-1832693 CTCCTAGACTCTCAGGGGTCTGG - Intronic
900430003 1:2596917-2596939 GGCCTTTACCCTGAGGAGTTGGG + Intronic
900500383 1:3001605-3001627 GGCCCCGATCCTGAGGGGTGGGG - Intergenic
900971790 1:5995966-5995988 GGCCCAGACCCTGGGGGATATGG + Intronic
901665622 1:10824568-10824590 GGCCTGGTCCCTGAGGAGCCAGG - Intergenic
902152058 1:14451259-14451281 AGCCTAGTCTCTGAGGGGGCTGG - Intergenic
902509243 1:16956884-16956906 GGCCTGGACACTGTGGGTTCAGG + Intronic
903085464 1:20853602-20853624 GGCGTGGACCCTGAGGGTGCTGG + Exonic
904237978 1:29126045-29126067 GGCCATGACTCTGAGGGGGCAGG + Intergenic
904425174 1:30418164-30418186 GGCCCAGAGGCTGTGGGGTCAGG + Intergenic
912385878 1:109270938-109270960 GGCCTGGACCCCGAGGGCTACGG + Exonic
912391225 1:109304554-109304576 AGCTCAGACTCTGAGGGGTCAGG + Intronic
912391489 1:109306313-109306335 AGCTCAGACTCTGAGGGGTCAGG + Intronic
912764507 1:112396383-112396405 GGCCCATCCCCTGAGGGGGCGGG + Intronic
912818687 1:112850043-112850065 AGGCCTGACCCTGAGGGGTCGGG + Intergenic
913165341 1:116179678-116179700 GGCCTAGACCAGGAGTGGACAGG + Intergenic
916717622 1:167458392-167458414 GGCCTAGCCCCTGCTGGGGCAGG + Intronic
919728462 1:200898530-200898552 GCCCTAGTGCCTGAGGGCTCAGG - Intronic
920364547 1:205441138-205441160 GGGCCAGACCCAGAGGGTTCTGG - Intronic
921036053 1:211379169-211379191 GGTTTAGAACCTGAGGGCTCAGG + Intergenic
922749119 1:228062542-228062564 GTCCTGGACCCTGAGGGCACAGG + Intergenic
1067222413 10:44353523-44353545 GAACTAGGCCCTGAGGGGCCTGG + Intergenic
1070711151 10:78684073-78684095 GGCCTAGGCCCTGAGGCCTTTGG + Intergenic
1074527920 10:114277844-114277866 GGCCTAGAAGATGAGGGGGCAGG + Intronic
1076565361 10:131394840-131394862 GCCCTAGACCATGAGGTGTCTGG - Intergenic
1077030233 11:462212-462234 GACCCAGACCCAGAGGGGCCAGG + Intronic
1079028581 11:16968157-16968179 TGCCAAGATCCTGAGGGGTTTGG + Intronic
1080262413 11:30363976-30363998 GTCCTAGACTCTTAGGGCTCTGG + Intergenic
1083127879 11:60590854-60590876 GGCCTAGACCCTGGGTCCTCTGG - Intergenic
1083879936 11:65543353-65543375 GGACTGGACCCTGGGGGGTGGGG + Intronic
1084006291 11:66325220-66325242 GGCCTAGCCCCTGAGGGTAAAGG + Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084451963 11:69244365-69244387 GGCCCAGAGGCTGAGGGGTGAGG - Intergenic
1085202679 11:74711222-74711244 GGCCCAGACACTGAGGGGGCTGG - Intronic
1088651119 11:111958687-111958709 GGCCTGAAGCCTGGGGGGTCAGG + Intronic
1088982721 11:114878154-114878176 GGCTTTCACCCTGAGGTGTCTGG + Intergenic
1089533123 11:119144810-119144832 TGTCTAGTCTCTGAGGGGTCGGG + Intergenic
1096691624 12:53325323-53325345 GGGCCAGACTCTGGGGGGTCCGG + Intergenic
1098910459 12:76203640-76203662 GGCCTAAGCCTTGAGAGGTCTGG + Intergenic
1101875236 12:108593026-108593048 GGGCCAGACCCTGAGGGGAACGG - Intronic
1101897332 12:108766629-108766651 GGACTTGACCCTGAGGGCTCTGG - Intergenic
1102212328 12:111136440-111136462 GGCCTTGCCCCTGTTGGGTCTGG - Intronic
1103082317 12:118035075-118035097 GGCCCAGATCCTGAGGAGTCTGG + Exonic
1105005613 12:132718874-132718896 GGCCTCGACCCAGAGGGGAGCGG - Intronic
