ID: 934874912

View in Genome Browser
Species Human (GRCh38)
Location 2:97908571-97908593
Sequence ATGAGCAAGGGGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 1, 2: 6, 3: 106, 4: 962}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934874905_934874912 -9 Left 934874905 2:97908557-97908579 CCTTCTTCACCAAAATGAGCAAG 0: 1
1: 0
2: 3
3: 20
4: 255
Right 934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG 0: 1
1: 1
2: 6
3: 106
4: 962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934874912 Original CRISPR ATGAGCAAGGGGAAAGAGGA GGG Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900377036 1:2359577-2359599 AGGAGCAAAGAGGAAGAGGAAGG + Intronic
900866179 1:5270142-5270164 GTTAGCAAGGGGTGAGAGGAGGG + Intergenic
901619151 1:10568118-10568140 ATAAGCAACGGAAAAGAAGAGGG - Intronic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903836659 1:26207860-26207882 ATTACCCAGGGGAAAGAAGAAGG + Intergenic
904054144 1:27659261-27659283 GGGAGCATGGGGAAAGAAGAGGG + Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904357158 1:29947779-29947801 ATGAGAAAAGGGGAAGAGGAAGG - Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904610119 1:31721190-31721212 ATGAGCCTGAGGAAGGAGGAGGG + Intergenic
904670492 1:32161256-32161278 TTGAGCCAGGGGAGAGAGGCAGG + Intronic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
905352118 1:37355089-37355111 AGGAGGGAGGGAAAAGAGGAAGG + Intergenic
905794034 1:40805427-40805449 ATGAGCAAGGGGAGAGTGGTGGG - Intronic
906268755 1:44457141-44457163 AGGAGGAAGAGGAGAGAGGAAGG - Intronic
906443168 1:45869020-45869042 ATGAGTCAGGGCAAAGAAGAGGG - Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906745969 1:48222444-48222466 ATGAGCAGGAGGAGAAAGGAGGG - Intergenic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
906968257 1:50481892-50481914 ATGAGCAAGGGGAGAGGGGTAGG + Intronic
907239644 1:53074430-53074452 GTGAGCAAGGAGAAAGAACAGGG + Intronic
907791222 1:57666737-57666759 ATAATCAAGGTGAAAGATGATGG - Intronic
907917059 1:58881062-58881084 ATTAGCAAGGGCAAGGAGAAGGG + Intergenic
908088018 1:60657474-60657496 AGTAACAAGGGAAAAGAGGAAGG + Intergenic
908313544 1:62909788-62909810 AAGGGAAGGGGGAAAGAGGAAGG + Intergenic
908397793 1:63742108-63742130 AGGAGGAAGGGGACAGGGGAGGG + Intergenic
908489254 1:64626631-64626653 ATGACCAATGTGCAAGAGGAGGG - Intronic
908511111 1:64850621-64850643 ATCAGCAAGGGTGAAGAGGATGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908776842 1:67648864-67648886 AGGAGCAAGGGAAAGCAGGAGGG - Intergenic
909724251 1:78815023-78815045 ATAATCCAGGGGAAAGATGATGG - Intergenic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
910161852 1:84280890-84280912 AAAAGAAAGGAGAAAGAGGAAGG - Intergenic
910220177 1:84881738-84881760 ATTGGAAAGGGGGAAGAGGAGGG + Intronic
910286116 1:85556128-85556150 AGGAGGAAGGGGAAAGGAGAAGG - Intronic
910969117 1:92836689-92836711 AAGTGCATGGGGAAAGAGGATGG - Intronic
911101944 1:94102253-94102275 ATGTGCCAGGGGATAGAAGAAGG + Intronic
911280114 1:95914511-95914533 AGGAGACAGGGGAAAGAGAAGGG + Intergenic
911316284 1:96360416-96360438 ATAAGGAAGGGAAAAAAGGAAGG + Intergenic
911402061 1:97387762-97387784 ATGTTCAAGGGGAAAAAAGAAGG + Intronic
911588620 1:99720085-99720107 TTGGGCTGGGGGAAAGAGGATGG + Intronic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
913322876 1:117601583-117601605 ATGAGAAAGGGGTACGAGGTTGG + Intergenic
913697462 1:121341425-121341447 ATGAAACAGGGCAAAGAGGATGG + Intronic
913939865 1:125091650-125091672 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
913940199 1:125096235-125096257 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
914140096 1:144938627-144938649 ATGAAACAGGGCAAAGAGGATGG - Intronic
914856426 1:151354764-151354786 GTGAGCAAGGGAAAAGAGTTTGG + Intergenic
914918626 1:151833065-151833087 ATGAGTAGTGAGAAAGAGGAGGG + Intergenic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
914960105 1:152197504-152197526 AGGGGGAAGGGGAAAAAGGAAGG - Intergenic
915895404 1:159807949-159807971 AAGAGAAAGAGGGAAGAGGAAGG + Intronic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916662207 1:166933103-166933125 GTTAGCAAGGAAAAAGAGGAAGG - Intronic
916781070 1:168030154-168030176 ATAAGAAAGGGGAAATAGCAGGG + Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917141403 1:171839568-171839590 AGGAGCACAGGGAAAGAAGAGGG - Intergenic
917214429 1:172663541-172663563 ATGAACAAAGGCACAGAGGAAGG + Intronic
917954897 1:180085097-180085119 AAGGGAAAGGGGAAAGGGGAAGG - Intronic
917975750 1:180236481-180236503 AGGAGCCGGGGGAAGGAGGATGG + Intronic
918045711 1:180939828-180939850 ATGAGAAAGGGGGAAGAGGCAGG - Intronic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918098033 1:181350414-181350436 AAGAGCAGGAGAAAAGAGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918992304 1:191712822-191712844 ATAAGGAAGGGGGAAGAAGAGGG + Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919782631 1:201230707-201230729 ATGAGCAAAGGCAAGGAGGTAGG + Intergenic
919841323 1:201611287-201611309 AAGAGCTTGGGGAAGGAGGATGG + Intergenic
920034671 1:203058231-203058253 AGGAGGTTGGGGAAAGAGGAAGG + Intronic
920186750 1:204164198-204164220 GTGAGCACTGGGTAAGAGGATGG - Intronic
920484796 1:206359757-206359779 ATGAAACAGGGCAAAGAGGATGG + Intronic
920841932 1:209562386-209562408 GGGAGCAAGGGGAAAAGGGAGGG + Intergenic
920903503 1:210136312-210136334 ATGAGTAAGGAGAAAGGGAACGG + Intronic
921004005 1:211075090-211075112 GTGAGCAAGGGGAGAGATGTAGG + Intronic
921019136 1:211220569-211220591 CTGAGCAAGTGGAAACATGAAGG - Intergenic
921185424 1:212665668-212665690 AGGAGCCCAGGGAAAGAGGAAGG - Intergenic
921394481 1:214654064-214654086 AGGAGGAGGGGGAATGAGGATGG - Intronic
921511749 1:216039984-216040006 GTGGGCAGGGGGAAAGAGGGAGG - Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922688539 1:227667415-227667437 ATCAGCAGGGGGAAAGAGCAAGG - Intronic
922894430 1:229089283-229089305 TTGAGGAGGGGGAGAGAGGAGGG + Intergenic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923272321 1:232368907-232368929 AAGAGGAAGGGGAAAGGAGAGGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
924761381 1:246990055-246990077 ATGAACGAGGGGAAAGGGAAGGG + Intronic
1063436804 10:6038678-6038700 AGAAGCAAGGAGGAAGAGGAGGG + Intronic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064044277 10:11997994-11998016 ATGAGCAAAGAGAAAGAGACAGG + Intronic
1064569775 10:16680600-16680622 AGGAGCAAGAGGAAAGGGAAGGG + Intronic
1064711494 10:18130805-18130827 ATGATCCAGGGGACAGTGGAGGG + Intergenic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065747908 10:28858715-28858737 TTGAGCAAGGAGCAAGATGAAGG - Intronic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066586910 10:36945678-36945700 ATGAGCACTGGGATAGGGGAGGG - Intergenic
1066704278 10:38160734-38160756 ATGAGCATGCAGAAAGAGGTGGG - Intergenic
1066986344 10:42471124-42471146 ATGAGCATGCAGAAAGAGGTGGG + Intergenic
1066991134 10:42515100-42515122 AGGAGCAAGGGCAAAGAGAGGGG - Intergenic
1067300037 10:45000075-45000097 TTGAGCAACTGGAAAGATGATGG + Exonic
1067409962 10:46055542-46055564 AGGAGGAAGGGGAAGGAGAAGGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1068041097 10:51825322-51825344 AGGAGAAAGGGGAAAGAGCTTGG - Intronic
1068217203 10:53998121-53998143 ATGGGCAAGAGAAAAGAGCATGG - Intronic
1068922270 10:62497312-62497334 ATACGCAAGTGGGAAGAGGAAGG - Intronic
1069058724 10:63871677-63871699 AAGAGTGAGAGGAAAGAGGATGG + Intergenic
1069177986 10:65318336-65318358 ATGAATAATGGGAAAGGGGAAGG + Intergenic
1069285893 10:66714935-66714957 AGGAGGAAGTGGAAAGAGAAGGG - Intronic
1069341177 10:67410352-67410374 AAGGGCAAGGGGTGAGAGGAGGG + Intronic
1069614980 10:69801378-69801400 AGAAGGAAGGGGAAAGAGGTTGG + Intergenic
1069837683 10:71319462-71319484 GAGAGCAAGGAGAGAGAGGAGGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070512467 10:77174000-77174022 AGTAGCAAGGGGAGAGGGGAAGG - Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070692384 10:78536768-78536790 ATGAGTATGGAGAAAGAAGAGGG - Intergenic
