ID: 934869567

View in Genome Browser
Species Human (GRCh38)
Location 2:97850461-97850483
Sequence TGGTGGTCTCAACACTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934869567_934869568 -7 Left 934869567 2:97850461-97850483 CCTTGGTAGTGTTGAGACCACCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 934869568 2:97850477-97850499 ACCACCAGTGCCATCCTCTCTGG 0: 1
1: 0
2: 0
3: 35
4: 183
934869567_934869573 15 Left 934869567 2:97850461-97850483 CCTTGGTAGTGTTGAGACCACCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 934869573 2:97850499-97850521 GAAAAACACACCCTTAATCCAGG 0: 1
1: 0
2: 0
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934869567 Original CRISPR TGGTGGTCTCAACACTACCA AGG (reversed) Intronic
903549434 1:24147646-24147668 TGGTGTTCCCAACCCAACCAAGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
913689567 1:121266384-121266406 TGGTGGTTGCAAAACCACCATGG + Intronic
914148031 1:145013888-145013910 TGGTGGTTGCAAAACCACCATGG - Intronic
917512005 1:175676445-175676467 TGCTGGTCTCAACACTCACCAGG - Intronic
921097261 1:211897485-211897507 TGGTGGTGTCGACATTCCCATGG - Intergenic
921266650 1:213426132-213426154 TGGTGGCCTCCGCACTGCCAGGG + Intergenic
923178655 1:231494892-231494914 TGGTAGTGTCAACATTCCCATGG - Intergenic
1066054845 10:31671155-31671177 TGGTTGGCTCAACACTCCCTTGG - Intergenic
1067555640 10:47267980-47268002 CGGCAGTCTCAACACTATCATGG - Intergenic
1076365042 10:129916225-129916247 TGGTGGTCTCACCCCTGCCAGGG - Intronic
1078343484 11:10520821-10520843 TGGTGGTCTCAAGATTATAATGG - Intronic
1080213977 11:29819952-29819974 TGGTGGTCACAACATTCCAAAGG + Intergenic
1081796147 11:45821344-45821366 TGGTGGTCTCAGGATTGCCAGGG - Intergenic
1087117584 11:94542014-94542036 TTGTGGTCTCAACCCTACCGAGG + Intergenic
1095211722 12:39502312-39502334 TGTTGCTCACAACACAACCAAGG - Intergenic
1099416762 12:82398061-82398083 TGGTGGACTCAATACTAAGATGG - Intronic
1104324034 12:127778934-127778956 TGTTGGTCTCAACAGCCCCAGGG - Intergenic
1111746238 13:92273017-92273039 TGGTGGTGTCACCTCTCCCAGGG - Intronic
1114166826 14:20227175-20227197 TGGTGATCTCAACACTCTGAGGG - Intergenic
1119040961 14:71274235-71274257 TGGGTTTCTCAACATTACCAGGG - Intergenic
1128533788 15:68474514-68474536 GGGTGTGCTCACCACTACCAGGG - Intergenic
1129931272 15:79412810-79412832 TGCTGGTCACAACACTCCAATGG - Intronic
1133782880 16:8953303-8953325 TTATGGTCTCAACTCTACCCCGG - Intronic
1140893282 16:79303430-79303452 CGGGGCTCTCAACACTACCCAGG + Intergenic
1143485175 17:7250304-7250326 TTGTGGTCTCACCACCACCAGGG - Intronic
1148101996 17:45097943-45097965 AGATGGTTTCAACACTTCCAGGG - Intronic
1155280917 18:24238763-24238785 TGGTGGTCTCACCTCTACTGTGG + Intronic
1156453926 18:37282218-37282240 TGGTCCTCTCTACACTCCCAGGG - Intronic
1159265269 18:66071995-66072017 TGGTGGTCTCAGCTGTACCTGGG - Intergenic
1159328411 18:66954493-66954515 TGTTGGCTTCAAGACTACCACGG - Intergenic
1161296173 19:3521454-3521476 TGGTGGTGGCTACACAACCACGG + Intronic
1161687192 19:5708571-5708593 TGGTGGACTCACCAGTCCCAGGG + Intronic
1163402139 19:17100674-17100696 TGGTGGTCCCAAGACTGCCAAGG - Intronic
1164421964 19:28101848-28101870 TGGTGCTGTCAACATTTCCAGGG - Intergenic
1164521551 19:28983766-28983788 GTGTGGTCTCAGCACTACCTAGG + Intergenic
1167273009 19:48517045-48517067 TTGTGCTCTCAACTCTCCCACGG + Intergenic
928204797 2:29276232-29276254 TGTTGGTTACAACACTTCCAGGG - Intronic
931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG + Intergenic
931423477 2:62149683-62149705 TGGGGGTGGCAAAACTACCAAGG - Intergenic