1105432568 13:20350553-20350575 GGCCTAGAACACCAGGGGTCTGG + Intergenic
1108706373 13:52992099-52992121 ATCCTAGACGGTGAGGGGTCAGG + Intergenic
1119920067 14:78438614-78438636 GGCTTAGACCCCGAGGTGCCAGG - Intronic
1122621175 14:103058185-103058207 GGCCCAGACGGTGTGGGGTCAGG + Intergenic
1122693249 14:103541347-103541369 GCCCTTCACCCTGAGGGGCCAGG - Intergenic
1131164830 15:90134778-90134800 GCCCTAGACCCTGAAGGGCCAGG + Intergenic
1131447706 15:92513466-92513488 GCCCTAGACCCTGAAGGGCCAGG + Intergenic
1131470353 15:92691251-92691273 GGACCAGACCCTTAGGGGTCTGG + Intronic
1132693603 16:1192494-1192516 GGCCCAGACCCTGAGGCGGAGGG - Intronic
1134124976 16:11610286-11610308 GGCCTGGAGCCTGCGGGGGCAGG - Intronic
1135884891 16:26296659-26296681 GGAGTCGACCCTGAGGGATCCGG - Intergenic
1136375073 16:29860540-29860562 AGCCAAGAGCCTGAGGGGTGGGG + Intronic
1137252255 16:46748865-46748887 GGACTAGTCACTGAGGGCTCCGG - Intronic
1141453127 16:84118993-84119015 TGCCTATACACTGAGGGGACTGG + Intergenic
1142266328 16:89065518-89065540 GGGCTACACCCTTAGGGGTGCGG + Intergenic
1142278987 16:89137959-89137981 GGCTGAGACCCAGAGGGTTCTGG - Intronic
1142376226 16:89708407-89708429 GGGGTAGACCCTGGCGGGTCAGG - Exonic
1142500489 17:330164-330186 GGCCTGGACCCTGTGTGGTCAGG - Intronic
1143372536 17:6449325-6449347 GACCTAGAGCCTGTGGGGGCGGG + Exonic
1143789955 17:9286914-9286936 GGCAAAGACCCTGAGAGGTGAGG - Intronic
1144964888 17:19070615-19070637 GGCCCGGACGCTGAGGGGTGTGG - Intergenic
1144983079 17:19181563-19181585 GGCCCGGACGCTGAGGGGTGTGG + Intergenic
1144985146 17:19196676-19196698 GGCCCGGACGCTGAGGGGTGTGG - Intergenic
1146447159 17:32941490-32941512 TGCCTGGTCCCTGAGGCGTCTGG + Exonic
1149560213 17:57603214-57603236 GGCCTGCACCCAGAGGGGTAGGG - Intronic
1149595127 17:57860845-57860867 GGGCCAGACCCTGATGGGTGGGG + Intergenic
1149660434 17:58331790-58331812 GACTTAGGCCCTGGGGGGTCAGG - Intergenic
1150291495 17:63985000-63985022 GGCCAAGCCCCTGAGAGGTGTGG + Intergenic
1152453919 17:80401865-80401887 GCCCTAGACCCAGAGGGGCCAGG + Intergenic
1152528692 17:80904203-80904225 GGTGCAGCCCCTGAGGGGTCAGG + Intronic
1152748347 17:82051433-82051455 GGCCTAGACCCTGGGAGGCGGGG + Intronic
1153659802 18:7316773-7316795 GCCCTGGGCCCTGTGGGGTCAGG - Intergenic
1153660828 18:7324763-7324785 GGCCTTGACCCTGAGGAAACTGG + Intergenic
1154197978 18:12279974-12279996 GGCCTGGACCCTGTGAGGCCTGG + Intergenic
1157466959 18:47955645-47955667 GGCCTAGAGACTGAAGGGTGTGG + Intergenic
1160628348 18:80228546-80228568 GGCCAAGACCCTGTGGTGTCTGG - Intronic
1161134881 19:2613784-2613806 GGGCTAGATCCTCTGGGGTCTGG - Intronic
1161289424 19:3485097-3485119 GGCCTAGACCCTGAGGAATGTGG + Intergenic
1162561582 19:11420773-11420795 GCGCTAGACCCGGAGGGATCGGG + Exonic
1163029623 19:14535842-14535864 GGCCAAGATCCTGAGGGGGTTGG + Intronic
1164721100 19:30432192-30432214 GGCCTAGATGCTGGGGTGTCAGG + Intronic
1165776120 19:38405254-38405276 GGCCTAGGTCCTCAGGGGTGTGG + Intronic
1168689192 19:58366718-58366740 GGTCTAGGCCCTGAGGGCCCAGG + Intergenic
