ID: 934865799

View in Genome Browser
Species Human (GRCh38)
Location 2:97809344-97809366
Sequence CTTCCAACAGAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934865799_934865802 -9 Left 934865799 2:97809344-97809366 CCCTTCTCCATCTCTGTTGGAAG 0: 1
1: 0
2: 2
3: 41
4: 291
Right 934865802 2:97809358-97809380 TGTTGGAAGAAATTCTAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934865799 Original CRISPR CTTCCAACAGAGATGGAGAA GGG (reversed) Intronic
900336369 1:2165964-2165986 CATCCAACAGACATGGGAAATGG - Intronic
901079901 1:6578188-6578210 GTCCCTACAGAGATGGTGAAAGG - Intronic
901910369 1:12452553-12452575 CTTCCCACTGAGGTGGGGAATGG + Intronic
902759856 1:18574122-18574144 TGTCCAACAGAGATGTTGAATGG + Intergenic
902855114 1:19197201-19197223 GTTCCAACACAGGTAGAGAAAGG + Exonic
903522829 1:23965853-23965875 CTTCAAAAGGAAATGGAGAAGGG + Intronic
903694177 1:25195342-25195364 TTTCCATCACAGATGGCGAATGG + Intergenic
904538602 1:31217675-31217697 CTTCCAGGAGGGATGGAGACTGG - Intronic
906541514 1:46590156-46590178 ATTCCAAAACAAATGGAGAACGG + Intronic
906699158 1:47845004-47845026 CTTCCAAGACAGGTGGAGACAGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907422128 1:54354608-54354630 CTTACAACCGAGATGGGGAGGGG + Intronic
908652157 1:66346118-66346140 TCTCCAACAGATATGGAGAGTGG - Intronic
910285492 1:85549669-85549691 CTTCCATCAGTGATGAAGAAAGG + Intronic
910308993 1:85801643-85801665 CTACCTACAGAAATGTAGAAAGG - Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911298942 1:96150157-96150179 TTTACATCAGAGAGGGAGAAAGG - Intergenic
911332763 1:96544074-96544096 ATTCAAATGGAGATGGAGAATGG + Intergenic
912545290 1:110446728-110446750 TTTCAAAAAGAGATGAAGAAAGG - Intergenic
912593227 1:110848709-110848731 CATCCAAGAGAGATGGAAAAGGG - Intergenic
913111908 1:115664528-115664550 CTCCCAAAAATGATGGAGAAAGG + Intronic
914389526 1:147207267-147207289 CTATCTACAGAGATGGGGAAAGG + Intronic
915038167 1:152946134-152946156 CTTACAACTGACATGCAGAATGG + Intergenic
916172413 1:162010892-162010914 CTTGGCACAGAGATGGATAAGGG + Intronic
917514985 1:175699717-175699739 CTTACAACAGAGATTGTGGAAGG + Intronic
917692211 1:177481150-177481172 CTTCCCACAGACATGGAGCGAGG - Intergenic
918333162 1:183479781-183479803 ATTCCAACAGAGGTGGAGATGGG + Intronic
918350143 1:183646758-183646780 CTTTCAGCTGGGATGGAGAAGGG + Exonic
919137683 1:193531369-193531391 TTTCAAACAGAGATGTAGAGTGG + Intergenic
919429890 1:197479456-197479478 CTATCAAAAGAGATGGAGAGGGG - Intergenic
919983825 1:202659154-202659176 CTTCCACCAGGGAAGGAGACAGG - Intronic
920220686 1:204398113-204398135 CTTCCACCACAGAGGAAGAAAGG + Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923879516 1:238088053-238088075 CTGGCAAGAGAGAGGGAGAAGGG - Intergenic
1063854194 10:10228900-10228922 TTTCCAACAGAAATGGAGAGGGG + Intergenic
1064196463 10:13247687-13247709 CAACCAAAAGAGCTGGAGAATGG + Intergenic
1066012730 10:31209442-31209464 CTGGCAGCAGAGAGGGAGAAAGG - Intergenic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1067873181 10:49980256-49980278 GTTCCAACAGAGAGGGAGGGTGG + Intergenic
1068321693 10:55426627-55426649 CTTCCAACAGCGAGGGCAAAGGG + Intronic
1068500288 10:57834927-57834949 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1068991274 10:63153564-63153586 CATCCAAGAGAGATGGAAAAGGG + Exonic
