ID: 934868544

View in Genome Browser
Species Human (GRCh38)
Location 2:97837891-97837913
Sequence GTGGTTGCCTAGAAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934868544 Original CRISPR GTGGTTGCCTAGAAATAGGA AGG (reversed) Intronic
902673069 1:17988526-17988548 GTGGCTGCCTGGGAATGGGACGG - Intergenic
902868905 1:19300716-19300738 GTGGTTGCCTAGGACTGAGAGGG - Intergenic
905170994 1:36109426-36109448 GGGGCTGCCTGGAACTAGGAGGG - Intronic
906457765 1:46011785-46011807 GTGTTCGTCTAGAAATAAGAAGG + Intronic
908824685 1:68121990-68122012 ATGGTTACCTGAAAATAGGAAGG + Intronic
909108018 1:71437243-71437265 GTAGTTGCTTAGGAATAGGTGGG + Intronic
912593998 1:110855855-110855877 GTAGTTGCCAAGAGGTAGGAGGG + Intergenic
913515658 1:119603468-119603490 GGAGTTGCCTGGCAATAGGAAGG + Intergenic
914773704 1:150716536-150716558 GTGATTGCCTAGGACTGGGAAGG + Intronic
916288423 1:163136259-163136281 GAGGTTGTGGAGAAATAGGAAGG - Intronic
917484987 1:175447718-175447740 CTGTTTGCCTACAAATAGAAAGG - Intronic
917705520 1:177630207-177630229 GTGGTTGCCAGGAATTCGGAAGG + Intergenic
918241644 1:182625409-182625431 GTGGTTGCCTGGGGCTAGGAGGG - Intergenic
919020982 1:192105448-192105470 CTGGTTGTCTAGAAAAAGGAAGG - Intergenic
920063130 1:203242216-203242238 GAGGTTGCAGAGAAAAAGGAGGG - Intronic
922529059 1:226329187-226329209 GTGTTTGCCTAGTACTGGGAGGG - Intergenic
922538465 1:226401139-226401161 GTGGTTGTCAGGAATTAGGAGGG + Intronic
922993494 1:229937390-229937412 GTGAATGCCTAGAATTAGGATGG - Intergenic
923423998 1:233850180-233850202 GTGGTTGCAGAGGAATAAGAAGG + Intergenic
1064465674 10:15578188-15578210 GTGGTTGCCAAGAGATATGGAGG - Intronic
1066495088 10:35934819-35934841 CTGGTTGCCAAGAAATAGATTGG + Intergenic
1066643174 10:37576989-37577011 GTGGTTTATTAGAAATAGAAGGG + Intergenic
1067053034 10:43035971-43035993 GTGGTTGCCTAGGGATGGGGCGG + Intergenic
1067959756 10:50834862-50834884 GTGGTGGCCTAAGAACAGGATGG + Intronic
1070405231 10:76088475-76088497 TTGGTTGCCAATAAACAGGAAGG + Intronic
1070552198 10:77498701-77498723 GTGTTTGCCTGTAAATAGGGAGG - Intronic
1070916455 10:80158236-80158258 GTGGTTGCCAGGAAAGAGGGTGG - Intronic
1074629585 10:115236913-115236935 GTGGTTGCCAAGAGTTTGGAGGG - Intronic
1078958885 11:16239630-16239652 CTGCTTGGCTAAAAATAGGACGG - Intronic
1080167031 11:29250996-29251018 GTGATTGCCAGGAATTAGGAAGG + Intergenic
1081491422 11:43572261-43572283 GGGCTTTCCTTGAAATAGGATGG + Intronic
1081707800 11:45195388-45195410 GTGGTTGCCTAGGGATGGGTGGG - Intronic
1085353731 11:75816905-75816927 GTGGTTGCCTTTGAATAGGCAGG + Intronic
1088521684 11:110708709-110708731 GTGGTTGCCTGGGAATGGGGAGG + Intronic
1089618096 11:119706459-119706481 CTGGTTGCCTAGGAAGAGGGAGG + Intronic
1089871393 11:121675489-121675511 GTGGTTGCCTGGATCCAGGAAGG - Intergenic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1092128857 12:6094388-6094410 GTTGTAAACTAGAAATAGGAGGG - Intronic
