ID: 934876808

View in Genome Browser
Species Human (GRCh38)
Location 2:97929188-97929210
Sequence ACCCAAATCCTACACTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934876804_934876808 3 Left 934876804 2:97929162-97929184 CCGGAAAGTAAAAAATAGAGAAA 0: 1
1: 0
2: 7
3: 191
4: 1959
Right 934876808 2:97929188-97929210 ACCCAAATCCTACACTGATGGGG 0: 1
1: 0
2: 0
3: 14
4: 110
934876803_934876808 12 Left 934876803 2:97929153-97929175 CCTATAGTGCCGGAAAGTAAAAA 0: 1
1: 0
2: 0
3: 20
4: 138
Right 934876808 2:97929188-97929210 ACCCAAATCCTACACTGATGGGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934876808 Original CRISPR ACCCAAATCCTACACTGATG GGG Intronic
901313017 1:8284180-8284202 ACAAATATCCTACACTGCTGTGG - Intergenic
902697729 1:18151547-18151569 GGCCAAATCCAACACTGATGGGG + Intronic
910204485 1:84734478-84734500 ACCCAAATGCTAAACTCATCTGG + Intergenic
916574917 1:166058879-166058901 ACCCAAATCCTAGATGGCTGAGG + Intronic
917940691 1:179918122-179918144 ACCCAACTCCTACAATCATATGG + Exonic
920989128 1:210919700-210919722 TCCCAAAGCCCACACTGGTGAGG + Exonic
1063193445 10:3718819-3718841 ACCCAAATCCTACACACAGAGGG + Intergenic
1063768774 10:9173990-9174012 ACCCAAAAGCTACAGTGGTGAGG - Intergenic
1072095129 10:92170924-92170946 ACTCAATTCCTACACTGTTCAGG + Intronic
1072550482 10:96473539-96473561 ACCCAATACCTAAACTGTTGGGG + Intronic
1077510074 11:2954757-2954779 ACCAAACTCCTGCACTGCTGGGG + Intronic
1077739512 11:4829919-4829941 ACCCAAATCCTGCACCTGTGTGG + Intronic
1081965815 11:47168899-47168921 AACCCCATCCTTCACTGATGGGG + Intronic
1084848786 11:71921656-71921678 ACTGAAATCTTACACTGAGGGGG + Intronic
1085265286 11:75234348-75234370 ACCAAGATTCTACAATGATGAGG + Intergenic
1086582557 11:88415798-88415820 ACCCAAAGCCTGCACTCTTGAGG - Intergenic
1091593017 12:1856538-1856560 ACCCAAATCCAACCTGGATGGGG - Intronic
1094410541 12:30163955-30163977 ATTCAAATCCTACAGTGCTGTGG + Intergenic
1104322414 12:127764256-127764278 ACCCAAAGCCTTCACTGACCAGG + Intergenic
1104703035 12:130921650-130921672 GCCCAAATCTCACACTGATACGG - Intergenic
1105929805 13:25041740-25041762 ACCCAGATCCTCCCCTGCTGTGG - Intergenic
1107418837 13:40226512-40226534 ATCCAAAGCCTACACTTAAGAGG + Intergenic
1115389631 14:32840608-32840630 ACCCAAATCATGTACTGAAGGGG - Intergenic
1122828389 14:104383382-104383404 ACCCCCATCCAACACTGACGGGG - Intergenic
1123625813 15:22226281-22226303 ACCCCAATCCTACAATGAGGGGG + Intergenic
1125547077 15:40513666-40513688 GCCCAAGTCCTACACAGCTGAGG + Intergenic
1128963717 15:72036534-72036556 ACCAACATCCTACAATGATGGGG + Intronic
1131435599 15:92419140-92419162 ACCCTCATCCAACACCGATGCGG + Intronic
1137663807 16:50235791-50235813 AACCAAATCCTCCCCTGCTGAGG - Intergenic
1138118403 16:54378750-54378772 CCCCAAACCCTACAATGAGGAGG - Intergenic
1144452519 17:15392809-15392831 AACCAAACCCAACACTGGTGTGG + Intergenic
1146681821 17:34814007-34814029 CCCACACTCCTACACTGATGGGG + Intergenic
1147250369 17:39149674-39149696 ACCCCAACCCTACTCTGAAGGGG + Intronic
1148579935 17:48736486-48736508 TCCCAAATCCCACTTTGATGAGG - Intergenic
1148711000 17:49680787-49680809 TCCTAAATTCTACAATGATGTGG + Intergenic