1070872460 10:79768620-79768642 AAGACCAAGGGTAAAGAAGAGGG + Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071639381 10:87290772-87290794 AAGACCAAGGGTAAAGAAGAGGG + Intergenic
1071655856 10:87447177-87447199 AAGACCAAGGGTAAAGAAGAGGG - Intergenic
1072265113 10:93719961-93719983 ATGAGCAAGAGGAAAGACCAAGG + Intergenic
1072548578 10:96459295-96459317 AAGAGCAAGGGCAATGAAGAAGG + Intronic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073053993 10:100687415-100687437 AGGAGGAAGGGAAAAGAGGCCGG - Intergenic
1073140100 10:101241634-101241656 AAGAGCAACGGGACAGAGGCAGG + Intergenic
1073287410 10:102397138-102397160 CTGACCAAGGGGAAAGATGTAGG + Intronic
1073735496 10:106341230-106341252 ATGGGCAAGGGGAAGGAGAGAGG - Intergenic
1074254019 10:111782440-111782462 ATGGGAAAGGGGACATAGGAAGG + Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1074759826 10:116658699-116658721 ATGAGCAAGGCCTAAGAGCAGGG + Intergenic
1074969007 10:118520337-118520359 AGGTGCCTGGGGAAAGAGGAGGG + Intergenic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076064618 10:127439592-127439614 GTCAGCAAGGGGCAAGGGGAAGG - Intronic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1077563034 11:3277302-3277324 AGGAACAGGGGGAAATAGGAAGG - Intergenic
1077568925 11:3323118-3323140 AGGAACAGGGGGAAATAGGAAGG - Intergenic
1078146240 11:8723478-8723500 TTGAGAGAAGGGAAAGAGGAGGG + Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078609792 11:12810273-12810295 TTAAGAATGGGGAAAGAGGAAGG - Intronic
1078729082 11:13959673-13959695 AGGAGAAAGGAGAAAGAAGAAGG + Intergenic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079809237 11:24974824-24974846 TTGAGCAAGGGGCAAGTGGTAGG + Intronic
1079996694 11:27303127-27303149 AGGATCAAGGGAAAAGAGGGAGG - Intergenic
1080144825 11:28968693-28968715 AAGAGTGAGGGGAAACAGGAAGG + Intergenic
1080633486 11:34103309-34103331 AGGATCAAGTGGAAAGAGAAAGG + Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1081226245 11:40526278-40526300 AGGAGCAAAGGGGAAGAGCAAGG + Intronic
1081341286 11:41930843-41930865 ATGAGCAATGGCAAAGTGCAGGG - Intergenic
1081488718 11:43550420-43550442 ATGAGCAAAGGCAGAGAGGAAGG + Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081719494 11:45277537-45277559 ATGAGGCTGGGGAAATAGGAAGG - Intronic
1081720066 11:45282146-45282168 TTGAGCAAGGAGAAAGAGCCAGG - Intronic
1081742910 11:45453462-45453484 AGGAGCATGGGGAAAGAGCTAGG + Intergenic
1081960633 11:47134056-47134078 GTGAGCAAGGAAAGAGAGGAGGG - Intronic
1082802886 11:57427215-57427237 GTGAGCAAGGGAAAAGAAGAAGG - Intronic
1083376197 11:62223938-62223960 ATAAGGAAGGGGGAAGGGGAAGG - Intergenic
1084389514 11:68865893-68865915 AGGAGGGAGGGGAAAGGGGAGGG - Intergenic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085901354 11:80703441-80703463 ATAAGCACTGGGACAGAGGAGGG + Intergenic
1085949063 11:81307545-81307567 AAGAGGAAGGGGAAACAGAAGGG - Intergenic
1086074858 11:82839738-82839760 GTGAGAAAGGGCAAAGGGGAAGG - Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087102904 11:94381958-94381980 AGGAGCAATGGGAAAGAGAGTGG - Intronic
1087587478 11:100140642-100140664 ATGAGTTAGAGGACAGAGGAGGG + Intronic
1087699618 11:101420900-101420922 AGGAGGAAGGGGAGAGAGGTGGG + Intergenic
1088047982 11:105476838-105476860 ATGAGGAAGGGGAAATCTGAAGG - Intergenic
1088430203 11:109750424-109750446 CTGAGGAAGGGGACAGAAGATGG - Intergenic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1088750835 11:112841108-112841130 ATGAGTAAGGGGTATGAGTAAGG + Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089162301 11:116448010-116448032 GGGAGAAAGGGGCAAGAGGAAGG - Intergenic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1090234393 11:125136561-125136583 AGGAGGAAGAGGATAGAGGAAGG - Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090678394 11:129027239-129027261 ATGAGCCAGGTGAGAGATGATGG - Intronic
1090703197 11:129314724-129314746 AAGAGGAAGGGGAAAGAGAGGGG - Intergenic
1091191721 11:133701273-133701295 AGGAGAAGAGGGAAAGAGGATGG - Intergenic
1091723150 12:2827733-2827755 AGGAGCAACGGCTAAGAGGAGGG - Intronic
1091877386 12:3947177-3947199 ATGAGCTAGGGGAGTCAGGAGGG - Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1092859911 12:12711429-12711451 ATGAGAAAGGGGAAAGAGAGTGG + Intergenic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093206826 12:16261236-16261258 ATGAGGAAGGGGAAATGAGAAGG - Intronic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1094307557 12:29037703-29037725 ATGAGAATGGGGAAAGCGGGAGG - Intergenic
1094365213 12:29672638-29672660 ATGAGGATGGGGTGAGAGGAGGG - Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1095927210 12:47591140-47591162 ATGAGCAAGGAGGAAAAGGAAGG + Intergenic
1096080989 12:48832387-48832409 CTGAGCCAGGGGAAACAGGGTGG - Intronic
1096283297 12:50275706-50275728 ATGAGCAAAGGCACAGAGGCAGG + Intronic
1096791734 12:54049187-54049209 ATGTGGAAGGGGAAAAATGAAGG - Intronic
1098078158 12:66755798-66755820 ATGAGAATGGGGAGAGAGCAGGG + Intronic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1098185379 12:67890820-67890842 GTGAGGATGGGGCAAGAGGAGGG + Intergenic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1098479746 12:70944328-70944350 ATATCCAAGGGGAGAGAGGATGG - Intergenic
1098859824 12:75695758-75695780 ATGAGCAAGGAGAAAGGAGAAGG + Intergenic
1099301118 12:80895740-80895762 AAAAGAAAGGGGAAAGAGGAAGG - Intronic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1099993510 12:89752393-89752415 ATGAGCAAGGGGACATGGAAAGG - Intergenic
1100042465 12:90336964-90336986 ATGAGGAAGGGAAACAAGGAAGG - Intergenic
1100242803 12:92726744-92726766 ATGGGCCAAGGGAAAGAAGAAGG + Intronic
1100782674 12:98046157-98046179 AGGAGCAAGGGAAAAGAGGTTGG + Intergenic
1100921660 12:99494884-99494906 AGGAGCAGGGAGCAAGAGGAAGG + Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101087224 12:101248805-101248827 ATGAGAATGTGGAAAGGGGAGGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101634196 12:106523729-106523751 ATGAGGGAGGGAGAAGAGGAAGG + Intronic
1102028861 12:109728571-109728593 CTGAGCAAAGGCACAGAGGAAGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102556049 12:113727295-113727317 AAGAGAGAGAGGAAAGAGGAAGG - Intergenic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1103059785 12:117849113-117849135 AGGAGAAAGGAGAAAGAGAACGG + Intronic
1104418165 12:128612813-128612835 ATGGACAAGGGAAAAGAGAAGGG - Intronic
1104546221 12:129715246-129715268 ATGAGCAGGAGGAGAGAGAAGGG + Intronic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1106043505 13:26116444-26116466 ATGAGCAAGGAGAAAAAAAATGG + Intergenic
1107812877 13:44217025-44217047 AGGAGCACAGGGGAAGAGGAAGG - Intergenic
1107855363 13:44610325-44610347 ATGAGAGAGAGGGAAGAGGAAGG + Intergenic
1108420859 13:50248153-50248175 GTGAGCAAGGGGGAAGAGGGTGG - Intronic
1109921137 13:69061220-69061242 AGGAGAAAGGAGGAAGAGGAGGG + Intergenic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110608282 13:77459696-77459718 ATGAGCAAGGTGTCAGAGGAAGG - Intergenic
1111375932 13:87379311-87379333 CTGATCAAGGGGGAAGAAGAGGG + Intergenic
1111624619 13:90768742-90768764 ATGTGCAAAGGTAAAGAGGCTGG - Intergenic
1111662315 13:91226433-91226455 ATGATCTAGGGGAAGGAGGGAGG + Intergenic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1112660828 13:101505753-101505775 ATTAGCAAGCAGGAAGAGGAAGG - Intronic
1113813336 13:113154972-113154994 GAGAGAAAGGGGAGAGAGGAAGG - Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114525823 14:23366319-23366341 AGGAGGGAGGGGAAAGGGGAGGG + Intergenic
1115962825 14:38854733-38854755 AGGAGCCAGGGGACAAAGGATGG - Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116289553 14:43015459-43015481 ATCAGCACAGTGAAAGAGGAAGG - Intergenic
1116780572 14:49232985-49233007 ATTAGAAGGGGGAAAGAGGGAGG - Intergenic
1117073338 14:52075792-52075814 ATGAGCACAGGAAAAGAGAAGGG + Intergenic
1117370883 14:55077470-55077492 GTGATAAAGGGGAAAGAGCATGG - Intergenic
1118012706 14:61626278-61626300 ATGAGTGAGAGGAGAGAGGATGG - Intronic
1118466191 14:66033340-66033362 ATGACCAAGAGCAAAGAGCATGG - Intergenic