1070513936 10:77186214-77186236 CTTGTAGCAGAGATGAAGAATGG - Intronic
1071307292 10:84310691-84310713 CTTCCAACAGAGATCAGAAAAGG - Intergenic
1073495003 10:103882829-103882851 TTTCCTGCAGACATGGAGAAGGG - Exonic
1073674327 10:105628219-105628241 CTTCCATAAGAGTTAGAGAAGGG + Intergenic
1074727970 10:116334090-116334112 CTCCCAAGAGAGATAGAGGAAGG + Intronic
1074742671 10:116500198-116500220 TTTAAAACAGAGAGGGAGAAGGG + Intergenic
1075068058 10:119302948-119302970 CTTCCTTCAGGGATGGAGAAGGG - Intronic
1076601451 10:131659320-131659342 CTTCCCAGAGGGATGGAGGATGG - Intergenic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1078644386 11:13126606-13126628 CTTCCAATGGAAATGGAGAGTGG + Intergenic
1080964924 11:37203159-37203181 CTGCCAACAGTGATGCTGAATGG - Intergenic
1081742684 11:45451829-45451851 GCTCCAAAATAGATGGAGAATGG - Intergenic
1081925635 11:46826143-46826165 ATTCCTTCAGAGATGGAGAGGGG + Intronic
1081945685 11:46991681-46991703 CTTGTAACAGAGATGGGGAGGGG - Intronic
1083055563 11:59815947-59815969 CTTCCAACAGGGAAGATGAAGGG - Intergenic
1084746788 11:71175621-71175643 CTTCCAGCCAAGATGGAGGAAGG + Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1086377330 11:86214733-86214755 CTTCTGATTGAGATGGAGAAAGG - Intergenic
1087654435 11:100905302-100905324 TTTGGAACAGAGATGGAGCAAGG + Intronic
1088260343 11:107937757-107937779 GAGCCAACAGAGTTGGAGAAGGG - Intronic
1089367089 11:117927483-117927505 CTTGGAAAAGAGGTGGAGAAGGG - Intronic
1091398730 12:170308-170330 CTTCCAAAAGAGAGGCAGGAAGG - Intronic
1092305827 12:7299693-7299715 CTTCCAAAAGAAAAGAAGAAAGG + Intergenic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1093246559 12:16745330-16745352 CTACCATCACAGATGGTGAAAGG - Intergenic
1093602056 12:21039333-21039355 CTTAAAAGGGAGATGGAGAAAGG - Intronic
1094042034 12:26128261-26128283 TTTGCAAGAGAGATGGAAAAGGG + Intronic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1094354349 12:29562337-29562359 CCTCCAACAGTGATGCAGAAGGG + Intronic
1095717082 12:45358094-45358116 CTTCCAGCAGGGATGCAGCACGG + Intronic
1096728961 12:53590623-53590645 CTCCCAACAGAGAAGAAGAAAGG + Intronic
1096810138 12:54164162-54164184 GATGCCACAGAGATGGAGAAGGG + Intergenic
1097670690 12:62533918-62533940 GTTCCAACACTGTTGGAGAAGGG - Intronic
1098493526 12:71109794-71109816 TTTCCCCAAGAGATGGAGAATGG + Intronic
1100401035 12:94230104-94230126 CAGGCATCAGAGATGGAGAATGG - Intronic
1102456021 12:113071316-113071338 CTTCCAGCTGAACTGGAGAAAGG - Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104797777 12:131531630-131531652 CTCCCAAGAGAGATGGAGGCAGG - Intergenic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1107750530 13:43560911-43560933 ATTCCAACTGAGATTAAGAAAGG - Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1110948260 13:81451697-81451719 TTACCAACAGATTTGGAGAAAGG + Intergenic
1110964017 13:81668386-81668408 CTTCCAACAGGGATAGAGAAAGG + Intergenic
1112123859 13:96443019-96443041 CTCCCAACAAAGACAGAGAAAGG + Intronic
1112640984 13:101274954-101274976 GTTCCAGCAGAGATGGGGCAAGG + Intronic
1114030739 14:18577775-18577797 GTTCCAGCAGAGGTGGTGAAGGG + Intergenic
1114642763 14:24235199-24235221 TTTCCACTAGAGATGGAGACAGG + Intronic
1115373075 14:32641155-32641177 TTACCATCATAGATGGAGAATGG - Intronic