934869567 2:97850461-97850483 TGGTGGTCTCAACACTACCAAGG - Intronic
934996552 2:98967043-98967065 GGCTGGTCACAACACTACAATGG + Intergenic
939836262 2:147133140-147133162 TGGTGGTCTCAAAATTATAAAGG - Intergenic
939956274 2:148530066-148530088 TGGTGGTCTCAACTGGACAACGG - Intergenic
940177074 2:150890228-150890250 GGGTGGTCTCAACACCACTTTGG - Intergenic
945821769 2:214673615-214673637 TGATGGGCAAAACACTACCAAGG + Intergenic
946287329 2:218713874-218713896 AGGTTTTGTCAACACTACCATGG - Intronic
948225266 2:236304919-236304941 TGGTGGAGTCTACACTACAATGG - Intergenic
949005766 2:241646459-241646481 AGATGGTCTCCAAACTACCATGG + Intronic
1171213558 20:23335445-23335467 TGTGGGTCTCAACCCTCCCATGG + Intergenic
1172945915 20:38689075-38689097 TGGTAGTTTCTACCCTACCATGG + Intergenic
1174795062 20:53515293-53515315 GAGTGGTCTCTAAACTACCAAGG + Intergenic
951396602 3:22176536-22176558 TGTTGGTCTCAATACAACCATGG + Intronic
955175991 3:56613218-56613240 TGTGGGTCTCAAGACTAACAGGG - Intronic
960715154 3:120567965-120567987 TGCTGGTCACAACACTATTAGGG - Intergenic
968199228 3:196738262-196738284 AGGTGCCCTCAACACAACCATGG + Intergenic
969841448 4:9885844-9885866 TGGCTGTGTCCACACTACCATGG + Intronic
970350640 4:15198434-15198456 TGGTGGATTTAACCCTACCACGG - Intergenic
970851571 4:20610004-20610026 TGATTGTCTCCACACTACAACGG - Exonic
976124037 4:81814558-81814580 AGTTGGTCTCAAAGCTACCAAGG + Intronic
981022143 4:140040229-140040251 AGCTGCTCTCAACACTACAATGG - Intronic
986361340 5:6981117-6981139 TGGAGGACTCAACACTACACAGG + Intergenic
994643001 5:102433658-102433680 TGCTGGTCACAACACTCCAATGG + Intronic
995467748 5:112468000-112468022 TGGGGGTTTCAAGACTCCCATGG + Intergenic
995653983 5:114403591-114403613 TGGTTGTCTCTAGACTGCCAGGG + Intronic
1003951453 6:11119708-11119730 TGGTGATCACAACACTGCCATGG - Intronic
1014494057 6:122098603-122098625 AAGTGTTCTCAACAATACCAGGG - Intergenic
1019163445 6:170084085-170084107 TGCTGGTCTCAACACTCTGACGG - Intergenic
1020725620 7:11810165-11810187 TGGTGCTCTCAACAACATCAGGG - Intronic
1027425917 7:78061473-78061495 TGGTTGGCTCAAAACTACCTTGG - Intronic
1027444907 7:78262615-78262637 TAGTGGTATCAACACTTCCTAGG + Intronic
1028761984 7:94507437-94507459 TAGTGGTCCCACCACTGCCATGG - Intergenic
1030097133 7:105910448-105910470 TGGTGGAACCAACACTAGCATGG - Intronic
1030272847 7:107688154-107688176 TGGTGGATTCAACAATACCTAGG + Intronic
1031959604 7:127976794-127976816 TGCTTGTCACAACACCACCAGGG + Intronic
1034190811 7:149212057-149212079 TGGTGGTCTCAGCACCAGAATGG + Intronic
1037341717 8:17852787-17852809 TAATCCTCTCAACACTACCATGG + Intergenic
1042468993 8:69161816-69161838 GAGTGGCCTCAACACCACCATGG - Intergenic
1043542092 8:81275582-81275604 AGGAGATCTCAAAACTACCATGG - Intergenic
1043680807 8:83022483-83022505 TGGTAGACTCAACACCACCTGGG + Intergenic
1050599360 9:7234960-7234982 TGCTGGTTTCAATACTACCTGGG - Intergenic
1051538971 9:18193259-18193281 TGTTGATCTCACCACTCCCAGGG - Intergenic
1052981807 9:34455743-34455765 TGCTGGTCTCAACAATACACAGG + Intronic
1059509300 9:114829121-114829143 TGGTATTGTCATCACTACCAAGG - Intergenic
1188771248 X:34157443-34157465 TGCTGGTCACAACACTCCAATGG + Intergenic
1191971779 X:66825005-66825027 TGGTGGCCTCAACTCCACAATGG + Intergenic
1192134782 X:68586872-68586894 TGGTGCCATCAACCCTACCAGGG - Intergenic
1192927892 X:75776010-75776032 TGGTGGTTACAACACTCCAATGG + Intergenic
1197567911 X:128111257-128111279 TGTTGGTCACAACACTCCAATGG - Intergenic
1198158017 X:133981938-133981960 TGGGAGTTGCAACACTACCACGG + Intronic
1199707088 X:150437122-150437144 TGCTGGTCACAACACTGCAATGG + Intronic