1118731729 14:68671460-68671482 ATGAGCAAGGACAAAGAGCAGGG - Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1119125047 14:72117610-72117632 GTGAGGAAGGGAAGAGAGGAGGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119651190 14:76384672-76384694 AGGAGCAAGGGGAAACTGGGAGG - Intronic
1119660788 14:76450306-76450328 GTGAGCAAAGGCAAAGTGGAAGG + Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1119995184 14:79245876-79245898 AAGAAAAAAGGGAAAGAGGAAGG + Intronic
1120605941 14:86578045-86578067 AAGAACATGGGGAAAGAAGAGGG - Intergenic
1120645132 14:87064970-87064992 ATAATCATGGTGAAAGAGGAAGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121593309 14:95137321-95137343 AAGAGGAAAGGGAAAGGGGAAGG + Intronic
1121863378 14:97339957-97339979 ATGAGCCAAGGGAAAGGAGAAGG - Intergenic
1121936660 14:98025887-98025909 ATGAGCAAGGGGTAGAGGGATGG - Intergenic
1122206021 14:100148434-100148456 ATGAGAAAGGAGGAAGGGGAAGG - Intronic
1122281016 14:100622439-100622461 AGGAGGAGGGGGAAAGAGGAAGG - Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122589487 14:102836992-102837014 AAGAGCAAGGGGAGAATGGAAGG - Intronic
1122589491 14:102837005-102837027 ATGAGGAGGAGGAAAGAGCAAGG - Intronic
1123396224 15:19939793-19939815 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1124841302 15:33244545-33244567 ATGAGAAAGGGAAGAGAGAATGG + Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125604149 15:40930566-40930588 ATGAGCAAGCGGGGAGAGGTGGG - Intronic
1126867702 15:52954315-52954337 AGGAGGAAGGGGAAAGAGAGAGG - Intergenic
1126870577 15:52982716-52982738 AGGAAGAAGGGGAAAAAGGAAGG - Intergenic
1126951310 15:53884809-53884831 AGGAGTAAAGGGAAAGAGGGGGG - Intergenic
1127064863 15:55226383-55226405 AGGAGCAAAGGGAAAGGGGAGGG + Intronic
1127239670 15:57098861-57098883 ATTTGCAAGGTGAAAGAGGGAGG - Intronic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1128145854 15:65332163-65332185 ATGAGGAAGGGAACAGGGGATGG + Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128365307 15:66995817-66995839 ATGAGCATGGGGATAGAGATGGG - Intergenic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1128705122 15:69832599-69832621 AAGAGGAAGGGGAAAGGGAAGGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128835605 15:70806920-70806942 ATGAAGCATGGGAAAGAGGAGGG + Intergenic
1128916386 15:71566734-71566756 GGGAGCAGGGGGAAAGAGGGGGG - Intronic
1129362092 15:75030358-75030380 ATGAACAAGGGGAAAGGACAGGG - Intronic
1129389867 15:75215103-75215125 AGGAGCTAGGGGATACAGGAGGG - Intergenic
1129949047 15:79570104-79570126 AGGAGAAAGGGAAAAGAGGAAGG + Intergenic
1130068492 15:80626882-80626904 AAGAGAAAGAGGAAAGAGAAAGG - Intergenic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130338722 15:82980452-82980474 AGGAGCAAGGGGAAAGCGTTAGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130867714 15:87946631-87946653 ATGAGCCAGGGAAGAGGGGAGGG - Intronic
1130899782 15:88198668-88198690 CTGAGCATGGGGCACGAGGAGGG - Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1132070370 15:98771366-98771388 GTGAGGAAGGGGAGAGAGGGTGG - Intronic
1132471298 16:104904-104926 GTTAACAAGGGGAAAGAGAAAGG + Intronic
1132525305 16:411290-411312 ATGAGCTGGGGGAGAGGGGAGGG + Intronic
1133333141 16:4988588-4988610 AGGAGGGAGGGGAAAGAGGAGGG - Intronic
1133381087 16:5331079-5331101 AGGAGAAAGGGGAGAGAGGGAGG + Intergenic
1133381568 16:5335453-5335475 ATGTGCAATGGAGAAGAGGAAGG - Intergenic
1133381585 16:5335585-5335607 ATGTGCAATGGAGAAGAGGAAGG - Intergenic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1133819538 16:9224284-9224306 AAGAGAGAGGGGAAAGGGGAAGG - Intergenic
1133834940 16:9359506-9359528 GTGAGAAAGGTGAAACAGGAGGG - Intergenic
1133859677 16:9582569-9582591 AGTAGGAAGGGGAAAGAGAAAGG + Intergenic
1134074931 16:11284004-11284026 AGCAGGAAGGAGAAAGAGGAGGG + Intronic
1134360669 16:13528231-13528253 CTGAGCAAGGGGAAAGGTGAGGG - Intergenic
1134386847 16:13781300-13781322 AGGAGGAAGGGGGCAGAGGAAGG + Intergenic
1134820279 16:17241257-17241279 ATAAACAAGGGGAGAGAGGGAGG + Intronic
1134908540 16:18003280-18003302 ATGAGATAGGGGAAAGAAAAAGG - Intergenic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135624231 16:23981652-23981674 AAGAGAAAGGGAAAAAAGGAAGG - Intronic
1135675155 16:24408783-24408805 AGGAGAAAGAGGAGAGAGGAGGG + Intergenic
1135785549 16:25345672-25345694 ATGAGTATGGTGAAAGAAGAGGG + Intergenic
1136028919 16:27488772-27488794 ATGAGCAATGGTAAAGCGGGTGG - Intronic
1136234154 16:28904159-28904181 ATCTGGAAGGGGAAAGAGAAGGG - Exonic
1136402442 16:30025885-30025907 GTGACAGAGGGGAAAGAGGAAGG - Intronic
1136566649 16:31074498-31074520 AGGAGAAGGGGGGAAGAGGAAGG - Exonic
1136698368 16:32107364-32107386 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1136698695 16:32111945-32111967 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1136768909 16:32815884-32815906 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1136769234 16:32820468-32820490 ACCTGCAAGGCGAAAGAGGACGG + Intergenic
1136798872 16:33050661-33050683 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1136799198 16:33055241-33055263 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1137004285 16:35258450-35258472 ATGAGCAAGGGGAATGCTGATGG - Intergenic
1137027218 16:35489058-35489080 ATGAGCAAGGGGACGGCTGATGG - Intergenic
1137392262 16:48091593-48091615 TTGAGCAAGGGGCTAGGGGAGGG - Intronic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1138225116 16:55287585-55287607 AAGAGAAAGGGAAAAGAAGAGGG + Intergenic
1138242221 16:55436276-55436298 ATGGGCCAGAGGAGAGAGGAGGG + Intronic
1139148304 16:64349166-64349188 ATGAGGAATGGGGAAGAGAATGG + Intergenic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140242221 16:73213430-73213452 ATGTGCAAGGAGAAAGAGATCGG + Intergenic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140328251 16:74026958-74026980 ATGAGTAAGGGAAGAGAGGAAGG + Intergenic
1140572021 16:76118699-76118721 ATGAGCCAAGGGAAAAAAGATGG - Intergenic
1140781928 16:78304925-78304947 AGGAAGAAGGGAAAAGAGGAAGG - Intronic
1140845215 16:78880613-78880635 AGGAGCAAAGGGAATGAAGATGG - Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1203071326 16_KI270728v1_random:1077995-1078017 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1203071651 16_KI270728v1_random:1082575-1082597 ACCTGCAAGGCGAAAGAGGACGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142794903 17:2300092-2300114 AGGAGAAAAAGGAAAGAGGATGG - Exonic
1142985890 17:3695267-3695289 ATGAGGATGGGGGAAGGGGATGG + Intronic
1143304846 17:5938176-5938198 ATAAGCGAGGGGAATTAGGAAGG + Intronic
1143463212 17:7117297-7117319 ATTAGTGAGGGGAAACAGGATGG - Intergenic
1143470069 17:7167954-7167976 AAGAGAAAGGGGAAAAGGGAAGG - Intergenic
1143621272 17:8081374-8081396 TAGAGCAAGAGGAAAGAGGGTGG - Exonic
1143666670 17:8366168-8366190 ATGGGCACGGGGAAGGAGAAAGG - Intergenic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1144212320 17:13025916-13025938 AAGAGAAAGGAAAAAGAGGAAGG - Intergenic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144507356 17:15843858-15843880 ATGAGCAAAGGCACAGAGGCAGG + Intergenic
1145035322 17:19536719-19536741 ATGAGCATGGGAAAAGAAGGGGG - Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145092605 17:19998395-19998417 GTGAGCAAGGGGAAAGAAGTGGG + Intergenic
1145119252 17:20241878-20241900 ATGAGCAAAGGCACAGAGGCAGG + Intronic
1145171481 17:20661463-20661485 ATGAGCAAAGGCACAGAGGCAGG + Intergenic
1145201802 17:20952207-20952229 ATGAGCAAAGGCACAGAGGCAGG + Intergenic
1145240856 17:21240505-21240527 ATGAGCTTGGAGAATGAGGAAGG + Exonic
1145293227 17:21566702-21566724 ATGCTGGAGGGGAAAGAGGAAGG + Intronic
1145416086 17:22715102-22715124 ACAAGCATGGGGAGAGAGGAAGG - Intergenic
1145692848 17:26762195-26762217 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1145722699 17:27088539-27088561 ATGAGGAGGAGGAAAGAGGGTGG - Intergenic
1146165187 17:30582944-30582966 GTGAGCAAGGGGAAAGGAGTGGG + Intergenic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146561107 17:33871425-33871447 ATGAGCAGGGAGAAGGAGGTGGG - Intronic
1146680699 17:34805670-34805692 ATGAGCAAAGGGATAGTGGTGGG + Intergenic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147308214 17:39578238-39578260 AAGAGCAAAGGGAAATAGGTGGG - Intergenic