1149218596 17:54388808-54388830 AGACAAATCCTAGACAGATGGGG + Intergenic
1151232093 17:72692335-72692357 GCTCAAATCCTACAATGATGAGG + Intronic
1151463197 17:74267969-74267991 ACTCAAAGTCTAGACTGATGAGG + Intergenic
1155284350 18:24272546-24272568 ACCCAAATACCACACTTAAGTGG + Intronic
1156956121 18:42965930-42965952 TCTGAAATCCTACAGTGATGTGG - Intronic
1158541310 18:58357273-58357295 ACCAAAATCTTATACTGAAGAGG - Intronic
1158607224 18:58906407-58906429 ACAAAAAAACTACACTGATGGGG - Intronic
1158654382 18:59316364-59316386 CCCCACTTCCTACAATGATGAGG + Intronic
1158967400 18:62634613-62634635 ACCCAACCCCCACACAGATGTGG - Intergenic
1159575460 18:70170638-70170660 ACCCAAAGCCTTAACTGATCTGG - Intronic
1164392599 19:27838747-27838769 ATCAAAATCCTGCTCTGATGTGG + Intergenic
1166295016 19:41884610-41884632 ACCCAAATCTTACATGGACGTGG - Intronic
1167597024 19:50433120-50433142 ACCCTCACCCTAAACTGATGCGG - Intronic
928414334 2:31079170-31079192 AGCCAACTTCCACACTGATGTGG - Intronic
934876808 2:97929188-97929210 ACCCAAATCCTACACTGATGGGG + Intronic
935126798 2:100231354-100231376 AGCCACATCCTACATAGATGGGG - Intergenic
939111195 2:138009500-138009522 ACCCTCATCATACACTGAGGGGG - Intronic
939184374 2:138843011-138843033 AGCCATATCCTACATTGCTGGGG + Intergenic
940717279 2:157240773-157240795 CCCCAAATCCTGCAGTGAGGTGG + Intergenic
942950546 2:181716242-181716264 ACCCAAACCCATCATTGATGGGG - Intergenic
948720773 2:239898767-239898789 AACGAAGTCCTACACAGATGGGG + Intronic
948917938 2:241047644-241047666 TCCCAAATACTTCACTGATAGGG + Intronic
1169040958 20:2494965-2494987 GTCAAAGTCCTACACTGATGTGG + Intronic
1170237882 20:14128050-14128072 ACCTGAAACCTACAATGATGAGG + Intronic
1172130318 20:32650721-32650743 ACCCAAATCCTTTCCTGATAAGG + Intergenic
1173104901 20:40124457-40124479 ACCCATATCCCACACTTATATGG - Intergenic
1176359578 21:5983370-5983392 CCCCAAATCCTAAGCTGCTGTGG - Intergenic
1179280672 21:39931315-39931337 ACCCAGTTCCTATGCTGATGGGG - Intergenic
1179763940 21:43555180-43555202 CCCCAAATCCTAAGCTGCTGTGG + Intronic
1183567739 22:38628249-38628271 ACCCAAGTCCCACTCTGAAGAGG - Exonic
1183766218 22:39877769-39877791 AACCAAAGCCTAACCTGATGGGG + Intronic
953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG + Intronic
954070923 3:48142376-48142398 CACCAAATCTTACACTCATGAGG + Intergenic
960831126 3:121849629-121849651 CCTCAAATCCTACACTTATGAGG + Intronic
972056966 4:34815371-34815393 ACCAGAATCCAACACTGAGGAGG + Intergenic
973047697 4:45554950-45554972 CCCTAAAACCTACACTGATGTGG + Intergenic
973826243 4:54710103-54710125 ACCCAAGTCCTGCACTGCTGGGG + Intronic
975435666 4:74348504-74348526 AGCCAAATCCCAGACTCATGGGG - Intergenic
977430250 4:96923137-96923159 ACCCTAATCATTTACTGATGAGG - Intergenic
978165252 4:105599376-105599398 TCCCAAATCCTGCACTGAATTGG - Intronic
978689699 4:111491970-111491992 ACCCAAATACTACAATAATTTGG - Intergenic
986602649 5:9488628-9488650 AATCAATTCCTACACTGATGCGG + Intronic
989728207 5:44613919-44613941 ACTCAAATCTTAAAATGATGAGG + Intergenic
990785970 5:59420273-59420295 ACCCAAATCCTAGTCTGACTTGG + Intronic
993060484 5:83032648-83032670 ACCCAAAGACCACAGTGATGGGG + Intergenic