925300276 2:2806868-2806890 GGCCTAGAGCCTTCGGGGTGGGG + Intergenic
926087314 2:10028579-10028601 GGCCTGGAGCATGAGGGGCCTGG - Intergenic
928593429 2:32839385-32839407 GGCCAAGACCTTGAAGGGGCAGG - Intergenic
930691739 2:54371905-54371927 GACCCAGACCCGGAGGGGTTAGG - Intronic
931752953 2:65346944-65346966 GGCCCAGACACTGAGAGGCCAGG - Intronic
932475464 2:72003213-72003235 TGCCTGGACACTGTGGGGTCCGG - Intergenic
934112058 2:88753180-88753202 GGCCTAGAGCCAGAGAAGTCTGG - Intergenic
934862848 2:97779063-97779085 GGCCTAGACCCTGAGGGGTCGGG - Intronic
934912567 2:98272796-98272818 TGGCTAGACCATGAGGGCTCTGG + Intronic
934942180 2:98510641-98510663 TGATTAGACCCTGAGGGCTCTGG - Intronic
935222495 2:101027489-101027511 GGCCTGCACCCCCAGGGGTCAGG + Intronic
935232683 2:101112666-101112688 GGCCAATACCCTGAGCAGTCAGG - Intronic
935653009 2:105398641-105398663 GGTCTAGACCCTGGGGGCGCTGG - Intronic
937104198 2:119294856-119294878 GGCCTGGGGCCAGAGGGGTCCGG + Intergenic
937985235 2:127635357-127635379 GACCAAGCCCCTGAGGGCTCTGG + Intronic
939185471 2:138855653-138855675 GGCCTAGACTCTAAGAGGACTGG + Intergenic
945269641 2:207925236-207925258 GGCATGGTCCCTGAGGGATCCGG + Intronic
946818545 2:223606681-223606703 AGCCAAGGCCCTGAGGGGCCGGG - Intergenic
1172816814 20:37693890-37693912 CGCCTGGAGCCTGAGGGGGCGGG - Intergenic
1173958824 20:47055632-47055654 TGCAAAGACCCTGAGGGGTAAGG - Intronic
1175315979 20:58047045-58047067 GGCCCAGTCCCTGGGGAGTCTGG - Intergenic
1180963899 22:19775859-19775881 CGCCTGGAGCCTGAGGGGTCTGG + Intronic
1181583756 22:23841978-23842000 GACCAAGACACTGAGGGGTTGGG + Intergenic
1182281224 22:29218725-29218747 GGCCCAGGCACTCAGGGGTCAGG - Intronic
1183739351 22:39661499-39661521 GGCCTAGTGCCAGTGGGGTCTGG + Intronic
1183807789 22:40226826-40226848 GGCCCAGAGCCTGAGGGGAGGGG + Intronic
1183961534 22:41414272-41414294 GGCCTGGACTCTGGGGGCTCTGG + Intergenic
1184715307 22:46278685-46278707 CGGCTACTCCCTGAGGGGTCAGG - Intronic
949526584 3:4910573-4910595 GGCCTAACACCAGAGGGGTCAGG + Intergenic
949943262 3:9171056-9171078 GGCCCAGGCCCTGAAGGGTCAGG - Intronic
950018378 3:9769697-9769719 GGGCTGGACCCTGAGGGGCAGGG - Intronic
950518182 3:13480578-13480600 GGCCCGGACCCGGAGCGGTCGGG + Intronic
953429183 3:42823089-42823111 AGCCTAGACCATGTGGGGCCTGG - Intronic
953878167 3:46678229-46678251 GGCCCAGAGCCAGAGGGGCCAGG + Intronic
954148210 3:48644795-48644817 GGCCTGGACCCTGAGGGCTATGG - Exonic
954631697 3:52051234-52051256 GGCCAGGTCCCTCAGGGGTCGGG - Intronic
968046243 3:195625127-195625149 GGCCTGGGGCCCGAGGGGTCAGG + Intergenic
968285631 3:197507001-197507023 GGTCTATATCTTGAGGGGTCTGG + Intergenic
968308410 3:197664960-197664982 GGCCTGGGGCCCGAGGGGTCAGG - Intergenic
982326649 4:154135746-154135768 GGCCTGGACCTAGTGGGGTCCGG + Intergenic
985716213 5:1463397-1463419 GGCCTGGACCCCGTGGGGTCAGG - Exonic
985747068 5:1653748-1653770 GGCCTGGGGCCCGAGGGGTCAGG - Intergenic
986728863 5:10620068-10620090 GGCTTAGACCCTTAATGGTCTGG - Intronic
995793943 5:115922665-115922687 GGCCTGGATCCTGAGGGTTCTGG + Intergenic