1116043966 14:39720326-39720348 CTTCCAATTGAGATTGAGGATGG - Intergenic
1116854094 14:49936822-49936844 CTTCCTAGAGAGATGTTGAATGG + Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119144058 14:72294347-72294369 ATTCCAACAGAGATGTAGACTGG + Intronic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1119859822 14:77928060-77928082 GTGGCAACAGAGATGGAGAGAGG + Intronic
1120930712 14:89845600-89845622 CTTACAAGAGAGCTGAAGAATGG - Intronic
1121117631 14:91354892-91354914 GTGCCAAAAGATATGGAGAAGGG + Intronic
1122076485 14:99238276-99238298 CTTCCACCAGAGATTGGAAAGGG + Intronic
1122201837 14:100127561-100127583 GTTCCAAGAGTGATGGGGAAGGG - Intronic
1125038716 15:35158058-35158080 ATTCCAACAAAGGAGGAGAATGG + Intergenic
1125122119 15:36173662-36173684 CTTAAAACAGAGATGAGGAAGGG - Intergenic
1125259320 15:37804380-37804402 CTTCCAACACATATGGCCAAAGG + Intergenic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1127118408 15:55749786-55749808 TTTCCAACAGAGAGGAAGAGAGG + Intergenic
1127516468 15:59698255-59698277 CATCCAACAGAAGTTGAGAAAGG + Intergenic
1128679095 15:69634308-69634330 CTTGCAACAGGTATGGCGAAAGG + Intergenic
1130344302 15:83027543-83027565 TCTCCTACAGAGGTGGAGAAGGG - Intronic
1130858062 15:87859097-87859119 AGTTCAACAGAGATGTAGAAAGG - Intergenic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1132801521 16:1756896-1756918 CCTCCCAGAGAGATGGATAATGG + Intronic
1137571576 16:49569587-49569609 GTTGCAACAGCCATGGAGAATGG + Intronic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138363031 16:56449195-56449217 CTTGCAACAGAGATGTGTAATGG - Intronic
1138746410 16:59367798-59367820 CTTGCGACAGAGACAGAGAACGG + Intergenic
1138887622 16:61098639-61098661 TTCCCAACAGCGATGTAGAAGGG + Intergenic
1139053555 16:63154481-63154503 GTTCCACCAGTTATGGAGAAAGG - Intergenic
1141156653 16:81601712-81601734 CTTCCATGGGAGCTGGAGAATGG - Intronic
1141560303 16:84863437-84863459 CCTCTAACGGAGATGGAGCAGGG + Intronic
1141986951 16:87586225-87586247 CTTCCCACAGAGAGCGAGAGAGG + Intergenic
1142675645 17:1511679-1511701 GTGCCAACAGGGATGGAGGACGG + Intronic
1143005389 17:3829163-3829185 TTGCCATCAGAGATGGTGAATGG - Intronic
1146004362 17:29151524-29151546 CCTCCAAAAGAGGTGGAGGAGGG + Intronic
1146168993 17:30618160-30618182 CTCCCAACAGAAATTGAGAAAGG - Intergenic
1146170569 17:30629289-30629311 CTCCCAACAGAAATTGAGAAAGG + Intergenic
1146344022 17:32045310-32045332 CTCCCAACAGAAATTGAGAAAGG + Intronic
1146461029 17:33046258-33046280 ATTCCAAAAGAGATAGTGAATGG - Intronic
1148171205 17:45521790-45521812 CTCCCAACAGGAATTGAGAAAGG - Intergenic
1148278470 17:46328009-46328031 CTCCCAACAGGAATTGAGAAAGG + Intronic
1148300679 17:46545872-46545894 CTCCCAACAGGAATTGAGAAAGG + Intronic
1148364815 17:47046759-47046781 CTCCCAACAGGAATTGAGAAAGG + Intronic
1150401825 17:64863379-64863401 CTCCCAACAGGAATTGAGAAAGG - Intronic
1150781942 17:68130691-68130713 CTGCCAACAGAAATTGAGAAAGG - Intergenic
1150894885 17:69198013-69198035 ATTCTAACTGAGATAGAGAATGG - Intronic
1153183855 18:2465798-2465820 TTTCAGTCAGAGATGGAGAAGGG - Intergenic
1154489516 18:14908947-14908969 CTGCCACCATAGATGGACAATGG + Intergenic
1155590740 18:27424472-27424494 GTGCCAACAGAGAAGGAGATCGG - Intergenic