994502428 5:100596641-100596663 ACTCTAATCCTACAGTGAAGAGG - Intergenic
999931337 5:156436037-156436059 ACCCAAAGCCTACACTTATCAGG + Intronic
1003815029 6:9830146-9830168 ACCCAAAACCTCCATTAATGTGG + Intronic
1006732904 6:36249631-36249653 ACACAAATCCTTCACTTACGTGG - Intronic
1008242370 6:49128561-49128583 AGCCACATCTTACACGGATGGGG - Intergenic
1008386781 6:50900928-50900950 AACCAAATCTTACTCTGTTGGGG - Intergenic
1019038228 6:169080620-169080642 ACCCAAATCCAACACTAAATGGG + Intergenic
1030818950 7:114073269-114073291 ACCCAAAGCCAATACTGAGGAGG + Intronic
1031924178 7:127622304-127622326 ATCCAAACCCTACAATAATGGGG - Intergenic
1032706413 7:134424080-134424102 GCCCAAATCCTTCACAGCTGAGG - Intergenic
1033386986 7:140887213-140887235 ACACAATTCCAACACTGGTGTGG + Intronic
1033448725 7:141443986-141444008 AACCAAAACCCACATTGATGGGG - Intronic
1036493834 8:9251704-9251726 AATCATATCCAACACTGATGGGG + Intergenic
1041512583 8:58668098-58668120 CCCCAAATCCAAGACTGATGAGG + Intergenic
1041512767 8:58669823-58669845 CCCCAAATCCAAGACTGATGAGG - Intergenic
1041768809 8:61450428-61450450 ACTCACATCCTACACTGCTGAGG - Intronic
1045227038 8:100258737-100258759 ACAGAAATGCTACACTGATGTGG + Exonic
1047466925 8:125125852-125125874 TCCCAAGTCCTACATTGGTGAGG + Intronic
1049565145 8:143334421-143334443 AACCAAACCCTACAGTGTTGAGG + Intronic
1049897389 9:120641-120663 ACACAAAACCCACATTGATGGGG + Intergenic
1053740482 9:41130908-41130930 ACACAAAACCCACACTGATGGGG + Intergenic
1054443477 9:65287085-65287107 ACACAAAACCCACATTGATGGGG + Intergenic
1054486800 9:65734418-65734440 ACACAAAACCCACATTGATGGGG - Intergenic
1054687868 9:68300391-68300413 ACACAAAACCCACATTGATGGGG - Intergenic
1054712424 9:68524668-68524690 ACCCAACTCCTCATCTGATGTGG + Intronic
1058721763 9:107770523-107770545 ACCCTAATCCTGCTCTGAAGAGG - Intergenic
1059845420 9:118270084-118270106 AGCCAAATCCAACACTGACCAGG - Intergenic
1188774327 X:34194702-34194724 ACCCAACTCCTACATGAATGTGG - Intergenic
1192131625 X:68557416-68557438 ACCTAAATCCTACTCCCATGAGG + Intergenic
1192521323 X:71803997-71804019 ACCCAGATCCTGCAGTGGTGAGG - Intergenic
1193100920 X:77610822-77610844 ACCCAAATCCTCAACTTTTGGGG - Intronic
1193480349 X:82019725-82019747 ATTAAAATCCTCCACTGATGAGG - Intergenic
1194532478 X:95068715-95068737 ACCAATGTCCTACACTGCTGTGG - Intergenic
1196694400 X:118595628-118595650 ATCCAAATCCTAGACAGAAGTGG + Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1199642734 X:149880067-149880089 ACTCGGATCCTACATTGATGTGG - Intergenic
1200091307 X:153637381-153637403 ACCCAAATCAGCCACCGATGTGG + Intergenic
1200988198 Y:9325709-9325731 AACCACATCCTACACCTATGTGG - Intergenic
1202023309 Y:20491488-20491510 ACCCATATCCTATCCTGCTGTGG - Intergenic
1202119821 Y:21510483-21510505 AACCACATCCTACACCTATGTGG + Intergenic
1202122272 Y:21534024-21534046 AACCACATCCTACACCTATGTGG + Intronic
1202156733 Y:21895359-21895381 AACCACATCCTACACCTATGTGG - Intronic
1202159181 Y:21918900-21918922 AACCACATCCTACACCTATGTGG - Intergenic
1202185630 Y:22183815-22183837 AACCACATCCTACACCTATGTGG - Intergenic
1202205730 Y:22402581-22402603 AACCACATCCTACACCTATGTGG + Intronic