1092445374 12:8551143-8551165 GTGATTTTCTAGGAATAGGAGGG + Intergenic
1094070900 12:26412012-26412034 GTTGTTTCATACAAATAGGAGGG - Intronic
1094391559 12:29956852-29956874 GTGGTTGCCTAGGGCTAGGAAGG + Intergenic
1094531174 12:31276696-31276718 GGTGTTGCCTAGTTATAGGATGG + Intergenic
1095906446 12:47383027-47383049 GTGTTTGCCTAGAAAAATGATGG + Intergenic
1095978258 12:47954540-47954562 GTGGATGCCTTGAAAAGGGAGGG - Intergenic
1096171187 12:49471782-49471804 GTGGTTGCCAACAACTGGGAGGG - Intronic
1096382037 12:51166991-51167013 GTGGTTGACTAGAACTATGGAGG - Intronic
1096440581 12:51639715-51639737 GTGGTTGCCGAAGAATGGGATGG - Intronic
1097002312 12:55887616-55887638 GCGGTTGCCAAGGACTAGGAGGG - Intergenic
1097807144 12:63978375-63978397 GGGGTTGCCTAGAGTTGGGAGGG - Intronic
1097936618 12:65259309-65259331 GTTGTTGCCTAGGAATGTGAGGG - Intergenic
1098110981 12:67121633-67121655 ATGGTTGCCTTGAGAAAGGAGGG - Intergenic
1099905955 12:88770176-88770198 GTGGAAGCCTATAAATACGAAGG + Intergenic
1102629229 12:114262709-114262731 GTGTTTGCTTGGAAATAGGAAGG + Intergenic
1104100853 12:125607770-125607792 GTGGTTGCCTAGAGCTGGGAAGG - Intronic
1104305349 12:127605532-127605554 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1105501800 13:20979414-20979436 GTTCTTGCCTGGAAATAGCAAGG + Intronic
1106289122 13:28344215-28344237 GAGGCTGCCAAGAAATGGGAAGG - Intronic
1107846202 13:44515804-44515826 GTGGCTGCCTAGGGCTAGGAAGG + Intronic
1108255323 13:48604086-48604108 GTGGTTGCCTAGGACAAGGGGGG - Intergenic
1109180811 13:59212182-59212204 GTGGTTGTCTGGACATAGCATGG - Intergenic
1110811277 13:79813017-79813039 GTGTTTGTCTGGAGATAGGAGGG - Intergenic
1112146864 13:96709633-96709655 GTGGCTGTCTATAAATCGGAAGG + Intronic
1112681403 13:101769783-101769805 GTGGTTGCCAGGAAATGGGGTGG + Intronic
1113873037 13:113574409-113574431 GTGGTTGCCAGGAATTAGAAGGG + Intergenic
1115339909 14:32282516-32282538 GTGGTTGCCTAGCACTGGGGTGG + Intergenic
1115471563 14:33773629-33773651 GTATTTGCCTGGAAATAGGAAGG - Intronic
1115935917 14:38552185-38552207 GTAGTTTCCTCAAAATAGGATGG - Intergenic
1116510000 14:45733327-45733349 ATGGCTGACTAGAAATAAGAAGG + Intergenic
1117481208 14:56146965-56146987 GTGGTTGCCTAGAGCTGAGACGG - Intronic
1118347926 14:64953175-64953197 GTGGTTGACTAGAAGGAGCATGG + Intronic
1118855325 14:69616953-69616975 GTGGTTGCCTAGGGCTAGGTGGG - Intronic
1119197716 14:72729750-72729772 GTGGTTGCCAGGCATTAGGACGG + Intronic
1125316134 15:38433635-38433657 GTGGTTGCCTGGAGACAGGTAGG - Intergenic
1126591654 15:50346288-50346310 ATGATTGCCAAGAAGTAGGAGGG + Intronic
1127090080 15:55457911-55457933 CTGGGTGGCTAGAAATAGAAGGG + Intronic
1127125545 15:55808262-55808284 GTGTATGCCTAGCAATGGGATGG - Intergenic