1155908841 18:31485745-31485767 GTTCCAACAGGGAAGGAGATGGG - Intergenic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1156786029 18:40916435-40916457 TTTTCAACAGAGATTGAGAAGGG + Intergenic
1157167671 18:45373223-45373245 CTACTAAGAGAGAAGGAGAAGGG - Intronic
1157807190 18:50666832-50666854 CTTCCCACAGTGATGATGAAAGG + Intronic
1158841002 18:61387289-61387311 CTACCAAAAGAAGTGGAGAATGG + Intronic
1162431467 19:10631452-10631474 CTGCCAAGAGAGATGGAGGGAGG - Intronic
1163817333 19:19474933-19474955 CTTCCATCAAAGAGGGACAAGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164969133 19:32515814-32515836 CTTCCAAGAGATCTGGAGGAAGG + Intergenic
1165261270 19:34620762-34620784 GTTCCAGCAGCGATGGAGATGGG + Intronic
1165847063 19:38824948-38824970 TTTAAATCAGAGATGGAGAAGGG - Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1168034103 19:53705274-53705296 CTTCCATCAGACATGGAGGATGG + Intergenic
1168151442 19:54451015-54451037 CTTCCCAAAGGGAAGGAGAAGGG - Intronic
925449867 2:3959973-3959995 CTTTCACCAGAGAGTGAGAACGG - Intergenic
926128302 2:10285260-10285282 CCTCCTGCAGATATGGAGAAAGG + Intergenic
927337476 2:21941655-21941677 CATCAAACAGAGAAGCAGAATGG - Intergenic
928860018 2:35846256-35846278 CTTCCACCAGCGAGGGCGAAGGG + Intergenic
929547744 2:42866677-42866699 CTTCCTCCAGAGATGGGGCAGGG + Intergenic
931116739 2:59173789-59173811 CTTCACACAGCGAGGGAGAAAGG - Intergenic
931677166 2:64708889-64708911 CCTCCAAAAGAGACTGAGAAGGG - Intronic
932189066 2:69723897-69723919 CTTGCAGCTGAAATGGAGAAAGG - Intronic
932874172 2:75433216-75433238 CTTCCAAGAGACTTGGAGGAAGG + Intergenic
933560059 2:83877216-83877238 CTTATAACAGAGATTGAGGAGGG + Intergenic
933743371 2:85552405-85552427 CTTCCAGCAGAGGTGGGCAAGGG - Exonic
934462520 2:94226196-94226218 CTTCCTACAGAGTTGGGGATAGG + Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
935976722 2:108585675-108585697 CTTGCAAAAGAGATGGTGATGGG + Intronic
937495912 2:122418998-122419020 CATCCCACAGAGATGGAGTAAGG - Intergenic
939073293 2:137569124-137569146 CTGCCTCCGGAGATGGAGAAAGG + Intronic
939400452 2:141685636-141685658 CTTACAACAGGGATGTAGAAAGG + Intronic
939444104 2:142286874-142286896 TTTCCAACAGAGGTGTAGGATGG - Intergenic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
941732893 2:168937843-168937865 GTCCCAATATAGATGGAGAATGG + Intronic
942143225 2:172998963-172998985 CCTCTAAAAGAGATGGAGATTGG + Intronic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943103098 2:183510718-183510740 TTTAAAACAGAGAGGGAGAAAGG + Intergenic
943434388 2:187846408-187846430 CTTAAAACAGAAATGAAGAAAGG + Intergenic
944022870 2:195126352-195126374 CTTCCAACTCAGAAGCAGAAGGG + Intergenic
947178789 2:227393796-227393818 CTCCCAGAAGAGATGGAAAAGGG - Intergenic
947242803 2:228014709-228014731 CTTCCACCAGGGAAGGAGAAGGG - Intronic
947642644 2:231715540-231715562 CCAGCAACAGAGAGGGAGAAAGG - Intergenic
947958847 2:234217787-234217809 CTTCCACCTGAGAAGTAGAAAGG + Intergenic
948312316 2:236997313-236997335 CCGCCAACAGAGAAAGAGAAAGG + Intergenic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1169735939 20:8837703-8837725 CTTCCCACAGTTATGGTGAAAGG - Intronic
1170499120 20:16956656-16956678 CTTCCAACAGTGAGGAAGCAAGG + Intergenic
1173264896 20:41470187-41470209 TCTCCCACAGAGATGGAGCAAGG - Intronic