997335591 5:133107001-133107023 GGTCTAGACGAGGAGGGGTCAGG + Intergenic
997364062 5:133314263-133314285 GGCTAAGACCCTGAGGGGCAGGG - Intronic
997990707 5:138542770-138542792 GGCGTCCATCCTGAGGGGTCCGG + Intronic
998545826 5:143026650-143026672 GGGCTAGACCATGTGGGGCCAGG + Intronic
1002181450 5:177433087-177433109 AGCCAAGAGCCTGAGGTGTCAGG + Intronic
1002416898 5:179125479-179125501 GGCCCAGACCCTAAGGAGGCTGG - Intronic
1006337256 6:33427326-33427348 CCCCTAGACCCTGAGGACTCAGG - Intronic
1007373762 6:41443061-41443083 GGGCTAGACCCTGAGGGCTCGGG + Intergenic
1016047716 6:139497569-139497591 AGCCTAGACCATGAAGGGTGGGG - Intergenic
1018414666 6:163590816-163590838 GGCCTAAGCCCTGATGAGTCTGG - Intergenic
1018497629 6:164366184-164366206 GGCCTATATCCTGAGGAGGCAGG + Intergenic
1018959856 6:168440784-168440806 GGCCTGGACCCTGGGGCGTGAGG + Intergenic
1019000589 6:168746422-168746444 GGCTTAGTCCCTTTGGGGTCGGG - Intergenic
1019424310 7:966622-966644 GGCCAAGACCCTGAGTGCACGGG + Exonic
1019498947 7:1354925-1354947 TGCCCAGACTGTGAGGGGTCAGG + Intergenic
1019995737 7:4723257-4723279 GGCCTGGACCCTGAAGGATGTGG + Intronic
1023767998 7:43529708-43529730 GGCCTAGAGCCTGAGTGGGCAGG - Intronic
1025976678 7:66376397-66376419 GGCGTAGGCCCTGAGGGGCGCGG - Intronic
1027859377 7:83556506-83556528 GACCTAGACATTGAGGGGCCAGG + Intronic
1030440129 7:109579119-109579141 GGCTTAGACCCAGAGGGTTGGGG - Intergenic
1033418096 7:141182143-141182165 GGCCTGGACAGTCAGGGGTCTGG + Intronic
1033728484 7:144147396-144147418 GGCCTAGACCCTGAGTTGGCTGG - Intergenic
1034919325 7:155066408-155066430 AGTATAGACCCTGAGGGTTCTGG - Intergenic
1035233854 7:157483993-157484015 GTCCTTTACCCTGGGGGGTCTGG - Intergenic
1035636763 8:1153155-1153177 AGCCTGGAAACTGAGGGGTCAGG - Intergenic
1039267511 8:35841771-35841793 GGCCTAGATCCTGAGTCTTCAGG - Intergenic
1049406526 8:142454013-142454035 GGCCAAGACCTTCAGGGCTCAGG - Intronic
1049437654 8:142595138-142595160 GGCCCAGACCCTGTTGGGTGAGG + Intergenic
1050296744 9:4212864-4212886 GGGCTATACCCTGAGGGGTATGG + Intronic
1051018895 9:12516290-12516312 TGCCTTGACACAGAGGGGTCTGG - Intergenic
1053119762 9:35537961-35537983 GGCCCAGAACCTGAGGAGGCTGG + Intronic
1053446506 9:38157226-38157248 TGGCGGGACCCTGAGGGGTCAGG - Intergenic
1056379898 9:86047519-86047541 GGCCTAGACAGAGAGGGGACTGG + Intronic
1057275857 9:93675641-93675663 GGCCTACAGCTTGAGGGGGCTGG + Intronic
1059008667 9:110432783-110432805 GTGCTAGACGCTGAGGGTTCAGG - Intronic
1060657359 9:125381105-125381127 GGCCCAGTCCCTCAGGCGTCTGG + Intergenic
1060969564 9:127730456-127730478 GACCCAGACCCTGAGGGGTGGGG - Intronic
1061415840 9:130446394-130446416 GGCCTTGGGCCTAAGGGGTCTGG - Intronic
1062285814 9:135772047-135772069 GGCCGGGAACCTGCGGGGTCTGG - Intronic
1190279078 X:48917873-48917895 GGTCTAGACTGGGAGGGGTCTGG - Intronic
1191005027 X:55702449-55702471 TGCCTACACCATGAGGGCTCTGG + Intergenic
1191807115 X:65147678-65147700 GGCCTAGAGCCTGAGTCATCAGG + Intergenic
1191928734 X:66344776-66344798 TGCCTACACCATCAGGGGTCTGG - Intergenic