1147309259 17:39584744-39584766 ATGAGCAAGGGGAAGATTGAAGG + Intergenic
1147318650 17:39633058-39633080 AGGAGCAAGGGGTTAGAGAAAGG - Intronic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1147773838 17:42886474-42886496 AGAAGGAAGAGGAAAGAGGAAGG - Intergenic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148899964 17:50867665-50867687 AGGGGAAAGGGGAAAGGGGAAGG - Intronic
1148922994 17:51055655-51055677 ACTAGCAAGGGGAAAGAGAGAGG + Intronic
1149335554 17:55632520-55632542 ATGAGCTAGGGAGAAGAGGGAGG + Intergenic
1149795406 17:59514501-59514523 CTGTGCTAGGGGAAAGATGATGG - Intergenic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150451324 17:65271244-65271266 AGGGGAGAGGGGAAAGAGGAGGG + Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150859948 17:68790936-68790958 ATGAGAAACTGGAAAGGGGAAGG + Intergenic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1151773056 17:76177507-76177529 ATGAGCATGAGGGAAGGGGAAGG + Intronic
1152279494 17:79376902-79376924 CTGAGCAAGGGAGAAGAGAATGG - Intronic
1152978776 18:252148-252170 AAGAGCAAGGGGAGAGAAGGAGG + Intronic
1153563290 18:6393933-6393955 GTGAGCAAGGGGAGAGCGGAAGG - Intronic
1153585495 18:6616149-6616171 ATGTGCAAAGAGACAGAGGAGGG + Intergenic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154450377 18:14470857-14470879 ATGAGCAATAAGACAGAGGATGG + Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155015615 18:21835850-21835872 AGGAGTATTGGGAAAGAGGAGGG + Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155269710 18:24128000-24128022 CTGAGCAAGGGAGAAGAGCAGGG - Intronic
1156566918 18:38202148-38202170 AAGAGCAAAGGGAAAGTGGTGGG - Intergenic
1157276073 18:46311909-46311931 AGGAGGAAGGGGATAGAGGCTGG + Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157470281 18:47983160-47983182 AGGAGGAAGGGGAAAGGGGAAGG - Intergenic
1157509564 18:48260968-48260990 ATGAGCAAGGGCAAAATGAAGGG + Intronic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158627461 18:59083789-59083811 ATGAGCACGGGGAAAGAAAGGGG + Intergenic
1158664513 18:59420529-59420551 ATGACCATGGGGAAGGAGAAAGG - Intergenic
1159035336 18:63271944-63271966 TTGAGCAAGGGGGAAGCAGAAGG - Intronic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159682498 18:71372353-71372375 ATGAGTAAGGGGGATGAGGGTGG - Intergenic
1159919064 18:74211645-74211667 AGGAGCCAGGGGAAAGGGGCTGG + Intergenic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159952085 18:74492033-74492055 CTGAGCAATGGCCAAGAGGATGG + Intergenic
1160544759 18:79645498-79645520 ATGAGCAAGGCGGGAGGGGAAGG + Intergenic
1160591208 18:79945592-79945614 ATGGGCCCGGGGATAGAGGACGG + Intronic
1160912509 19:1481504-1481526 AAAAGCCAGGGGAAAGTGGAGGG - Exonic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161274908 19:3410522-3410544 GTGAGGAAGGGGAGACAGGAAGG + Intronic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1162059989 19:8088779-8088801 ATGAGCAAGGAGACAAATGAAGG + Intronic
1162303379 19:9856923-9856945 AGGAACAGGGGGAATGAGGATGG + Intronic
1163038180 19:14583625-14583647 GTGAGCAGGGTGAGAGAGGAGGG + Intronic
1163038867 19:14587882-14587904 GTGAGCAGGGTGAGAGAGGAGGG + Intronic
1163052128 19:14692451-14692473 ATGAGCCAGGTGAGAGAGGGAGG + Intronic
1163602145 19:18255589-18255611 AGGAGCAGGGGGAAAGAGGACGG - Intergenic
1164441908 19:28285163-28285185 AGGATGGAGGGGAAAGAGGATGG + Intergenic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164912869 19:32026649-32026671 ATGGGCAACAGGAAAGAGCAAGG - Intergenic
1164916102 19:32053394-32053416 AAGAGCAAGGGAAGAGATGAAGG + Intergenic
1165956887 19:39506704-39506726 AGGAGGAAGGGAAGAGAGGAGGG + Intronic
1166690345 19:44818677-44818699 AGGAGTGAGGGGAGAGAGGAGGG - Intronic
1166727540 19:45037872-45037894 ATGAGGAAGGGCCAAGGGGATGG - Exonic
1166911343 19:46160481-46160503 ATGGGCAAGAGTGAAGAGGAAGG + Intronic
1167095896 19:47375036-47375058 ACGACCAAGTGGAGAGAGGAGGG - Intronic
1167154734 19:47731036-47731058 GAGAGGAAGGGGTAAGAGGAAGG + Intronic
1167284576 19:48591792-48591814 ATGGGCAGAGGGACAGAGGAGGG + Intronic
1167608166 19:50492792-50492814 AAGAGGAGGAGGAAAGAGGAAGG + Intergenic
1167679036 19:50908336-50908358 GTGAGAGAGGGGAAAGGGGAGGG - Intronic
1167742752 19:51334168-51334190 GTGAGCAAGGGGACTGGGGAAGG - Intronic
1167746176 19:51353094-51353116 ATGAGCAAGGGGGCACAGGGAGG + Intronic
1167852336 19:52211681-52211703 GTGAGCAAGGGGGCAGAGGTGGG - Intronic
1168239419 19:55081755-55081777 ATGTCCTAGGGGACAGAGGAGGG - Exonic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1202672185 1_KI270709v1_random:65709-65731 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925130154 2:1488785-1488807 AAGGGCCAGGGGACAGAGGAAGG - Intronic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925498730 2:4481122-4481144 ATAAGGAAGGGGCAAGGGGAAGG + Intergenic
925971518 2:9109937-9109959 ATGAGCAAAGGGAATGAGTCTGG + Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926204583 2:10826825-10826847 ATGAACAGAGGGAAAGAGGGAGG - Intronic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926689800 2:15725408-15725430 ATGAGCCAGGAGACGGAGGAAGG - Intronic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
926772673 2:16392368-16392390 ATGGACAAGGGGAAAGCAGAGGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927068679 2:19501712-19501734 AGGAGCAAGTGCAAAGGGGAAGG - Intergenic
927208838 2:20626531-20626553 ATGAGGAAGGTGATATAGGATGG + Intronic
927250262 2:20990184-20990206 AAGAGGAAAGGGAAAGAGGATGG - Intergenic
927438469 2:23090646-23090668 GAGAGAAAGAGGAAAGAGGAGGG + Intergenic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927842255 2:26453252-26453274 ATGAGCATGGAGAGAGAGGCAGG - Intronic
927878275 2:26673354-26673376 ATGCACAAGGGGGAAGAGTATGG + Intergenic
927888974 2:26736482-26736504 TTGAACAAGGGCAAAGAGCATGG - Intergenic
927984228 2:27396392-27396414 ATGAGCTGGGGGAAAGAGAATGG + Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
929139792 2:38656805-38656827 ATAAGAAAGGGGACAGGGGAGGG - Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929582106 2:43087931-43087953 ATGGGCAAGGCAGAAGAGGAGGG + Intergenic
929868548 2:45738393-45738415 ATGAGCAAAGGCAGAGAGGAAGG - Intronic
929967764 2:46548377-46548399 ATGAGAAAAGGGAAGGAGAAAGG + Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930763109 2:55057664-55057686 TTGAGAAAGCGAAAAGAGGATGG + Intronic
931362562 2:61590443-61590465 AAGAGAAAGAGGAAAGAAGAAGG + Intergenic
931492731 2:62767043-62767065 ATGAGGGAGAGGTAAGAGGAAGG + Intronic
931505477 2:62921862-62921884 ATGAGCTAGAGAAAAGAAGATGG + Intronic
932285180 2:70525606-70525628 AGAAGCAAGGGGCAGGAGGAGGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
933143111 2:78817915-78817937 ATGAGGAAGGATAAAGAGCATGG + Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934097562 2:88620664-88620686 GTGAGCAAGGGCACAGAGCAGGG - Intronic
934105312 2:88690211-88690233 ATGCGCAAAGTGATAGAGGAGGG + Intergenic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934571102 2:95373970-95373992 CTGAACAAGGGGATATAGGAGGG - Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935063277 2:99626500-99626522 AAGAGGAAGGGGAAAGGGAAGGG - Intronic
935199140 2:100840781-100840803 ATGTGCGAAGGGAAAGAGCAAGG + Intronic
935490148 2:103709499-103709521 AAAAGGAAGGGGAAAGGGGAAGG + Intergenic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
936064729 2:109322106-109322128 ATGAGGAAAGGGAAAAAGAAGGG + Intronic
936068328 2:109348738-109348760 AGGAGGAAGGGGAAGCAGGAGGG - Intronic
936472485 2:112811503-112811525 AGAAGGGAGGGGAAAGAGGAAGG + Intergenic
936667035 2:114608883-114608905 ACTAGAAAGGGGAGAGAGGAAGG + Intronic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
937899561 2:127007927-127007949 AGGAGGAAAGGGAAAGAGAAGGG + Intergenic
937998848 2:127715952-127715974 AAGAGAAAAGGGAAAGAGCAAGG + Intronic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938588524 2:132715184-132715206 ATGTGCAAGAGGAAAAAGCAAGG - Intronic
939179113 2:138783369-138783391 ATGAGCAAAGGCAGAGTGGAGGG + Intergenic
939500266 2:142975334-142975356 ATGAGGAACTGGAAAGGGGATGG - Intronic
939563538 2:143759604-143759626 GGGAGCAAAGGGAAAGAGGTAGG - Intronic
939656704 2:144835273-144835295 AGGAGCAGGGGGAGAGAGCACGG - Intergenic
939657632 2:144847721-144847743 GAGAGGGAGGGGAAAGAGGAGGG + Intergenic
940275906 2:151940382-151940404 ATGAGCAAAGGTAAAAAGGCAGG + Intronic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940797771 2:158098616-158098638 ATGAGCAAGGAGCAAGAGAAGGG - Intronic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941558619 2:167016178-167016200 AGGAGGAAGGAGAAAAAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942777010 2:179593982-179594004 ATGAGAAAGGGAATAGGGGAGGG + Intronic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
943291634 2:186079454-186079476 ATGAGAACCTGGAAAGAGGATGG + Intergenic
943442669 2:187945158-187945180 TTGAGCAAGTGGGGAGAGGATGG - Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943953865 2:194161848-194161870 AAGATCAAGGGGAAGCAGGAGGG - Intergenic
944036356 2:195298989-195299011 AAGAGGAGTGGGAAAGAGGAAGG - Intergenic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
944593895 2:201244420-201244442 ATGAGCCAGGGTACAGAGGAGGG - Intronic
944848712 2:203695111-203695133 AGGCCCCAGGGGAAAGAGGAGGG + Intergenic
945068802 2:205970616-205970638 ATGAGAAAGAGAGAAGAGGACGG - Intergenic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946393565 2:219431285-219431307 GGGAGCAAGGGGAGAGTGGAAGG - Intergenic
946525963 2:220520726-220520748 AGGAGGAATGGGAAAGATGAAGG + Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947298077 2:228655503-228655525 ATAAGCAAGGAGAGAGAGCAAGG - Intergenic
947368060 2:229416935-229416957 AGGAGCAAGGGGAAAGAAGGAGG + Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
948091959 2:235302248-235302270 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948498407 2:238370805-238370827 AAGAGAAAGGGGGAAGTGGAAGG + Intronic
948632246 2:239309746-239309768 ATGAGCGAAGGGGAAGGGGATGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168838089 20:891131-891153 ATGAAAAAGGGGAAACAGCAAGG + Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168961878 20:1875645-1875667 ATGAGCAAAGGTAAGGAGGGAGG - Intergenic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169880279 20:10340153-10340175 AGGAGCAAGGGGTAAGCGGGAGG + Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170126610 20:12970759-12970781 CTGAGGAAGGGGAGAAAGGATGG - Intergenic
1170349364 20:15422094-15422116 AGGAGCAAGGAAAAAGTGGAAGG + Intronic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1171107033 20:22444026-22444048 ATGAGAGAAAGGAAAGAGGAGGG - Intergenic
1171161384 20:22927275-22927297 AGGAGGAAGGGGAGAGAGGTTGG - Intergenic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1171880049 20:30611718-30611740 AGGATCAGGGGGAACGAGGAGGG - Intergenic
1172835005 20:37867867-37867889 ATGAGCAAGGGCAAAGGGTGAGG + Intronic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1173349541 20:42232560-42232582 ATGAGGAAGAGGAAACAGAAAGG - Intronic
1173853045 20:46231017-46231039 AGGAGCAGGGGGGCAGAGGAGGG + Intronic
1173871450 20:46344566-46344588 GTGCACATGGGGAAAGAGGAGGG - Intergenic
1174149717 20:48477610-48477632 GAGGGCGAGGGGAAAGAGGAAGG + Intergenic
1174219506 20:48942139-48942161 ATGAGGGAGGGAAAAGAGAAAGG + Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1174502430 20:50995508-50995530 AGGAGAAAGGGGGAAGTGGATGG + Intergenic
1174835392 20:53852073-53852095 AGGAAGAAGGGGAAAAAGGACGG - Intergenic
1174934965 20:54857297-54857319 AGGAGCAAGGGGGAAGCCGATGG - Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1178319172 21:31591877-31591899 AAGAGTAAGGGGACAGAGAAGGG + Intergenic
1178712870 21:34934913-34934935 ATGAAAAAGGGGAAAAATGAAGG - Intronic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1179646941 21:42781980-42782002 AGGAGGAAGGGGAGAGGGGAGGG - Intergenic
1179769862 21:43606423-43606445 GTGAGCAGGAGGAAAGAGGAGGG + Intronic
1179812990 21:43884270-43884292 AGGAGGAGGGGGAAGGAGGAGGG - Intronic
1181030013 22:20145163-20145185 ACGAACACGGGGACAGAGGACGG - Intronic
1181092921 22:20486524-20486546 ATGGGCAAGGGTAGAGAGAAGGG - Intronic
1181266075 22:21631758-21631780 CTGAGCAAAGGGGAAAAGGAGGG + Intergenic
1181513250 22:23398150-23398172 ACGAACACGGGGACAGAGGACGG + Intergenic
1181928495 22:26379561-26379583 AGGAGCAAGGAGATAGAAGAAGG - Intronic
1182024117 22:27104095-27104117 ATCAGGAAGGGGAAACAGGAGGG + Intergenic
1182732865 22:32509396-32509418 ATGGGAAAGGGCAAAAAGGAGGG - Intergenic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1182965192 22:34514869-34514891 GGGAGCAATGGGAAAGAGAAAGG + Intergenic
1183102569 22:35592987-35593009 ATCAGAAATGGGAAAGAGGGAGG + Intergenic
1183481102 22:38066005-38066027 AGGATAAAGGGGAGAGAGGATGG - Intronic
1183929518 22:41228010-41228032 AAGGGCAAGGGGAAAGAGACAGG - Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
949431864 3:3985429-3985451 AGGAGCATGGGGAAGGAGTATGG - Intronic
949689994 3:6625335-6625357 ATCAGAAATGGGAAAAAGGAAGG + Intergenic
950456992 3:13098635-13098657 CTGAGCTAGGGGAAAATGGATGG + Intergenic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
950545897 3:13637725-13637747 ATCATCAAGGGCAATGAGGAGGG + Exonic
951289077 3:20853888-20853910 ATGAGAAAGGGGAAAGAAACTGG - Intergenic
951333650 3:21395023-21395045 AGGTGCAAGGGGAAAAAGGGAGG - Intergenic
951407137 3:22314921-22314943 ATGATCAAGGGGAAAATGAATGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951641805 3:24844816-24844838 GGGAGCAGGGAGAAAGAGGAGGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951853342 3:27167891-27167913 ATGAGCAAATGGAACTAGGAGGG - Intronic
951908040 3:27722554-27722576 AGGAGCAAGAGGTACGAGGAAGG - Intronic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
952751340 3:36827302-36827324 TGGAGCAAGTGGACAGAGGAGGG - Exonic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
952926866 3:38326663-38326685 AGGAGAAAGGAGGAAGAGGAGGG - Intergenic
952936254 3:38400525-38400547 GTGAACGAGGGGAGAGAGGAGGG + Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953383569 3:42492221-42492243 AGGAGGAAGAGAAAAGAGGAAGG - Intronic
953463176 3:43097494-43097516 GTGAGCAAGGGGGAAAGGGAGGG + Intronic
953544929 3:43857450-43857472 ATGAGCAAAGGTGTAGAGGAAGG + Intergenic
954021004 3:47741555-47741577 AGGAGTAAGGGAAAAGAGAAAGG - Intronic
954422481 3:50425984-50426006 ATGAGCAAGGGCCTAGAGGCAGG - Intronic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954976412 3:54699290-54699312 AGGAGCAAGGGGGAAGGGGCTGG + Intronic
955015835 3:55067932-55067954 AGAAGCAAGGGGAAAGAGGACGG + Intronic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956474701 3:69607888-69607910 GAGAGGGAGGGGAAAGAGGATGG + Intergenic
956478869 3:69652874-69652896 GTGAGAAAGGGGATAGAGAAGGG - Intergenic
956842659 3:73155036-73155058 ATCAAAAAGGGGGAAGAGGAGGG - Intergenic
956997273 3:74841905-74841927 TTGCGCCTGGGGAAAGAGGAGGG - Intergenic
957065512 3:75518776-75518798 AGGAGCTGGGGGAAAGGGGAGGG - Intergenic
957467496 3:80613288-80613310 AAGAGGAAGGGAAAAGGGGAAGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957926155 3:86814673-86814695 ATGATGCAGGGGAAAAAGGAGGG - Intergenic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
958119416 3:89264454-89264476 CTGAGCAAGGGGTACGAGGGAGG - Intronic
958682301 3:97346579-97346601 ATTAGTAAGGGAAAGGAGGAAGG + Intronic
958761641 3:98316333-98316355 CTCAGCAAGGGGAAAGTGGCAGG + Intergenic
959580988 3:107982086-107982108 AAGAGGAAGGTGAAAAAGGAAGG + Intergenic
959651750 3:108757157-108757179 ATGAGAAGGAGGCAAGAGGACGG + Exonic
960356067 3:116655090-116655112 ATAAGCAGGGGGAAAGAGGCAGG + Intronic
960424121 3:117485384-117485406 AGAAGAAAGGGGAAAAAGGAAGG + Intergenic
960476340 3:118133405-118133427 AGGAGGAAAGGGAAAGAAGAAGG + Intergenic
960529637 3:118748597-118748619 ATGAGCAAAGGCACAGAGGAAGG - Intergenic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
961008343 3:123419865-123419887 ATGAGCACGGGGGAAGTGCAAGG - Intronic
961285839 3:125802228-125802250 ATGACCAATGGGACAGAGTAGGG + Intergenic
961287821 3:125820645-125820667 AGGAGCTGGGGGAAAGGGGAGGG + Intergenic
961674734 3:128557760-128557782 AGGAGAAAGAGGAAAGGGGAAGG + Intergenic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
962520398 3:136193444-136193466 GTGAGGTAGGGGGAAGAGGAAGG - Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963297551 3:143562389-143562411 AAGAGCAAAGGGAGAGAGGCAGG + Intronic
963873661 3:150448063-150448085 AGGAGAAAGGGGTATGAGGAGGG - Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
965903879 3:173678503-173678525 ATTAACAGGTGGAAAGAGGATGG + Intronic
966001421 3:174953344-174953366 GGAAGGAAGGGGAAAGAGGAGGG - Intronic
966210580 3:177449517-177449539 AGGAGCAAGGAGACCGAGGAAGG + Intergenic
966739985 3:183223615-183223637 AAGAGAAAGAGGAAAGAGGACGG + Intronic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
967241950 3:187448131-187448153 ATGAGCTCGGGCAAAGAGGGAGG - Intergenic
967303653 3:188040503-188040525 ATGGGCAAGAGGGAAGAGGCAGG + Intergenic
967946468 3:194807929-194807951 AAGAGCGAGGGGCAATAGGAGGG - Intergenic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968731178 4:2270056-2270078 ATCAGCAAGGGGACAGTGGTGGG + Exonic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
968914349 4:3490737-3490759 ATGAGCAGGAGGAAGAAGGAAGG - Intronic
968914360 4:3490792-3490814 ATGAGCGGGGGGGCAGAGGAAGG - Intronic
968914441 4:3491152-3491174 ATGAGCAGGAGGAAGAAGGAAGG - Intronic
969549261 4:7853504-7853526 ATGAGGACTGGGGAAGAGGAGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969604299 4:8194716-8194738 ATCAGGAAAGGGACAGAGGACGG + Intronic
969744141 4:9056378-9056400 AGGAGCTGGGGGAAAGGGGAGGG + Intergenic
969803548 4:9588500-9588522 AGGAGCTGGGGGAAAGGGGAGGG + Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970542514 4:17094222-17094244 AGGAGCAAGGGAAGAAAGGAGGG + Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970789908 4:19845115-19845137 ATGAACAAGGGGAAAAGGTATGG - Intergenic
970805331 4:20024226-20024248 AGGAGCAATAGGAAAGAAGAAGG + Intergenic
971055734 4:22910602-22910624 AGGAGGAAGGGCAGAGAGGAGGG + Intergenic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971810629 4:31421144-31421166 ATGAGCAAGGGGAACAAAGATGG - Intergenic
972061964 4:34886485-34886507 ACTAGAGAGGGGAAAGAGGAGGG - Intergenic
972356255 4:38281774-38281796 AGGAGAGAGAGGAAAGAGGAGGG - Intergenic
972719890 4:41685491-41685513 ATCAGCGAGGGGAAAGGGCATGG + Intronic
973578686 4:52318919-52318941 ATGAGAAAGAGGCAAGAGGTGGG + Intergenic
973600406 4:52537144-52537166 ATGAGCAATGGACAAGAGAATGG + Intergenic
974020493 4:56688146-56688168 AGGAGGGAGGGGGAAGAGGAAGG + Intergenic
974020528 4:56688254-56688276 AGGAGAGAGGGGGAAGAGGAAGG + Intergenic
974463429 4:62220832-62220854 ATGGGCAATGGGCAACAGGAAGG + Intergenic
974522804 4:63007175-63007197 ATGATCAAGGTGAGAGATGATGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974782128 4:66565839-66565861 ATGAGAAAGGGGAAATCAGAAGG + Intergenic
974816581 4:67012752-67012774 ATGAGCAATAGCATAGAGGAAGG + Intergenic
975467510 4:74724981-74725003 GGAAGCAAGGGGAAAAAGGAAGG - Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976561911 4:86511614-86511636 AGGAGGAAGAGGAAAGAAGAAGG + Intronic
976782288 4:88774240-88774262 ATAAGGCAGGGTAAAGAGGATGG - Intronic
976886118 4:89986598-89986620 ATGAGTTTGGAGAAAGAGGAAGG - Intergenic
976927791 4:90522998-90523020 AGGAGCAGGGGTAAAGAGGGGGG - Intronic
978724540 4:111955137-111955159 ATCAGGAAAAGGAAAGAGGAGGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979521669 4:121674341-121674363 AGGAGAAAGGGGAAAGAGAAAGG + Intronic
979730611 4:124018619-124018641 AGGAAGAAAGGGAAAGAGGAAGG - Intergenic
979892792 4:126120969-126120991 ATGAGGTAGAGGAAAGAGTAAGG + Intergenic
980265863 4:130514884-130514906 ATTAGAAAGGGGAAAGAGGCCGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980931802 4:139189184-139189206 GTGAGAAGTGGGAAAGAGGAAGG + Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
980972261 4:139577784-139577806 AAGAGCCAGGGGAAAGTGAATGG + Intronic
981354063 4:143766700-143766722 AAGAGGAAGGGGAAAGAAAAGGG - Intergenic
981732167 4:147911018-147911040 ATGAGGAAAGGGAAAGAAAAGGG - Intronic
981969359 4:150648099-150648121 ATGAGCTAGGAGAAAGAAGGAGG + Intronic
982123370 4:152162901-152162923 AGGAGAAAGGGGAAAGGGGAGGG + Intergenic
982335382 4:154231287-154231309 AGGAGAAAAGTGAAAGAGGAAGG - Intergenic
982846045 4:160253787-160253809 GTGACCCAAGGGAAAGAGGATGG - Intergenic
983264955 4:165499042-165499064 ATAGGAAAGGGGAAAGAGCAAGG + Intergenic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
983957040 4:173710093-173710115 ATGAGCAAGGAGAAAGTGCTAGG + Intergenic
984161061 4:176252438-176252460 AGGAAGAAAGGGAAAGAGGAAGG - Intronic
984247617 4:177294771-177294793 ATTAGCAAGGGTGAAAAGGAGGG - Intergenic
984318284 4:178157458-178157480 AGGAACAAGGTGAAAGATGAGGG + Intergenic
984617189 4:181912180-181912202 ATGAGGAAGGGGAAAAGGCAAGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
984911456 4:184676968-184676990 AAGTGAAGGGGGAAAGAGGAAGG - Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985117484 4:186605746-186605768 AAGAGCAAGAGGGAAGAGGAAGG + Intronic
985805060 5:2037703-2037725 ATGGGAGAGGGGAGAGAGGAGGG - Intergenic
986519365 5:8597523-8597545 ATGAACATTGGGAAGGAGGATGG + Intergenic
986701406 5:10412919-10412941 AGGAACAAGGGGAGAGATGAGGG + Intronic
986709889 5:10480931-10480953 TTGAGCAGGGGGAGACAGGAAGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987555230 5:19437735-19437757 ATGAGCAAAGGCACAGAGGAAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
987919496 5:24260468-24260490 ATGAACAAGGGGAAAAAAGTGGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988713753 5:33804211-33804233 ATGAAGATGGGGGAAGAGGAAGG - Intronic
989242091 5:39213512-39213534 ATGAGCAAGGAAACAGAGCAAGG + Intronic
989310404 5:40010524-40010546 ATGAGCTAGAATAAAGAGGATGG - Intergenic
989313795 5:40053260-40053282 ATAAGCCATGGGAAATAGGAGGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990125027 5:52505040-52505062 ATGAGGAAGGGAAAGAAGGAAGG + Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991408472 5:66324412-66324434 ATGAGAGGGGGGATAGAGGAAGG - Intergenic
991959660 5:72031641-72031663 ATGAGCAAGGGTCAAGAGGTGGG - Intergenic
992468481 5:77030560-77030582 ACGAGCAAGGGGACCGAGGATGG - Exonic
992891816 5:81210812-81210834 GAGAGCAAGGGGACAGAGGTGGG - Intronic
994243433 5:97450501-97450523 ATGAGCATGAGGAAAATGGAAGG - Intergenic
994275603 5:97833044-97833066 ATGAGCAAGTGAAGAGAGAAGGG - Intergenic
994815497 5:104581701-104581723 ATAAGCAAGGGGAGAAAGCAAGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995551413 5:113285495-113285517 GTGAGCAGGGGGAGAGTGGAAGG - Intronic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
996308623 5:122078184-122078206 CTGAGAAAGGGGAAAGGGAAGGG - Exonic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996534601 5:124564463-124564485 AGGAGGAAGAGGAAAGAGAAGGG + Intergenic
996607849 5:125344831-125344853 AGGAGCCAAGGGAAAGAGGAGGG - Intergenic
996742038 5:126808572-126808594 AGGAGAAAGACGAAAGAGGAAGG + Intronic
997038883 5:130227793-130227815 ATGGGAATTGGGAAAGAGGAAGG - Intergenic
997298956 5:132788334-132788356 AGAAGCTAGGGGAAAGAGGTGGG - Intronic
997343275 5:133163922-133163944 ATTAGCAAAGGAAAAGAAGAAGG - Intergenic
998545494 5:143023886-143023908 AGGAGAAAGGGGAAAGAAAAAGG - Intronic
999281252 5:150367641-150367663 AGGAGCAAGAGAGAAGAGGATGG - Intronic
1000059106 5:157637397-157637419 AATAGCAAGGGTATAGAGGAGGG - Intronic
1000477537 5:161729846-161729868 ATGAGAAATGGCAAAGAGGAGGG + Intergenic
1000643945 5:163738641-163738663 ATGAGCCTGGGGAAATAAGAAGG + Intergenic
1001322450 5:170693804-170693826 ATTAGCAAGAAGAAAGTGGAGGG + Intronic
1001741480 5:174056388-174056410 ATGATCAATAGGAAAGAGTATGG + Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003215904 6:4111542-4111564 ATGAGTAGGGTGAAAGTGGAAGG - Intronic
1003262392 6:4531279-4531301 AAGAGCAAGGAAAAAGAGAAAGG + Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004002053 6:11604828-11604850 AGGAGGAGGGGGAAGGAGGAGGG + Intergenic
1004015424 6:11727896-11727918 AAGAGAGAGGGGAAAGAAGAAGG + Intronic
1004551986 6:16656675-16656697 ATGGGCAAGGTGAAAGATGATGG - Intronic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005701647 6:28407160-28407182 ATGAATAAAGGAAAAGAGGAAGG + Intergenic
1006191984 6:32215108-32215130 ATGACCAATGGGGAAAAGGAAGG - Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008046420 6:46855882-46855904 ATGAGCGGGGTGAAAGAGTAGGG + Intronic
1008140844 6:47830396-47830418 ATAAGCAAAATGAAAGAGGAAGG - Intronic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008333448 6:50270943-50270965 ACGGGCAAGAGGAGAGAGGAAGG + Intergenic
1008951333 6:57163109-57163131 ATGAGGAGGGGAAAAGAAGAAGG - Intronic
1009814566 6:68715458-68715480 ATGAGCAAGAGGAATGGAGAAGG + Intronic
1010187132 6:73157339-73157361 AGGAGGAAGGGGAAACAGGAAGG + Intronic
1010388017 6:75304613-75304635 ATGAGAAAAAGGAAAGAGAAGGG + Intronic
1011065085 6:83317664-83317686 ATGAGCAAGGGCAATTAGGCAGG - Intronic
1011551656 6:88536024-88536046 AAGAGCAAGGGGGGAGGGGAAGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013059070 6:106614263-106614285 CTGAGGAAGGTGAAAGAGCAGGG + Intronic
1013414506 6:109912809-109912831 AAGAGAAAGTGGACAGAGGAGGG - Intergenic
1014308704 6:119771756-119771778 AGGAGAGAGGGGAAAGGGGAAGG + Intergenic
1014310890 6:119799939-119799961 ATAAGCAAAGGGAATGAGAAAGG + Intergenic
1014398414 6:120955723-120955745 ATGAGCAAGGACAAAGTGGCAGG + Intergenic
1014719688 6:124901025-124901047 ATGAGCAAATGGAAAGAAGATGG - Intergenic
1014769011 6:125440079-125440101 CTGAGCAAGGAAATAGAGGAAGG - Intergenic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1016369370 6:143356621-143356643 GGGACCAAGGGGAAAGAGAAGGG - Intergenic
1016457861 6:144249838-144249860 TTGAGCAAGGAAAAAAAGGAAGG - Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018435168 6:163752677-163752699 AGGAGCAAGGGCAGAGAGGTTGG + Intergenic
1019028619 6:168992041-168992063 GTGAGCATGGGCAAAGAGAACGG - Intergenic
1019320805 7:414457-414479 AGGAGGAGGGGGAAAGAAGAGGG - Intergenic
1019405896 7:883929-883951 CCGGGCAAGGGGAAAAAGGACGG - Intronic
1019410048 7:902653-902675 ATGAGAACAGGGAAAGTGGAGGG + Intronic
1019551879 7:1607086-1607108 GAGAGAAAGAGGAAAGAGGAGGG - Intergenic
1019767771 7:2864054-2864076 AGAAGCCAGGAGAAAGAGGAAGG - Intergenic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1019861302 7:3660440-3660462 AAGAGAATGGGGAAATAGGAGGG + Intronic
1019881416 7:3864705-3864727 CTTAGTAACGGGAAAGAGGAAGG + Intronic
1019964050 7:4484543-4484565 GAGAGAAGGGGGAAAGAGGAGGG + Intergenic
1020705827 7:11542957-11542979 ATCAGCAAGGGAAAAAAGGTAGG - Exonic
1020828129 7:13057916-13057938 CTGAGCAAAGTGAAAGAGAAAGG - Intergenic
1021583067 7:22177484-22177506 ATGGGCAAGGAGAAAAAGTAAGG + Intronic
1021789889 7:24194282-24194304 AGGAGCAAGAGGGAGGAGGAGGG + Intergenic
1022751055 7:33226164-33226186 ATTATCAAGGGGAAAGAGTAAGG - Intronic
1022788742 7:33665286-33665308 ATGAGCAAGTTGAAAGAGAGGGG - Intergenic
1023119989 7:36899452-36899474 ATGAGCAAAGGCAAGGAGGTAGG + Intronic
1023192670 7:37599550-37599572 ATGTCCATGGGGCAAGAGGAAGG - Intergenic
1023466105 7:40456841-40456863 ATGAGCAAGGGAGGAGAGCATGG + Intronic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024543630 7:50499595-50499617 ATTAGCAAAGGGAACCAGGAAGG - Intronic
1024805096 7:53130185-53130207 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
1025207146 7:57000450-57000472 ATGAAGAATGGGAAAGGGGAGGG - Intergenic
1025481073 7:60983555-60983577 AACTGCAAGGAGAAAGAGGATGG - Intergenic
1025664790 7:63576440-63576462 ATGAAGAATGGGAAAGGGGAGGG + Intergenic
1025945395 7:66100454-66100476 ATGAGGAGGAGGAAAGAGGGAGG + Intronic
1025957081 7:66191247-66191269 AGGAGTAAAGGGACAGAGGACGG + Intergenic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026606905 7:71824274-71824296 TTGAGGAAGGGGAAACAGGCAGG - Intronic
1027845312 7:83365253-83365275 AAGAGAAATGGGAAAGAAGAGGG - Exonic
1028018897 7:85746148-85746170 ATAAGGAAGGGGGAAGCGGAAGG + Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028492148 7:91424456-91424478 AGGAGCAAGGCAAAAGATGAGGG + Intergenic
1028547595 7:92020960-92020982 AAAAGCAAGGGGAAAGACTATGG - Intronic
1028849255 7:95517999-95518021 ATGATCAATTGCAAAGAGGAAGG + Intronic
1029069192 7:97881427-97881449 AGGAGCTGGGGGAAAGGGGAGGG - Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1029987248 7:104933776-104933798 AGGAACAAGGGGCAAGGGGAGGG + Intergenic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030231031 7:107208712-107208734 ATAAGCAAGGAAAAAGAGCAGGG + Intronic
1030644527 7:112045115-112045137 ATGAGGAAGGGGAAAATGGCAGG - Intronic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031912736 7:127534617-127534639 ATGAGGTCGGGGAAAGAGAAAGG + Intergenic
1032065050 7:128762004-128762026 ATGAGCAATGGAAGATAGGATGG + Intronic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1032448405 7:132004343-132004365 ATGACCAAGCCCAAAGAGGAGGG - Intergenic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1032692703 7:134304931-134304953 ATGGGCAAGGGGAAAAAACATGG + Intronic
1033129772 7:138735703-138735725 GTGAGCAAGGGGAATGCCGAGGG - Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033621866 7:143069179-143069201 ATGAGAAAGAGGAGAGAGCAAGG + Intergenic
1033640900 7:143262738-143262760 ATGGGCAAGGGGCTAGAGAATGG + Intronic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1034966648 7:155395551-155395573 AGCACCAAGGGGACAGAGGAAGG - Exonic
1034978909 7:155463431-155463453 AGGAGCAGGAGGAAGGAGGAAGG - Exonic
1034993266 7:155561282-155561304 AAGAGAAAGGGGAATGGGGATGG + Intergenic
1034995100 7:155572039-155572061 AGGGGCATGGGGAGAGAGGAAGG + Intergenic
1035010312 7:155710010-155710032 ATGAACGAGGGTAAAGAAGACGG - Intronic
1035218568 7:157390448-157390470 ACCAGCTAGGGGGAAGAGGAAGG - Intronic
1035229708 7:157457632-157457654 ATGAGCAAGGGCAGACAGCAGGG - Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036550992 8:9814768-9814790 AAGAGAAAAGGAAAAGAGGAAGG - Intergenic
1036755627 8:11468931-11468953 GTGGGCCAGAGGAAAGAGGAAGG + Intronic
1036884897 8:12544818-12544840 AGGAGCTGGGGGAAAGGGGAGGG - Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1038395824 8:27244730-27244752 ATCAGAAAGTGGAAAGAGGAGGG + Intronic
1038426931 8:27469690-27469712 AGGAGCAGGGGGAAAGCGGTGGG + Intronic
1038637667 8:29300584-29300606 ATATCCAAGGGGAGAGAGGAAGG - Intergenic
1038829365 8:31040152-31040174 ATGAGCAACCAGAAAGATGAAGG + Intronic
1039364575 8:36916385-36916407 ATGAGGAAGGGGAGAAAGAAAGG + Intronic
1039441094 8:37595805-37595827 ATGAGAAAGGGGAAACTAGATGG + Intergenic
1039513157 8:38107566-38107588 ATGAGAAAGGAAAAAAAGGATGG - Intronic
1041280083 8:56199890-56199912 ATGAGCAAAAGGAGAGAGAATGG + Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041411414 8:57560527-57560549 AGAAGCAAGGAGAAAGAGAAGGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041952099 8:63515177-63515199 ATGAGCAGGGGGCAAGGGAATGG + Intergenic
1042386323 8:68179312-68179334 ATGAGCTAGGGGACATAGGTTGG + Intronic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1043414974 8:80038463-80038485 AGGAGCAGGGGGAAAGGGGAAGG - Intronic
1043719439 8:83528535-83528557 ATAAGCAAGGGGCAAAGGGAGGG + Intergenic
1043777745 8:84291161-84291183 AGAAGTAAGGGAAAAGAGGACGG + Intronic
1043817544 8:84820694-84820716 GGGGGCAAGGGGAAAGGGGAGGG - Intronic
1043854194 8:85245772-85245794 CTGAGCAGCGAGAAAGAGGAGGG - Exonic
1044578570 8:93798682-93798704 AAGGGAAAGGGGAAAGAGAATGG - Intronic
1044596397 8:93962873-93962895 ACCAGAGAGGGGAAAGAGGAAGG - Intergenic
1044826157 8:96199282-96199304 ATGAGCAAAGGCAAAGAGGTGGG - Intergenic
1045076015 8:98569111-98569133 CTGAGCAAGGAAAAAGAGCAAGG + Intronic
1045567032 8:103329902-103329924 ATGAGAGAGGTGAAAGCGGACGG + Exonic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045789474 8:105965434-105965456 CTGAGCAAAGGGAGAGATGAAGG - Intergenic
1045888791 8:107129818-107129840 ATAGGAAGGGGGAAAGAGGAAGG + Intergenic
1045977542 8:108146751-108146773 GAGTGCAAGGGGTAAGAGGAAGG - Intergenic
1046078856 8:109345296-109345318 ATGGGCAAGGGAAAAAATGAAGG + Exonic