1173698520 20:45044885-45044907 TTTCCCACAGAGTTGGAGAAAGG + Intronic
1174484957 20:50855257-50855279 ATACCAACAGAGATGGAGATGGG - Intronic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1175445708 20:59018149-59018171 CTTCCAAGGAAGATGGGGAAGGG - Intergenic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1177744359 21:25193416-25193438 TTTCCATCAGAGAAAGAGAAAGG - Intergenic
1177841266 21:26236410-26236432 CCTCAAACAAAGATTGAGAAAGG + Intergenic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1178682091 21:34680823-34680845 CTTCCTACAGACATGTTGAATGG - Intronic
1180454853 22:15504831-15504853 GTTCCAGCAGAGGTGGTGAAGGG + Intergenic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1180692256 22:17727189-17727211 CTACAAACAGAGATGTAGCAGGG - Exonic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1181901474 22:26159845-26159867 CATCCAACAGAGATGGGGGCAGG + Intergenic
1181943857 22:26499739-26499761 TATTCAACAGAGCTGGAGAAGGG + Intronic
1183090533 22:35519086-35519108 CTTCCCACAGAGAATGAGAGAGG - Intergenic
1185391612 22:50564481-50564503 CTTCCGAGAGAGTAGGAGAAAGG + Intergenic
949722655 3:7008797-7008819 CTTCCAAGAAAAAAGGAGAAAGG - Intronic
951621718 3:24609091-24609113 CTTCCAAAAGATATGGAAAATGG + Intergenic
951725362 3:25751988-25752010 CTTCTAACAGCTGTGGAGAAGGG - Intronic
952389803 3:32870371-32870393 CCTGCAACAGAGATGGGGACAGG - Intronic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
953801148 3:46023505-46023527 CATCCAAGAGAGATGGAAAAGGG + Intronic
954299268 3:49690759-49690781 CTTACAACTGAGATGGATACAGG + Intronic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
960387806 3:117041812-117041834 TATGCAACAGAGATAGAGAAGGG - Intronic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
962827480 3:139110566-139110588 CTTCCTACAGGTATGAAGAATGG + Intronic
963419122 3:145037144-145037166 TTTCGAGGAGAGATGGAGAAAGG + Intergenic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
966828954 3:183989386-183989408 GTTCCAGCAGATAGGGAGAAAGG + Intronic
970171975 4:13299433-13299455 CACCCAAGAGAGATGGAGAAAGG + Intergenic
972494180 4:39617742-39617764 CTTCCACCAGAGAGTGAGTAGGG - Intronic
972713061 4:41617931-41617953 CTTCCAACAGCTATGAAGTAGGG + Intronic
973801807 4:54485766-54485788 CATCCAACAGAGATGGACATGGG + Intergenic
974524038 4:63025317-63025339 CACCCAACAGAGAAGGAGCAGGG - Intergenic
975613585 4:76224373-76224395 CCTCCCACAGAAATGGAGAGAGG + Intronic
977013159 4:91659485-91659507 CTGCTAACAGTGAAGGAGAAGGG + Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
979133134 4:117074392-117074414 CTGCCTACCGACATGGAGAATGG - Intergenic
980738994 4:136927090-136927112 CTTCCATCAGTGAAGGAGAGGGG - Intergenic
981415027 4:144482973-144482995 CTTACCACAGAGATGGAGTCAGG - Intergenic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
983038868 4:162900791-162900813 CTTCCCACAGAGAGACAGAAAGG - Intergenic
984616020 4:181898681-181898703 TTCCCAACAGAAATGTAGAAAGG - Intergenic
985048879 4:185970199-185970221 CTTCCACCAGTGAGGGTGAAGGG + Intergenic
985893740 5:2737262-2737284 CTTCTAACTCAGCTGGAGAATGG - Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
992074018 5:73174460-73174482 CTTCCTACAGAGAAGGGGGAGGG - Exonic
992163539 5:74025955-74025977 CTTGGAACAGAGCAGGAGAAGGG + Intergenic
