ID: 934872945

View in Genome Browser
Species Human (GRCh38)
Location 2:97884723-97884745
Sequence GTAAGTAATGCTACTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934872942_934872945 28 Left 934872942 2:97884672-97884694 CCTTCTTTGTTGCTTTTTATAGC 0: 1
1: 2
2: 25
3: 197
4: 1005
Right 934872945 2:97884723-97884745 GTAAGTAATGCTACTCCTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934872945 Original CRISPR GTAAGTAATGCTACTCCTGC TGG Intronic
905856436 1:41317647-41317669 TTAAGTGATGCTACTGCTGTCGG + Intergenic
907846635 1:58214373-58214395 GTAAGTACTGATATTCCTTCAGG - Intronic
910434767 1:87194437-87194459 GTAAGAAATGCTACACAGGCAGG + Intergenic
910733415 1:90423822-90423844 ATGAGTATAGCTACTCCTGCTGG - Intergenic
1066565488 10:36717590-36717612 GTGAATAATGCTCCTCCTGGAGG + Intergenic
1067131580 10:43570151-43570173 GTAAGTCATGTCACTCCTGCAGG - Intronic
1068009294 10:51427700-51427722 GTAGGTAATACTAATGCTGCTGG - Intronic
1068069476 10:52178798-52178820 GTAACTATAGCTACTCCTGTTGG + Intronic
1074202662 10:111252665-111252687 ATAAGTATAGCTACTACTGCTGG + Intergenic
1079533938 11:21487865-21487887 ATAAGTATAGCTACTCCTCCCGG - Intronic
1080344637 11:31310871-31310893 GTAAATAAAACCACTCCTGCAGG + Intronic
1092650038 12:10624832-10624854 GGAACAAATGCTTCTCCTGCAGG + Exonic
1093266763 12:17013147-17013169 ATAAGAATAGCTACTCCTGCTGG + Intergenic
1098797381 12:74907872-74907894 GCAAGTAATGCCAGTGCTGCTGG + Intergenic
1100474777 12:94925215-94925237 TTAACTAATGCTAATCCTGCAGG + Intronic
1104518558 12:129451422-129451444 GTAACTAATGCTCATTCTGCAGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106885376 13:34179096-34179118 ATGAGTAATGCTCTTCCTGCTGG + Intergenic
1107701870 13:43056816-43056838 GTAAGAACAGCCACTCCTGCTGG + Intronic
1115799427 14:36975924-36975946 GTAAGCAGTGCTACTGTTGCGGG + Intronic
1117795162 14:59385889-59385911 GTAAGTATAGCAACTACTGCTGG + Intergenic
1120004478 14:79341419-79341441 GTAGGTGCTGCTACTGCTGCTGG - Intronic
1120246636 14:82013984-82014006 ATAAGAATAGCTACTCCTGCTGG - Intergenic
1122059137 14:99124900-99124922 GGAAGTGCTGCTCCTCCTGCTGG - Intergenic
1123793812 15:23751633-23751655 CTAAGTATAGCTATTCCTGCTGG + Intergenic
1124635942 15:31365369-31365391 GGAAGAAATGCAACTCCTACCGG - Intronic
1130094569 15:80846327-80846349 GTCAGTAATGCTTGTCTTGCAGG + Intronic
1131411802 15:92213664-92213686 GTTAGGAATGCTACTGCTACAGG + Intergenic
1133683797 16:8146796-8146818 ATAAGAAATGCTATTCCTCCAGG + Intergenic
1147843588 17:43389553-43389575 GTCAGTCATGCTCCCCCTGCAGG + Intergenic
1150191873 17:63250796-63250818 GTAAGTAATGTTACCCAGGCTGG + Intronic
1150193885 17:63273785-63273807 CTAGATAATGCCACTCCTGCTGG - Intronic
1158470576 18:57732849-57732871 GTAAGAAATTCAACTCCGGCCGG - Intronic
1165084434 19:33333801-33333823 GTAGGCTATGCTAGTCCTGCAGG + Intergenic
1166552756 19:43677380-43677402 GTAAGAAATGCAGCTCCTGCTGG + Intergenic
1168443832 19:56394616-56394638 TAAAATAATGCTACTGCTGCTGG + Intergenic
928022790 2:27716541-27716563 GAAAGGAATGCTCTTCCTGCGGG - Intergenic
933433278 2:82212853-82212875 GTAAGAATAGCTACTCTTGCTGG + Intergenic
934872945 2:97884723-97884745 GTAAGTAATGCTACTCCTGCTGG + Intronic
938598052 2:132809572-132809594 CTAAGAATAGCTACTCCTGCTGG + Intronic
938960397 2:136335630-136335652 GTAAGTCCTGCTAGTGCTGCTGG - Intergenic
939406690 2:141767534-141767556 GAAAGTACTGCAACTCCTGAGGG - Intronic
940235024 2:151501708-151501730 ATAAGTCAAGCCACTCCTGCCGG - Intronic
941907405 2:170730246-170730268 GGAAGTAATGCGTCTCCTTCAGG - Intergenic
943053328 2:182944076-182944098 CAAAGTAATGCTTCTTCTGCTGG + Intronic
944732344 2:202529546-202529568 GTAAGAAATGCAGCTCTTGCAGG + Intronic
1170029072 20:11925286-11925308 GACAGTAATGGTCCTCCTGCTGG + Exonic
1173784747 20:45784443-45784465 GTGAGAAATTGTACTCCTGCTGG + Intronic
1177834605 21:26174242-26174264 GTAAGTTATGGCACCCCTGCAGG - Intergenic
1185352792 22:50346663-50346685 GCAAGTCATGCTCCTCCTGTCGG + Intronic
949934690 3:9107614-9107636 CTAAGTGATGCTGCTGCTGCTGG - Intronic
952583321 3:34861478-34861500 GTAAGTAAAGCTTCTGCAGCAGG - Intergenic
952858483 3:37792886-37792908 GTAAGGAATGCTTATCCTGGAGG + Intronic
955785644 3:62535836-62535858 GGAAATATTGATACTCCTGCTGG + Intronic
957339250 3:78872268-78872290 GTAAGTAGGGCCACTCCTGGGGG + Intronic
960192715 3:114726570-114726592 CTAGGTAATGCTAATGCTGCTGG + Intronic
961526475 3:127503058-127503080 GTAAGTAATTTTTCTCTTGCTGG - Intergenic
961852533 3:129835770-129835792 GTAACTAATGTTACTCCAGAGGG + Intronic
963056145 3:141188017-141188039 CTGAGTAATGCTTCTGCTGCAGG + Intergenic
964920995 3:161895664-161895686 TCAAGTGATGCTGCTCCTGCTGG + Intergenic
970216298 4:13762298-13762320 GTGAGTAATGCAACCCTTGCTGG - Intergenic
978607562 4:110498371-110498393 GTAAATGGTGCTACTTCTGCGGG + Intronic
981640955 4:146943319-146943341 GTAAGTACTGCAAGCCCTGCTGG + Intronic
983591316 4:169414644-169414666 GTAAGTAATTCTGCTGCTGGTGG - Intronic
985823551 5:2177382-2177404 GGAAGTAATGCTACTCCCTGAGG - Intergenic
987360318 5:17100445-17100467 GTCAGCAGTGCTACTCCTGGTGG + Intronic
987747370 5:21993548-21993570 GTAGGTAGTTCAACTCCTGCAGG - Intronic
991767543 5:70003341-70003363 GTAGGTAGTTCAACTCCTGCAGG - Intergenic
991846777 5:70878417-70878439 GTAGGTAGTTCAACTCCTGCAGG - Intergenic
992685539 5:79195829-79195851 GGAAGTATTGCTAATCCTTCAGG + Intronic
999569702 5:152905792-152905814 CTAAGTGATGATACTGCTGCTGG - Intergenic
1005710373 6:28498621-28498643 TCAAGTGATGCTACTGCTGCTGG + Intergenic
1009399383 6:63236457-63236479 GTAATTAATGCCACTGCTGACGG + Intergenic
1011677288 6:89747158-89747180 GTAAGTGATCTTATTCCTGCAGG - Intronic
1018257606 6:161937698-161937720 ATAATTAATTCTTCTCCTGCTGG - Intronic
1019054444 6:169213425-169213447 GTAGGTCCTGCTACTGCTGCAGG + Intergenic
1020638431 7:10725411-10725433 GCAATTAATGCTATTCCTGTGGG - Intergenic
1028447695 7:90943940-90943962 GGAATTAATGCTGCTCTTGCAGG + Intronic
1031386385 7:121157103-121157125 GTTAGTAATGCCAATCCTCCAGG - Intronic
1031519264 7:122743475-122743497 GTAAGTACTGAGACTCCTGATGG - Intronic
1033027024 7:137784307-137784329 ATAAGAATTGCTACTACTGCTGG - Intronic
1033353960 7:140584528-140584550 GTTACAAATGCTAGTCCTGCAGG + Intronic
1033407349 7:141083026-141083048 GTAAGTAATCCTAGGCCTTCAGG + Intronic
1042897041 8:73681811-73681833 GTAAGAATAGCTACTCCTGCTGG - Intronic
1043006814 8:74830095-74830117 GTAAGCAATGCCAATCCTTCAGG + Intronic
1044694913 8:94913225-94913247 GCATTTAATCCTACTCCTGCTGG - Intronic
1044790939 8:95846286-95846308 GAAAGAAAGGCTACTCCAGCTGG + Intergenic
1045848468 8:106664383-106664405 TTAAGTAATGCTGATGCTGCTGG + Intronic
1046068648 8:109223998-109224020 GCAAGTAATGAGACCCCTGCAGG - Intergenic
1048655589 8:136532098-136532120 GCAATTAATGCTACTACTACTGG + Intergenic
1051197543 9:14579208-14579230 GTAAGTATAGCTACTTTTGCTGG - Intergenic
1052360947 9:27556538-27556560 GTACGTAATGCTCTGCCTGCTGG - Intronic
1056803467 9:89710371-89710393 GTAAGTAATGTCACTACTGGAGG - Intergenic
1186370512 X:8941939-8941961 GTAAATAATGCTGCTCCTGCTGG + Intergenic
1187687098 X:21826581-21826603 CTGGGTAATGCCACTCCTGCTGG - Intergenic
1188517415 X:31002538-31002560 CCAAGTAATGCTAATGCTGCTGG - Intergenic
1190331562 X:49238948-49238970 GCAAGTAATGCCACTCCCCCTGG + Intronic
1193865330 X:86723925-86723947 ATAAATATAGCTACTCCTGCTGG + Intronic
1198298964 X:135315734-135315756 ATAAGCATAGCTACTCCTGCTGG + Intronic