1128189999 15:65683893-65683915 GTGGTTGCCTGGTGTTAGGAAGG - Intronic
1129111169 15:73338129-73338151 GTGGTTGCCGAGAACAAGGCTGG + Intronic
1130773417 15:86948591-86948613 CTCGTTGGCTAGAAATATGATGG - Intronic
1130950794 15:88585873-88585895 GTGGTTGCCAGGAGTTAGGAAGG + Intergenic
1131600779 15:93846679-93846701 GAGGTTGCAGAGAAAAAGGAAGG + Intergenic
1134268641 16:12713951-12713973 GTGATTGCTTAGAATTAGGGTGG - Intronic
1134766371 16:16762456-16762478 GTGGATGCCTAGAAAAAGAGTGG + Intergenic
1134979677 16:18596752-18596774 GTGGATGCCTAGAAAAAGAGTGG - Intergenic
1135392840 16:22108106-22108128 GTGGTTTCAGAGGAATAGGAAGG + Intronic
1136664322 16:31795041-31795063 GTGGTTGCTTAGAGATGGGTTGG - Intergenic
1138334667 16:56243619-56243641 CTGGTTGCCAAGGAATTGGAGGG + Intronic
1147204855 17:38829708-38829730 GTGGTTGCCTAGAGATGGGTAGG + Intergenic
1147992376 17:44342718-44342740 GTGGTTGCCTAGGGTTAGGGAGG + Intergenic
1148519815 17:48262101-48262123 GTGGCTGCCTACAAAGAAGATGG + Intronic
1149489945 17:57077361-57077383 ATGGTTCCAGAGAAATAGGAGGG + Intergenic
1150530260 17:65973704-65973726 GTGGTTGCCTGGATATGGGGAGG + Intronic
1152557557 17:81061434-81061456 GTGGTTGCCTGGAGATGGGGAGG - Intronic
1154052796 18:10977895-10977917 GTGGTTGCCTAGAGATGGCTGGG + Intronic
1154161590 18:11984295-11984317 GTGGGTGGCTGGAACTAGGAGGG - Intronic
1154395827 18:13987692-13987714 GATGTTGCATAGAAACAGGAAGG - Intergenic
1157809289 18:50683053-50683075 GTGGTTGCCTAGGGATGGAAAGG + Intronic
1159110657 18:64052688-64052710 GTGATTTCTAAGAAATAGGATGG + Intergenic
1159907771 18:74113273-74113295 GTGGTTGCCAGGAATTAGGGAGG + Intronic
1163041190 19:14603901-14603923 TTTGGTGCCTAGAAATAGCAAGG + Intronic
1163223869 19:15940958-15940980 GAGGTTGCCCAGCAATGGGAGGG + Intergenic
1168069094 19:53939445-53939467 GTGGTTGCCAGGGAATAGGATGG - Intronic
1168329365 19:55557775-55557797 GTGGTTGCCAGGAGCTAGGAGGG - Intergenic
925133276 2:1509491-1509513 GTGGTTTCCCAGAAACAAGAGGG - Intronic
925542791 2:4984582-4984604 GGGGTTTCCAAGAAATAGGGAGG - Intergenic
925624593 2:5830000-5830022 GTGATTGCCTAGAGATAATAAGG + Intergenic
925951901 2:8922689-8922711 GGGGTTGACTGGAAAAAGGATGG - Intronic
927494464 2:23543299-23543321 GTGGTCCCCAAGAAAGAGGAGGG + Intronic
928936202 2:36680851-36680873 GTGGTTGCCAGGAATTAGGGAGG - Intergenic
929946114 2:46373607-46373629 GTGGTTGCCTGGAACCAGGGTGG + Intronic
930050715 2:47214219-47214241 TTGGTTGCCTAGGAACAGAATGG + Intergenic
931424352 2:62157393-62157415 GTGGTAGCCTAGGTAGAGGAAGG + Intergenic
931779531 2:65567259-65567281 GTGGTTGCCCAGGAATAGTGAGG + Intergenic
933799468 2:85949227-85949249 GGGGTGTCCTTGAAATAGGAAGG - Intergenic
933865547 2:86513332-86513354 GTGGTTGCCAAGAGTTAGTAGGG + Intronic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
935151658 2:100442344-100442366 GTGGCAGCCTAGGAATAGAAGGG + Intergenic