992854959 5:80850227-80850249 CTTCCTACAGACATGTTGAATGG - Intronic
993615613 5:90108050-90108072 CATTCAACTGAGATAGAGAAGGG - Intergenic
994058201 5:95444068-95444090 CTTCCACCAGAGACAGGGAAAGG + Intronic
994959777 5:106584412-106584434 CCTCCCACAGAGATGGAGGTGGG + Intergenic
995368731 5:111393962-111393984 AGTGAAACAGAGATGGAGAAGGG + Intronic
995986751 5:118185482-118185504 ATTTCAACAGAAATGGAGAGGGG + Intergenic
996043517 5:118843785-118843807 GTACCAACAGAGATGGAGTAGGG - Intronic
997210105 5:132072182-132072204 CTTGCAAAAAAGGTGGAGAAAGG + Intergenic
998817149 5:146026112-146026134 CTACTAACAGATATGGAGGAGGG + Intronic
998875705 5:146596871-146596893 GTTCCAGCAGGGCTGGAGAAAGG - Intronic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
999625928 5:153520261-153520283 CATCCTACAGAGAAGGTGAAGGG + Intronic
999939659 5:156528088-156528110 ATGACAGCAGAGATGGAGAAAGG + Intronic
1000953680 5:167516436-167516458 ATTCCATTAGAGATGGAAAAAGG - Intronic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1001996235 5:176161373-176161395 CTTCCAGCAGGGAGGGGGAAAGG + Intergenic
1002483135 5:179516686-179516708 CTTCCCACACAGGTGGAGAGAGG - Intergenic
1002597965 5:180336395-180336417 ATTCCAACAGCGCCGGAGAATGG - Intronic
1002671360 5:180870365-180870387 CTTCCCAGGGAGATAGAGAAAGG - Intergenic
1003091277 6:3105686-3105708 CTTACAACAGAGAGGAGGAAAGG + Exonic
1003898169 6:10627861-10627883 TATTCAACAGAGAGGGAGAAAGG + Exonic
1004422781 6:15486691-15486713 GTGACAACAGAGATGAAGAAAGG - Intronic
1004683200 6:17916899-17916921 CTTCCAAAAGGCATGAAGAAGGG + Intronic
1005309300 6:24543932-24543954 CTTCCCACAGGGAAGGAGCAGGG + Intergenic
1006101802 6:31690173-31690195 CTTCCCCCAGGGATGGAGAAAGG - Intronic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1010216292 6:73404935-73404957 CTTCCTGCAGTGATGGAAAATGG + Intronic
1011121476 6:83958479-83958501 CAGTCAAGAGAGATGGAGAAGGG + Intronic
1011388070 6:86818995-86819017 CTTCCAAACCAAATGGAGAAAGG - Intergenic
1011493213 6:87913697-87913719 CTGCCATCAGAAAGGGAGAAAGG - Intergenic
1012465520 6:99513064-99513086 CTTCAAGCAGACATGGAGAGGGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013671356 6:112406878-112406900 CCTCCATTAGGGATGGAGAACGG + Intergenic
1014130288 6:117823310-117823332 AGTCCCACAGAGAAGGAGAATGG - Intergenic
1015406075 6:132837910-132837932 CTCCCCACAAAGTTGGAGAATGG - Intergenic
1016904328 6:149133875-149133897 CTTTCAACAGAGTTGGTCAAGGG - Intergenic
1017039230 6:150294442-150294464 CTCCCCAGAGAGATGCAGAACGG + Intergenic
1017957133 6:159188094-159188116 CTTCAAACAAAGATGAAGTAGGG + Intronic
1017983296 6:159421439-159421461 CTTCCACCACCGATGGAGAATGG - Intergenic
1018657601 6:166054497-166054519 CTTCCATGATAGATGGTGAAGGG - Intergenic
1018941606 6:168312053-168312075 CTTCTATCAGGGAAGGAGAAGGG - Intronic
1020387263 7:7620734-7620756 CCTCCAACAGAGAGGGAGAGTGG - Intergenic
1021356623 7:19658803-19658825 TTTACATCAGAGAGGGAGAAAGG + Intergenic
1022991242 7:35709666-35709688 CTTCCATCAGAGATAGTGACTGG - Intergenic
1023118158 7:36882994-36883016 TTTCAACCAGGGATGGAGAAAGG + Intronic
1023576122 7:41629064-41629086 GTAGCAACAGAGAAGGAGAAGGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025806410 7:64838002-64838024 CTTATAACAGAGATTGAGGAGGG + Intergenic