1046260959 8:111766553-111766575 ATCAGCAAGGGAAATGATGAGGG + Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047003227 8:120593911-120593933 ATCAGGCAGGGGAGAGAGGAGGG + Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047255805 8:123212684-123212706 ACGTGCCAGGGGAAAGAGAATGG + Intergenic
1047382368 8:124375064-124375086 AGAAGCAAGGGGAAAGAGATAGG - Intergenic
1047455204 8:125002135-125002157 ATCAGGATGGGGAAAAAGGAGGG + Intronic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1047559987 8:125976615-125976637 AAGAGCAAGGGGAACCAGGGAGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048220155 8:132533721-132533743 AAGAGCAAGGGTAGACAGGAAGG - Intergenic
1048381985 8:133873535-133873557 TGGAGCAAGGAGACAGAGGAAGG - Intergenic
1048396358 8:134017908-134017930 CTGAGCAGTGGGAAAAAGGAAGG - Intergenic
1048413001 8:134195207-134195229 AGGAGGAAGGGAAAAGAGGCGGG - Intergenic
1050163219 9:2739233-2739255 ATGAGGAACAGCAAAGAGGAAGG + Intronic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1050475928 9:6041041-6041063 AGAAGGAAGGAGAAAGAGGAAGG - Intergenic
1050525011 9:6538715-6538737 ATTTGCAAGGAGAGAGAGGAGGG - Intronic
1050569742 9:6925407-6925429 AGGAGGAAGGGGAAAGGGAAAGG - Intronic
1051180186 9:14403534-14403556 AAGAGAAATGGGAAAGAAGAGGG - Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1052323424 9:27192669-27192691 GGGAGGAAGGGGAAAGAGGAAGG + Intronic
1052688251 9:31780952-31780974 ATGTGCTAGGGCAATGAGGAAGG - Intergenic
1052860960 9:33437358-33437380 AAAATCAAGAGGAAAGAGGAAGG + Intergenic
1052964810 9:34331870-34331892 ATAAGCCAAGGGAAAGAGAAAGG - Intronic
1053113574 9:35482539-35482561 ATGGGGAAGGGAAAAGAAGATGG + Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1053286330 9:36851721-36851743 ATGAGCAAAGGCAGGGAGGAGGG + Intronic
1053350722 9:37411768-37411790 AGGAGCAAGGGGATGGAGGCAGG - Intergenic
1053581927 9:39414184-39414206 ATGAGAAAGTGGAAACAGCAGGG + Intergenic
1053696509 9:40644162-40644184 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054103506 9:60972916-60972938 ATGAGAAAGTGGAAACAGCAGGG + Intergenic
1054307760 9:63443390-63443412 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1054440114 9:65252865-65252887 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054490291 9:65769074-65769096 ATGAGCAAGGGAGGGGAGGAGGG + Intergenic
1054582847 9:66933920-66933942 ATGAGAAAGTGGAAACAGCAGGG - Intergenic
1054952409 9:70867319-70867341 ATGAGCAAGAGAAATAAGGAAGG - Intronic
1055053701 9:72004413-72004435 GGGCTCAAGGGGAAAGAGGAGGG + Intergenic
1055302635 9:74898286-74898308 CTCAGCAAGGGGAAAAAGAAGGG - Intergenic
1055410433 9:76023283-76023305 ATGAACAAGGGAAGACAGGAAGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1056139168 9:83657770-83657792 ATGAACAAGGGGGAAAAGCAGGG - Intergenic
1056224329 9:84480626-84480648 AAGAGGAAGGGGAAAGGTGAGGG + Intergenic
1056303113 9:85262198-85262220 AAGAGAAATGGGAAAGAGGTGGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056339211 9:85608131-85608153 ATGAGCAAAGATATAGAGGATGG + Intronic
1057544296 9:96005821-96005843 ATGAACAAGGGGTAACAAGAAGG + Intronic
1057941100 9:99285575-99285597 ATTAGCAAGAGGAAAAAAGAGGG - Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058343420 9:103926705-103926727 AGGAGCAGAGGGAGAGAGGAAGG + Intergenic
1058561429 9:106233118-106233140 AGGAGGAGGAGGAAAGAGGAAGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058972852 9:110098923-110098945 CAGAGCTGGGGGAAAGAGGAAGG - Intronic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059382449 9:113936982-113937004 GTGAGCGAGGGGAATGAGGTTGG - Intronic
1059454367 9:114390232-114390254 ATGAGCAAAGGCAGGGAGGAGGG - Intronic
1059454453 9:114390722-114390744 CTGAGCAAGGGCAGAGAGGGTGG - Intronic
1059646733 9:116275624-116275646 AGGAAAAAGGGGGAAGAGGAAGG - Intronic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060241383 9:121906668-121906690 AAGGGAAAGGGGAAAGGGGAAGG + Intronic
1060274454 9:122171860-122171882 GTCATCAAGGGGAAAGATGATGG - Intronic
1060668054 9:125444973-125444995 ATGAGCAACAGGAAGGAGAAGGG + Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061899686 9:133666522-133666544 AGGAAAAAGGGGAGAGAGGAAGG - Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062564529 9:137158276-137158298 AGGAGCAGGGGGAAGGAGCAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1202778957 9_KI270717v1_random:17822-17844 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1203774747 EBV:66453-66475 ATGAGCAAGGGCCCAGGGGAGGG + Intergenic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185662002 X:1735487-1735509 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
1186530291 X:10288360-10288382 AGGAGCAAGAAGAAAAAGGATGG - Intergenic
1186588101 X:10898144-10898166 AGGAGGAAGGGGAAAGGGAAGGG + Intergenic
1186746146 X:12571443-12571465 AGGAGAAAGGGGAAACAGGCAGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1186833758 X:13417382-13417404 GGGAGCAAGGGAAGAGAGGAAGG - Intergenic
1187025738 X:15433899-15433921 AGGAGGAAGGGGAAAGAAGGAGG + Intronic
1187025792 X:15434140-15434162 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025806 X:15434240-15434262 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187141915 X:16602041-16602063 ATGAGCAATGGGGATGAGGGAGG + Intronic
1187191840 X:17043162-17043184 AGAAGCAAGGGGAAAGAGATGGG + Intronic
1187278286 X:17835704-17835726 ATAAGAAAGGGAACAGAGGAAGG - Intronic
1187652535 X:21424749-21424771 AGGAACAAGGGGAAAAATGAAGG - Intronic
1188057950 X:25563415-25563437 AGGAGCAAGGGGGAAGTGGAAGG + Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189640399 X:43063753-43063775 AGGAGCAAGGGGCAAGAGGTGGG + Intergenic
1189723244 X:43942000-43942022 AAGAACAAGAGCAAAGAGGATGG - Intergenic
1189932768 X:46032678-46032700 ATGAGCAAAGGGAAAGATGGGGG + Intergenic
1190108024 X:47573025-47573047 GGGAGGAAGGGGGAAGAGGAAGG + Intronic
1190338131 X:49275322-49275344 AAGAGCCAGGAGAAAGAGAAGGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190596095 X:52053641-52053663 ATGAGCAGGGGGCAAGAAGAAGG - Intronic
1190612729 X:52200432-52200454 ATGAGCAGGGGGCAAGAAGAAGG + Intronic
1190720003 X:53139856-53139878 AGGAGGAAGGGGGAGGAGGAAGG + Intergenic
1191590846 X:62882762-62882784 AAGAGCAAGAGCAAAGAAGAAGG - Intergenic
1191999553 X:67134189-67134211 ATGAGAAAAGGGAGAAAGGAAGG + Intergenic
1192000040 X:67140136-67140158 ACCATCAAGGGGAATGAGGAGGG + Intergenic
1192302441 X:69919209-69919231 ATGACTAAGGGGGAAGAGGGTGG + Intronic
1192314226 X:70039526-70039548 ATGAGCTAGGGGAAGGACTAAGG + Intergenic
1192588814 X:72342557-72342579 ATGATCAAGGGGTAGAAGGAAGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196124169 X:112082037-112082059 ATGAGCACAGGGAAAGGGGCGGG + Exonic
1196203456 X:112912227-112912249 ATAATCAAGGGGAGAGATGATGG - Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196881238 X:120199907-120199929 ATGAGCCAGGTGAAAGATAATGG - Intergenic
1197088139 X:122503675-122503697 ATTAGAGAGGGGAAAGTGGAAGG - Intergenic
1197325184 X:125084132-125084154 ATAAGTATGGGGAAAGGGGAGGG - Intergenic
1197472549 X:126881486-126881508 AGGAGCAAAGGGATACAGGAGGG - Intergenic
1197967732 X:132082876-132082898 ATGACCAACAGGAAACAGGAGGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198080616 X:133235957-133235979 CAGAGCAACAGGAAAGAGGAAGG - Intergenic
1198249915 X:134870169-134870191 TTGCCCAAAGGGAAAGAGGATGG + Intergenic
1199237029 X:145504121-145504143 ATGAGCAAAGGAAGAAAGGAAGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199381355 X:147176322-147176344 ATGCTGGAGGGGAAAGAGGAAGG + Intergenic
1199381862 X:147180989-147181011 AGGAGAAAGGGCAAAGGGGAGGG + Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199951274 X:152708204-152708226 GGGAGTAAGGGGAAAGAGGTGGG - Intergenic
1199958409 X:152760257-152760279 GGGAGTAAGGGGAAAGAGGTAGG + Intergenic
1200258694 X:154600024-154600046 AGGAGGAAGGGGGAAGAGCAAGG + Intergenic
1200319297 X:155169093-155169115 ATCAGCTAGGGGAAACAGCAAGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201484776 Y:14481149-14481171 AAGAGCAAGTGGAAAAAGTAAGG + Intergenic