935288841 2:101591606-101591628 GTGGTTGCCAAAAATTGGGATGG + Intergenic
937743634 2:125385907-125385929 GTGGTTGCCAAGGAATAGTGGGG + Intergenic
939253361 2:139712110-139712132 GTGGTTGCCTAGGTCTAGAAGGG - Intergenic
940329986 2:152464288-152464310 GTGGGTGCCAACAAATAGAATGG + Intronic
940768017 2:157810680-157810702 GAGATTGCCTATAAATGGGAAGG - Intronic
941831624 2:169967283-169967305 TTGGTAGCCTATAGATAGGAAGG + Intronic
942379746 2:175376570-175376592 GTGCTGGCCTAGAAATAAGCTGG + Intergenic
944152627 2:196576535-196576557 GTGGTTGCCAGGAATTGGGAAGG + Intronic
944976430 2:205058070-205058092 GTGGTTGCCAAGGAAAAGGAGGG - Intronic
945294641 2:208158632-208158654 GTGGTTGCCTAGCGCTAGGGTGG - Intergenic
945545336 2:211143360-211143382 CTGGTTTCATAGAAAGAGGAAGG + Intergenic
946518286 2:220437291-220437313 ATGCTTCCCTAGAAATAGGTAGG - Intergenic
947331230 2:229031643-229031665 GGGGTTTCCTAGAAATGGAATGG + Intronic
947474160 2:230427775-230427797 GTTGTTGGCTTAAAATAGGATGG - Intronic
947631931 2:231659399-231659421 GTGGTTGCCAAGAGCTGGGAGGG + Intergenic
1169104298 20:2981009-2981031 GTGGTTGCCTAGAATTAGCTTGG + Intronic
1169857677 20:10121472-10121494 GTGGTTGCCAGGCAATCGGAGGG + Intergenic
1170190496 20:13640289-13640311 TTTGTTACCTAGAAGTAGGATGG + Intergenic
1171433018 20:25097984-25098006 GTGGTTGCCAGGAATTTGGAGGG + Intergenic
1172254498 20:33505476-33505498 ATGGTTGAATAGAAATAGAAGGG + Intronic
1173584191 20:44169644-44169666 ATAGTTCCCTGGAAATAGGAAGG - Intronic
1174220521 20:48950995-48951017 GTGGTTGTCTAGAGTTAGGGGGG - Intronic
1174827777 20:53784365-53784387 GTGGTTGCCTGGTAATCGGCGGG + Intergenic
1175454257 20:59098515-59098537 GTGGTTGCCAAGAATTAGCAGGG - Intergenic
1177506845 21:22030333-22030355 GAGGTTGTAGAGAAATAGGAAGG + Intergenic
1179453478 21:41481447-41481469 GTGGTTGCTTATGAGTAGGAGGG + Intronic
1180511115 22:16091181-16091203 GTGGTTGACCAAAAATAGAATGG + Intergenic
1180541508 22:16452840-16452862 GTGTATGCCCAGTAATAGGATGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182247633 22:28972290-28972312 GTGGTTGCCTAGCACTGGGGAGG - Intronic
1183471535 22:38009682-38009704 GTGGTTGCCTAGGGAGAGGGTGG - Intronic
1184103854 22:42355958-42355980 GGGGTAGCCTGGAGATAGGAAGG + Intergenic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
949447894 3:4154804-4154826 GTGGTTGCCCAGATATTGGCTGG - Intronic
949725650 3:7041301-7041323 GTGGTTGCCTGGGAATGGGAAGG - Intronic
950590260 3:13931930-13931952 GTGGTGGCTTAGAAATGGAAAGG + Intergenic
951955068 3:28244405-28244427 GTGGTTGCATTGAATAAGGATGG + Intronic
953313807 3:41907132-41907154 GTGGTTGCCTAGTACAAGCATGG + Intronic
953596960 3:44325534-44325556 GTTGTTGCCTAGGACTAGGGTGG - Intronic
955054036 3:55440351-55440373 GTGCTTGCCTACTTATAGGATGG - Intergenic
955528988 3:59852689-59852711 GTGGTTGCCAAGGATTAGGAGGG - Intronic