1028128743 7:87145925-87145947 TATCCAACAGAGATAGAGAAAGG + Intergenic
1028795264 7:94895209-94895231 CTTCCAACAGAGATGGACCCAGG - Intergenic
1028811603 7:95094296-95094318 TTTCTAATGGAGATGGAGAAGGG - Intronic
1029877867 7:103772882-103772904 CTTCCAATTGAGATTGTGAAGGG + Intronic
1030991031 7:116300766-116300788 GTTCCAATAGAGATGTATAAAGG + Intronic
1032333677 7:131004507-131004529 TTTCCCACAGATATGGAAAAGGG - Intergenic
1033453948 7:141485731-141485753 ATGCCACCAGACATGGAGAAAGG - Intergenic
1034733937 7:153411994-153412016 CTTATAACAGAGATTGAGGAGGG + Intergenic
1035909851 8:3554537-3554559 CTTCCAACAGAGCAGGAGCTGGG - Intronic
1037367437 8:18137948-18137970 ATTCCAACAGAGAATGGGAAGGG - Intergenic
1037425187 8:18747936-18747958 CTGGCAAGAGAGAGGGAGAAAGG + Intronic
1039186571 8:34923820-34923842 CTTCCAACATATATGGAAATGGG - Intergenic
1039254723 8:35706499-35706521 CTTCCTGCAGAGCTGGAGAGAGG + Intronic
1041344846 8:56886581-56886603 CCACCAACAGAGACGGAGAAAGG + Intergenic
1041861675 8:62520989-62521011 CTGTCATCTGAGATGGAGAAGGG - Intronic
1042544402 8:69938112-69938134 CTTCCAACAGAAATGGGCAAAGG - Intergenic
1043661376 8:82746450-82746472 CTTCCCAGAGAGAAGGAGGAGGG + Intergenic
1044024961 8:87157609-87157631 CTTCAAAAGGGGATGGAGAAGGG - Intronic
1044770570 8:95626782-95626804 CATCACACAAAGATGGAGAAAGG + Intergenic
1045132693 8:99174414-99174436 CCTGCAACAGTGATGGAAAAAGG + Intronic
1045558923 8:103241859-103241881 ATTCCATCAGAGAGGGAGAAAGG - Intergenic
1045962401 8:107983325-107983347 CATCCAAGAGAGATGGAAAAGGG + Intronic
1046089020 8:109475986-109476008 CTACCATTAGAGGTGGAGAATGG - Intronic
1049905293 9:211138-211160 CATCCAATAGAGATGGAGCATGG + Intergenic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1050917270 9:11152923-11152945 CTTCCAAAAAAAATGGAAAAAGG + Intergenic
1052233725 9:26186092-26186114 ATTACAACAGAAATGTAGAAAGG + Intergenic
1058652388 9:107188906-107188928 ATACTAAAAGAGATGGAGAAGGG + Intergenic
1059635478 9:116166213-116166235 CTTCCAAAACAGAAGGGGAAGGG + Intronic
1061379396 9:130244926-130244948 CTTGCGACAGGGCTGGAGAAAGG + Intergenic
1062633337 9:137477216-137477238 CTTGGAACAGAGATGGAGCCTGG - Intronic
1185835985 X:3346371-3346393 CTTCAAACAGTGCTGGGGAACGG + Intronic
1186230555 X:7449226-7449248 CTTCCTACAGAGACTGAGAGCGG - Intergenic
1186969991 X:14831580-14831602 CAGCCCACAGAGATGGGGAACGG + Intergenic
1187386888 X:18857227-18857249 CTTCCCTCAGTGAGGGAGAAGGG - Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1191141403 X:57120022-57120044 CCTCCAACAGAGAGGGAGCCAGG - Exonic
1191143048 X:57135990-57136012 CCTCCAACAGAGAGGGAGCCAGG - Exonic
1192565416 X:72159270-72159292 ATTCCATCTGAGATGGAGCAGGG + Intergenic
1194078887 X:89433015-89433037 TTTCCAACTGAGATGGTGGAAGG - Intergenic
1198333663 X:135645407-135645429 GTTCCAATAGAGAGGGAGAAAGG - Intergenic
1200959252 Y:8982107-8982129 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1201312108 Y:12606480-12606502 TTTAAATCAGAGATGGAGAAGGG + Intergenic
1201670595 Y:16516041-16516063 CTTCCCACAGAGGTGGAGTCTGG + Intergenic
1201770277 Y:17611856-17611878 CTTATAACAGAGATTGAGGAGGG - Intergenic
1201831277 Y:18294131-18294153 CTTATAACAGAGATTGAGGAGGG + Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic