ID: 934874290

View in Genome Browser
Species Human (GRCh38)
Location 2:97901177-97901199
Sequence ATGCTCATATATAGGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934874290 Original CRISPR ATGCTCATATATAGGACAGT GGG Intronic
901811645 1:11770405-11770427 ATGCTTATCTCTGGGACAGTGGG + Intronic
903088637 1:20888594-20888616 TTGCTCATATATAGCAGATTTGG - Intronic
906183560 1:43841699-43841721 ATGCTAATATCTAAGACAATAGG - Intronic
908392669 1:63697798-63697820 TAGCTCATATCTAGGACATTAGG - Intergenic
908490148 1:64635324-64635346 ATGCTCATCTAAATGACAGCTGG - Intronic
916628867 1:166590389-166590411 TTGCTGATATATAATACAGTTGG + Intergenic
919526205 1:198654662-198654684 ATTCTCTTATAAAGGACAGCAGG - Intronic
921807301 1:219470871-219470893 ATGTTCATCCATTGGACAGTTGG - Intergenic
923184615 1:231558875-231558897 ATGCCCAAATATAGGTCAGAAGG - Intronic
1066779565 10:38929222-38929244 ATGATAATATATCTGACAGTGGG - Intergenic
1068607536 10:59022664-59022686 ACGTTTATATATAGGACATTTGG - Intergenic
1069386664 10:67889324-67889346 CTGCTTATTTATAGCACAGTGGG + Intronic
1072910542 10:99497115-99497137 AGGCTCCTTTATAGCACAGTAGG + Intergenic
1073528756 10:104211637-104211659 ATTCTCACAGATAGGACGGTGGG - Intronic
1075130794 10:119737361-119737383 ATGATTATATATAGGTCACTGGG - Intronic
1082681763 11:56181937-56181959 CTGCTCAAATATAACACAGTGGG + Intergenic
1090661547 11:128885791-128885813 ATGCTCAGATCTGGGACAGAGGG - Intergenic
1091777292 12:3192735-3192757 ATGGTCATATAGAGGAAAGTTGG + Intronic
1092243231 12:6848405-6848427 ATGCTAGGATATAGGACATTGGG + Intronic
1093186051 12:16021113-16021135 GTGCTCATATATAAGACTGTGGG + Intronic
1095131893 12:38552621-38552643 ATGCTCATATTTAAGAATGTGGG + Intergenic
1095475470 12:42582978-42583000 ATGCACGTAAATAGGATAGTTGG + Intronic
1102587086 12:113931021-113931043 ATGCTCATTTGTAGGAAAATTGG + Intronic
1103020802 12:117532510-117532532 ATGCTGCTTTACAGGACAGTAGG - Intronic
1108028221 13:46200866-46200888 ATGCTAATATTTGGGAAAGTTGG - Intronic
1109226586 13:59703762-59703784 ATGCTAAGAGATAGGACATTTGG - Intronic
1109274826 13:60291740-60291762 ATGCTTCTATAAAGGACATTTGG - Intergenic
1109530455 13:63637048-63637070 TTTCTCATACATAAGACAGTGGG + Intergenic
1112630577 13:101157542-101157564 ATCCTCAATTATAGGAAAGTTGG + Intronic
1113157930 13:107346537-107346559 ATCCTCTTATATATGACAGATGG + Intronic
1113241069 13:108337715-108337737 ATGCTAATTTATAGGAGGGTTGG + Intergenic
1116937018 14:50751161-50751183 ATGCTGATGTGTAGGAGAGTAGG - Intronic
1123900805 15:24874731-24874753 AATCTCATAAATAGGAGAGTAGG + Intronic
1126302892 15:47219850-47219872 ATGGTCAGCTATAGGTCAGTTGG + Intronic
1140176301 16:72663959-72663981 ATGGTCATATACAGGAGAGGTGG + Intergenic
1149127303 17:53250993-53251015 ATGATCAAATTTAGGTCAGTGGG + Intergenic
929538812 2:42803901-42803923 TTGATCATATATACCACAGTTGG - Intergenic
930151418 2:48063851-48063873 ATACACCTATATAGAACAGTGGG - Intergenic
932007474 2:67941031-67941053 ATGCTCATATATGTGGCGGTTGG - Intergenic
932515234 2:72340260-72340282 ATCTACATATATAGGACATTTGG + Intronic
934874290 2:97901177-97901199 ATGCTCATATATAGGACAGTGGG + Intronic
937991905 2:127667911-127667933 ATACTCATATATAGAAAACTCGG + Intronic
939448045 2:142334886-142334908 ATGCTAATATCCAAGACAGTGGG - Intergenic
939605477 2:144249797-144249819 ATGCTCATATAAAGTTCAGTTGG - Intronic
940686956 2:156863738-156863760 ATACACATATATATGATAGTGGG + Intergenic
941724189 2:168843205-168843227 ATGCTCATAGCTAAGACAGAGGG - Intronic
942429181 2:175891741-175891763 ATGTTCATATATTAGACAATTGG - Intergenic
945337322 2:208607896-208607918 ATGGTCATAGATAGAACAGATGG + Intronic
946787229 2:223260269-223260291 TTTCTCTTATATAAGACAGTGGG - Intergenic
1169400557 20:5275703-5275725 ATGCACATATATATGAGAATTGG - Intergenic
1170004654 20:11652592-11652614 ATGATCAAAAATAGGACAGTGGG - Intergenic
1170618127 20:17970758-17970780 ACGCTAATAAGTAGGACAGTGGG - Intronic
1170639884 20:18142469-18142491 TTGATCAAATAAAGGACAGTGGG + Exonic
1173182863 20:40817784-40817806 AAGCTCATCCATAGGCCAGTTGG + Intergenic
1178051150 21:28748901-28748923 TTGCTCAAATATGGGTCAGTTGG - Intergenic
1178997259 21:37414641-37414663 AGGCTCATTTCTAAGACAGTTGG - Intronic
1179074731 21:38109462-38109484 AAGCTCAAATCTAGAACAGTAGG + Intronic
950879210 3:16308841-16308863 ATGCTCAAATATAGCAAAATAGG - Intronic
951579488 3:24146956-24146978 ATATTCAAATATAAGACAGTTGG + Intronic
953503211 3:43458142-43458164 AAGATTATATATAGCACAGTGGG - Intronic
953896544 3:46807549-46807571 ATGCTCATATATAGATAATTAGG - Intronic
957182428 3:76897086-76897108 GTGCTCATATATTGGACCATTGG - Intronic
957367266 3:79242521-79242543 ATTTTCACATATAGGAAAGTAGG + Intronic
957450861 3:80380136-80380158 ATGCTCATATATACTAATGTAGG - Intergenic
957638939 3:82824065-82824087 ATGCTCAAATATAGTCTAGTTGG + Intergenic
957883060 3:86247759-86247781 ATGCTGAGATATTGGTCAGTAGG - Intergenic
959902156 3:111673596-111673618 AGGCTCATATATAGATCTGTAGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964226374 3:154407997-154408019 ATGGCCAAATATAGGATAGTTGG + Intronic
964721506 3:159771583-159771605 ATCATCATAAATAGGAAAGTAGG - Intronic
964829058 3:160862774-160862796 ATGGTCATATTTAGGAGAGTAGG + Intronic
967418254 3:189243461-189243483 ATGCTCATAGCCAGGACAATAGG - Intronic
971711066 4:30113238-30113260 ATTCTCATATAGAGGAGAGCAGG + Intergenic
973940084 4:55898647-55898669 ATGCCCATATATAGAAGAGAGGG - Intronic
978749214 4:112228261-112228283 AAGTTCATTTATATGACAGTTGG - Intergenic
981213164 4:142132590-142132612 ATCCTCAGAAATAGGACAGAAGG - Intronic
987927522 5:24362230-24362252 ATGCTTTTACATAGGCCAGTTGG + Intergenic
994115942 5:96061443-96061465 CAGCTCACATATAGGACTGTAGG + Intergenic
994165315 5:96602109-96602131 ATTCTCATATATAGACCAGAGGG - Intronic
996094181 5:119381041-119381063 ATTCTGATATATAGTAAAGTTGG - Intronic
998744244 5:145238719-145238741 AGGTTCATTTATAGGATAGTGGG - Intergenic
1000697959 5:164412645-164412667 ATGCTCATATATTTGACATTGGG - Intergenic
1008324107 6:50155714-50155736 ATGTTGATATATAAAACAGTAGG - Intergenic
1008786352 6:55173695-55173717 ATGATCATATTTATGACACTTGG + Intronic
1009392532 6:63162032-63162054 TTGCTAATATATAGTACAGCTGG - Intergenic
1011868015 6:91855670-91855692 ATGCTCATTTATTGTACTGTGGG + Intergenic
1021601550 7:22369253-22369275 ATGCTCATATTTAGGAAGTTAGG - Intergenic
1022001075 7:26226729-26226751 ATGCTCATAGAAAGGACTCTTGG + Intergenic
1024116145 7:46195717-46195739 ATGCTCTTATATCCCACAGTTGG - Intergenic
1031240724 7:119235361-119235383 ATGATCACATAAAGCACAGTGGG - Intergenic
1032983772 7:137315072-137315094 ACGCTCATAGATAGGATAGAGGG + Intronic
1033590761 7:142806275-142806297 ATTCTCCTATATAGGACATTTGG - Intergenic
1037654842 8:20874012-20874034 ATGCTCATCTGTGGGACAATAGG + Intergenic
1038931454 8:32198089-32198111 ATGCTCATATTTATGCCAATTGG + Intronic
1039803381 8:40978992-40979014 CTGATCATTTATAGGAAAGTGGG + Intergenic
1043613514 8:82095094-82095116 ATGCTCAAATTGAGTACAGTAGG + Intergenic
1043832817 8:85010510-85010532 ATGCTCATAGATAGCACCGATGG + Intergenic
1044172538 8:89072674-89072696 TTGCTACTATATAGGAAAGTGGG - Intergenic
1044885730 8:96774953-96774975 TTTCTCATATACAGGAAAGTTGG + Intronic
1045643706 8:104280203-104280225 ATTCTTATTTATATGACAGTAGG + Intergenic
1054988963 9:71298909-71298931 ATTCTCTTATCTAGGAAAGTAGG - Intronic
1187524423 X:20041217-20041239 AGGCTCAGATATAAGACAGAGGG + Intronic
1188849740 X:35116949-35116971 GTGATCTTATATATGACAGTTGG + Intergenic
1190633162 X:52408866-52408888 AAAGTCACATATAGGACAGTTGG - Intergenic
1196881335 X:120200731-120200753 ATGCTCATATAGTGGAGAGTAGG + Intergenic