955645297 3:61131278-61131300 GTAGTTGCTAAGAGATAGGAAGG - Intronic
955863682 3:63359171-63359193 GTCCTTACCTAGAAAGAGGAAGG - Intronic
956151306 3:66245979-66246001 GTGGTTGCCTAGGAGTGGGGAGG - Intronic
956186633 3:66568831-66568853 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
956741489 3:72279611-72279633 GAGGGTGCTTAGGAATAGGAGGG + Intergenic
956858931 3:73303330-73303352 GAGACTGCCTAGAAATAAGAAGG - Intergenic
957857886 3:85901809-85901831 GTGGTTGCTTAGAGTTAGGGTGG - Intronic
958805732 3:98807621-98807643 GTAGTTGGCTAGATAGAGGAAGG - Intronic
959947271 3:112138733-112138755 ATGATTGCCTAGAAACAGAATGG + Intergenic
961916457 3:130380094-130380116 GTGGTTACCTAGGACTAGGGTGG + Intronic
962777501 3:138676815-138676837 GTGGTTGCCTAGAATTGGAGTGG + Intronic
963817231 3:149844973-149844995 GTGGTTGCCTAGGGATTGGCAGG - Intronic
963998271 3:151736953-151736975 ATGGATGCAGAGAAATAGGAAGG - Intronic
964359265 3:155877558-155877580 GTGGTTGACTAGGACTGGGAGGG - Intronic
964703734 3:159596434-159596456 GTATATGCCTAGTAATAGGATGG - Intronic
965613059 3:170565082-170565104 GAAGTTGCCTTGAAATAGTAAGG - Intronic
967068328 3:185940051-185940073 GTGATTGCCTAGGACTGGGAGGG - Intergenic
967494981 3:190133075-190133097 GTGGTTGCAGGGAAAAAGGAAGG - Intergenic
967630084 3:191735579-191735601 GTGGATGTGGAGAAATAGGAAGG + Intergenic
967737741 3:192971144-192971166 GTGGTTGCATAAAAATGTGAGGG - Intergenic
974657962 4:64849379-64849401 GTGGTTGCTTAGAAATTCCAGGG + Intergenic
974787501 4:66638697-66638719 GTAATTGAATAGAAATAGGAAGG + Intergenic
974854953 4:67450078-67450100 GTGATTGCCAAGGATTAGGAAGG + Intergenic
975148430 4:70994393-70994415 GTGGGTGCCAGGGAATAGGAAGG - Intronic
976512429 4:85927312-85927334 GTGGTTGCTTAGAGCTGGGATGG + Intronic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
980155181 4:129095979-129096001 GTGGTTTCCTAGAAGAAGGAAGG - Intronic
983603290 4:169554641-169554663 GTGGTTGCCAAGAGTTGGGAGGG + Intronic
984165965 4:176303658-176303680 TTTGTTCCTTAGAAATAGGATGG + Intergenic
984417611 4:179480884-179480906 CTGGTTGCCTAAACATAGGATGG + Intergenic
984532427 4:180933241-180933263 GTCTTTGCCTAGAAATATGTAGG + Intergenic
986572856 5:9183051-9183073 GTGGTTGCCTAGAAAACAGAGGG + Intronic
986957291 5:13168542-13168564 GTGGTTTCCTGGGAATGGGAGGG + Intergenic
987012499 5:13781846-13781868 GTCTTTGCCAAGTAATAGGAGGG - Intronic
987176975 5:15322442-15322464 AAGATTGCCTAGAAATAGAATGG - Intergenic
987191415 5:15482390-15482412 GTGGCTGAGTAGAAAAAGGAGGG + Intergenic
988462039 5:31448323-31448345 GTGGTTGCCTAGGATTGGGCAGG + Intronic
988703540 5:33700503-33700525 GTGGTTGCCAAGGGTTAGGATGG + Intronic
988848449 5:35154501-35154523 GAGGTTGCAGAGAAAAAGGAAGG + Intronic
989385519 5:40851393-40851415 GTACTTGCATAGAAAAAGGATGG + Intronic
990277452 5:54213195-54213217 GTGTTTTCTTAGAAATTGGAAGG - Intronic
990299270 5:54434369-54434391 GGGGTTGCCTAGAAGAAGTATGG + Intergenic
991733534 5:69611407-69611429 GTAGTTGCCTAGGGCTAGGAGGG + Intergenic
991809968 5:70466553-70466575 GTAGTTGCCTAGGGCTAGGAGGG + Intergenic
991861420 5:71016443-71016465 GTAGTTGCCTAGGGCTAGGAGGG - Intronic
991926602 5:71711819-71711841 GTGGTTGCCTGGGGACAGGATGG + Intergenic
992478068 5:77123182-77123204 GAGATTGCCTACCAATAGGAAGG - Intergenic
992643278 5:78788456-78788478 GAAGTTGTCTTGAAATAGGATGG + Intronic
993118400 5:83745054-83745076 GTTGTTGCCTTGAAAAAGGAAGG + Intergenic
994144472 5:96378138-96378160 GTGTTTGCCAGGGAATAGGAAGG + Intergenic
994569495 5:101497098-101497120 GTGGTTACCTAGGAACAGGTAGG + Intergenic
996562473 5:124845652-124845674 CTGGTTCCTTAAAAATAGGATGG + Intergenic
997066370 5:130564898-130564920 GTGGCTGCCTGGAGATAGAAGGG + Intergenic
997987779 5:138517451-138517473 GTGGTTGCCTAGAATGAGACAGG + Intronic
998260151 5:140624521-140624543 GTGGTTGCTTAGAAGTGGGGTGG - Intergenic
999528339 5:152433491-152433513 GTTGTTGCCTGGAGATGGGATGG + Intergenic
1002788220 6:419646-419668 GGGGTTGCCTGGAAACAGGAAGG + Intergenic
1002977244 6:2092928-2092950 GAGGTTGTCAAGAAATATGAAGG + Intronic
1005564464 6:27076767-27076789 GTGGTTGCCAGGATCTAGGATGG - Intergenic
1005806587 6:29478989-29479011 GTGGTTGCCAAGAGCTGGGAGGG - Intergenic
1005846791 6:29787814-29787836 GAGGTTGTGGAGAAATAGGAAGG + Intergenic
1005851073 6:29822852-29822874 AAGGTTGCAGAGAAATAGGAAGG + Intergenic
1007792030 6:44315307-44315329 GTGGTTGCCAAGGGCTAGGAAGG - Intronic
1009717469 6:67417547-67417569 GTAGTTGTATATAAATAGGAAGG + Intergenic
1011814005 6:91166980-91167002 TTGGTTGTCTAGAAAAGGGAAGG + Intergenic
1014325355 6:119986602-119986624 GGGTTTGCATAGAAACAGGATGG - Intergenic
1015218378 6:130776557-130776579 GTGGGTACCTAGAGATAGGAAGG + Intergenic
1015455822 6:133424959-133424981 ATGGTTGCCAAGAGATTGGAGGG - Intronic
1015964816 6:138687807-138687829 GTGGTTGCCTAGGAATGGGAGGG + Intronic
1016550572 6:145275081-145275103 GAGGTTGACTACAAATAGGAAGG - Intergenic
1017866259 6:158445921-158445943 GTGGTTTCCTAGAGAGAAGAGGG + Intronic
1020390909 7:7656944-7656966 GAGGATGTGTAGAAATAGGAAGG - Intronic
1020749466 7:12122388-12122410 GAGGTTGTCTAGAAATAGGAAGG - Intergenic
1023359615 7:39401665-39401687 GTGGATGCCTAGAAACAGCAGGG - Intronic
1023379447 7:39591846-39591868 GTGGTTGCCAGGAATTAGGTAGG - Intronic
1026267954 7:68811655-68811677 GTGGTTGCCTGGGAATAGTGGGG + Intergenic
1028067831 7:86410319-86410341 GTGGCTGTCTGGGAATAGGAAGG + Intergenic
1029031798 7:97476071-97476093 GTGGTTCTCCATAAATAGGAAGG - Intergenic
1029060618 7:97794250-97794272 GTGGTTGCTGAAGAATAGGATGG - Intergenic
1032653761 7:133906030-133906052 GTGGTTGGGTAGAAATGGGCAGG + Intronic
1036126512 8:6068030-6068052 GTGGTTGCTTAAAAATTGGCAGG - Intergenic
1036649403 8:10632772-10632794 GAGGTTGACTTGATATAGGATGG + Intronic
1038494974 8:27994950-27994972 GTGATTGCCTTGATAGAGGAGGG + Intergenic
1038550054 8:28459692-28459714 CTGGATGCCTAGTAATAAGAGGG - Intronic
1039966216 8:42285890-42285912 GTGGTTGCCTAGGACTAGAGGGG + Intronic
1041044490 8:53878112-53878134 GTGGTTGCCAAAAAAAATGAAGG - Intronic
1041151782 8:54943213-54943235 GTGCTTGCTTAGAGAAAGGAAGG + Intergenic
1041533679 8:58901363-58901385 ATGGTTGCCTAGCAACTGGAAGG - Intronic
1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG + Intergenic
1043396064 8:79838359-79838381 GTGGTTGCCAGGAATTAGGGAGG + Intergenic
1044682374 8:94794893-94794915 GTGGTTGCCTAGGGCTAGGGAGG - Intergenic
1045162548 8:99564832-99564854 GTAGTTGACTAGTAAGAGGAAGG - Intronic
1045540197 8:103076924-103076946 GTGGTTGCCAGGAACCAGGATGG + Intergenic
1045995438 8:108357221-108357243 GTGGTTGCTTAGAACTGGGGTGG + Intronic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048759499 8:137777665-137777687 GTGGTTGCCTAGATAGGGGCTGG - Intergenic
1050111408 9:2220397-2220419 GTGGTTGCCTGGGATTATGAGGG - Intergenic
1050342586 9:4655362-4655384 GTGGTTACCTATAGCTAGGAGGG + Intronic
1050412659 9:5382791-5382813 GATGTTGCCTTGAAGTAGGATGG + Intronic
1050552528 9:6760118-6760140 GTGGTTGCCTAGGGACAGAAGGG - Intronic
1050741837 9:8829299-8829321 GTGATTGCCTTGGCATAGGATGG - Intronic
1052588718 9:30463067-30463089 GTGGTTGGCTGGGACTAGGAGGG + Intergenic
1056112359 9:83408474-83408496 CTGGGTGCCAAGAAATGGGAGGG - Intronic
1056255379 9:84794254-84794276 GAAGTTGCCTAGAAATAGGCAGG + Intronic
1058501929 9:105628888-105628910 GTGGTTGCCTAGGACCAGGGTGG + Intronic
1059804945 9:117788722-117788744 GTGTTTGCCAAGATATTGGAAGG + Intergenic
1060945020 9:127565300-127565322 GTGGTTGCCTAGATTTAGGAGGG + Intronic
1187310214 X:18134599-18134621 GTGGTTCCATAGAAATATGACGG - Intergenic
1187455931 X:19441293-19441315 GTGATTGCTTAGGAATAGGGGGG + Intronic
1188211687 X:27433336-27433358 ATGGTTGCTTAGAAATAGGGTGG - Intergenic
1189280517 X:39817554-39817576 CTGGTTTCCCAGAAACAGGAGGG + Intergenic
1192263068 X:69520129-69520151 GTGGAAGCCTAGAAAGTGGATGG - Intronic
1193650230 X:84122778-84122800 GTAGTTGCCTAGGAATTGCAGGG - Intronic
1194005315 X:88484410-88484432 GTGGTTACCTAGGGCTAGGAGGG - Intergenic
1195012087 X:100742613-100742635 TAGGTTGCCTAGAAACAGAATGG - Intergenic
1195785155 X:108511870-108511892 GTGGTTGCCTAGGACTGGGTGGG + Intronic
1196832557 X:119787584-119787606 GTGGTCTCCTAGAATTGGGAAGG - Intronic
1198557908 X:137815604-137815626 GTGGTTATCTGGAGATAGGAAGG + Intergenic
1198665622 X:139018988-139019010 GTGGTTGCCTAGTGATAAGAGGG - Intronic
1199696390 X:150345608-150345630 TTGGTGCCCTAGAAAAAGGAGGG + Intergenic
1200782535 Y:7229621-7229643 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic