ID: 934878538

View in Genome Browser
Species Human (GRCh38)
Location 2:97951336-97951358
Sequence GCTTCTGGTGCCACACAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934878538 Original CRISPR GCTTCTGGTGCCACACAGCG GGG Intronic
900372706 1:2339323-2339345 GTTTCTGCTGCCACACGGTGGGG + Intronic
900509152 1:3050202-3050224 GTCTCTGAAGCCACACAGCGGGG - Intergenic
900563963 1:3323383-3323405 GCTTCTGGCGGCACACACTGCGG - Intronic
901775849 1:11560102-11560124 TCTTCTGGTGCCACAGAGGGAGG - Intergenic
902775045 1:18669270-18669292 GCCTCTGGTTCCACATAGCAGGG + Intronic
907011637 1:50968822-50968844 GCTTCTGTTGCCTCTCAGAGAGG - Exonic
907408866 1:54270893-54270915 GCCTCTGGTGTCACACAGCCTGG - Intronic
908062654 1:60368585-60368607 TCCTCTGGTGGCACACAGTGGGG - Intergenic
908646442 1:66283125-66283147 GATTCTGGAGCCACACTGCCTGG + Intronic
913203021 1:116511464-116511486 GCTTCTGGGGCTACACTGCCTGG + Intergenic
917368597 1:174262262-174262284 GCTTCTGTTGGCACCCAGTGGGG + Intronic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
921340163 1:214126643-214126665 TCTTCTGGAGCCAGACAGCTTGG - Intergenic
1062913335 10:1228764-1228786 GCCTGTGATGCCACAGAGCGGGG + Intronic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063348958 10:5337199-5337221 ACTTCTCGTACCACACAGCTGGG - Intergenic
1067095829 10:43298902-43298924 GATTCTGGTTCCAGCCAGCGAGG - Intergenic
1067258324 10:44664721-44664743 GCTTTTGGAGCCACACTGCCTGG - Intergenic
1070950611 10:80428167-80428189 GCTTGTGGAGCCTCACAGCCAGG - Intronic
1072592146 10:96836213-96836235 TCTTATGGTGCTACACAGGGGGG + Intronic
1074124443 10:110516944-110516966 GCTTCTGGTGCCAGACACGAGGG + Intergenic
1074841381 10:117355511-117355533 GACTCTGGAGCCACACAGCTTGG + Intronic
1076814137 10:132906347-132906369 GCTTCTGAGGCCACCCAGCTGGG - Intronic
1080442515 11:32308057-32308079 ACTGCTGGTGCCACACAAAGGGG + Intergenic
1081263595 11:40991420-40991442 GCTCCTGATGCCACAAAGGGTGG - Intronic
1084525727 11:69696914-69696936 TCTCCTGGAGCCACACAGCCTGG - Intergenic
1087258690 11:95986110-95986132 AATTCTGGTCCCACACAGTGGGG + Intronic
1088247997 11:107838153-107838175 GCCTCTGGAGCCACACTGCTTGG - Intronic
1090352338 11:126115390-126115412 GCCTCTGGGGCCACCCAGCTGGG + Intergenic
1104860620 12:131921537-131921559 ACATCTGGAGCCACACAGCTTGG + Exonic
1107811265 13:44201945-44201967 GCTTCTGGTACCACACTACGTGG + Intergenic
1111878390 13:93924265-93924287 GCTGCTGGTGCCAAAAAGAGTGG + Intronic
1112590622 13:100760875-100760897 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1113773582 13:112929075-112929097 TCTTCTGGGGCCTCCCAGCGGGG + Intronic
1118283778 14:64452592-64452614 GCTTCAGGTGCCACAGAAAGTGG + Intronic
1119075337 14:71632584-71632606 TCTTCTGATGCCACACAGTGGGG - Intronic
1121012546 14:90529339-90529361 GCTACTGGAGCCAACCAGCGTGG + Exonic
1121022330 14:90587812-90587834 GGTTCTGGGGCCACACTGCTTGG + Intronic
1122075600 14:99232786-99232808 GGTTCTGGGGCCAGACAGCTGGG - Intronic
1122671773 14:103378320-103378342 GCTTATTAGGCCACACAGCGTGG - Intergenic
1123059008 14:105586041-105586063 GCTTCTGATGCCACCCCACGCGG + Intergenic
1123083338 14:105706272-105706294 GCTTCTGATGCCACCCCACGTGG + Intergenic
1123820236 15:24022390-24022412 ACTTCTGGTCCCACACAGTTTGG - Intergenic
1124402690 15:29363946-29363968 GCTTTTGGTGCCACACACCTGGG + Intronic
1125449556 15:39794247-39794269 GCTGTTGGTGCCACACTGCTGGG - Intergenic
1125892952 15:43279647-43279669 CCTTCTGGAGGCACACAGTGCGG - Exonic
1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG + Intergenic
1129989055 15:79945897-79945919 TCTTGTGGTGCCACAAAGCAAGG + Intergenic
1130064657 15:80593822-80593844 GCGCCTGGGGACACACAGCGGGG - Exonic
1131487773 15:92836417-92836439 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134100296 16:11447184-11447206 GCATCTGGTGTCACACAGACTGG + Intronic
1134272964 16:12750246-12750268 GCTTCTTGTGCCAAACAGCCAGG - Intronic
1138297500 16:55899552-55899574 GCCTCTGGTGCCACAGAGAGTGG + Intronic
1139572833 16:67824094-67824116 CCTTCTGGTGCTCCACAGCAGGG + Intronic
1142043660 16:87911558-87911580 GCTTCCGGTGCCACTCTGGGAGG + Intronic
1144871869 17:18376886-18376908 GCTTCAGGTGCCACTAAGCCTGG - Intergenic
1147603585 17:41760956-41760978 GCATCTGGTGCCAGAGAGTGAGG - Intronic
1147661337 17:42118617-42118639 TCTCCCTGTGCCACACAGCGTGG - Intronic
1148478050 17:47941910-47941932 GCTTCTGGGGCCACCCGGTGGGG + Intronic
1151059462 17:71074485-71074507 GCTTCTGGTGTCACACTCCAAGG - Intergenic
1151670267 17:75568407-75568429 GCTTCTGATTCCACAGAGCTGGG + Intronic
1152819475 17:82429388-82429410 GCTTCTATTTCCACACACCGCGG + Intronic
1153382273 18:4454090-4454112 CCTCCCGGTGCCACCCAGCGAGG + Intronic
1155339168 18:24796730-24796752 GCTTTTGGTGCCATTCAGCCTGG - Intergenic
1157211195 18:45743468-45743490 GACTCTGGTGCCAGACAGCCTGG + Intronic
1158104518 18:53870774-53870796 GCTTGTGGTGGCACAGAGTGTGG - Intergenic
1158667986 18:59449954-59449976 ACTCCTGCTGCCACACAGAGGGG - Intronic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1160894767 19:1397249-1397271 GCTTCTGGTGACACACAGCTGGG + Intronic
1161112629 19:2478673-2478695 GCACCTGGTACCACACAGCGAGG + Intergenic
1161315550 19:3615670-3615692 GCTGCTGGTGACACACTGGGCGG + Intronic
1161584343 19:5096954-5096976 GCTTGTGAGGCCACACAGGGTGG + Intronic
1162617491 19:11814161-11814183 GCTTCTGCTGTCACTCAGCACGG + Intergenic
1162655259 19:12124174-12124196 GCTTCCGGGGCCACACGGCAGGG - Intronic
1162832757 19:13297319-13297341 GCCTCTGGTGCCAGAGAGCCTGG + Intronic
1163653325 19:18531675-18531697 GCATCTGGAGTCACACAGCATGG - Intergenic
1163665671 19:18603045-18603067 GCTTCTCGTTCCACACAGAGTGG + Intronic
925979806 2:9167455-9167477 GCTTCGGGTGTCACACATTGTGG - Intergenic
925988437 2:9234610-9234632 GCTTCTGGATCCACACAATGGGG - Intronic
927206146 2:20611778-20611800 GCTTCTGCTGCCTCACCGTGGGG - Intronic
928120006 2:28577214-28577236 ACTGCTGGTGCCAGACAGCCAGG - Intronic
930095216 2:47561472-47561494 GCAGCAGGTGCCACACAGCAGGG + Intronic
932260208 2:70320715-70320737 GCCTCTGGAGCCAGACAGCCTGG - Intergenic
933934603 2:87192038-87192060 GGTCCTGGTGCCACACAGTAGGG - Intergenic
934614406 2:95762384-95762406 GGTGCTGGTGCCAGGCAGCGGGG + Intergenic
934878538 2:97951336-97951358 GCTTCTGGTGCCACACAGCGGGG + Intronic
935343825 2:102084804-102084826 GTTACTGCTGCCACACAGCATGG + Intronic
936358540 2:111773858-111773880 GGTCCTGGTGCCACACAGTAGGG + Intronic
939236157 2:139496422-139496444 GCTTCTGGTGCCAAAAAGGCTGG + Intergenic
941096600 2:161244911-161244933 CCTTCCAGTGCCACACTGCGGGG + Intergenic
941656005 2:168145438-168145460 TCTTCTGGTGCCAAGCAGCAGGG - Intronic
1169032809 20:2424701-2424723 GCCTCTTGTGCCAAACAGCAAGG - Intronic
1171024311 20:21614782-21614804 CCTGCTGGTGCCACAGAGCAGGG + Intergenic
1171500134 20:25586568-25586590 GCTTCTGGTGCCAAGCATCTCGG + Intergenic
1172779201 20:37425801-37425823 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1174815810 20:53686105-53686127 GCCTGTGGTTCCTCACAGCGGGG + Intergenic
1177435433 21:21045937-21045959 ACTTCTGGAGCCACACTGCCTGG + Intronic
1181193459 22:21161356-21161378 GCTTCCTGTGGGACACAGCGCGG - Intergenic
1182451027 22:30421761-30421783 GACTCTGGTGACACACAGTGAGG - Intronic
1182748881 22:32626182-32626204 GCCTCTTGTGCAACACAGCTTGG + Intronic
1184279629 22:43429603-43429625 GAATCAGGTGCCACAAAGCGTGG - Intronic
1185364324 22:50429951-50429973 GCTCCTCGTTCCACACAGTGGGG - Intronic
950160304 3:10755716-10755738 GCTTCTCGTGACACACACTGGGG - Intergenic
950526678 3:13528533-13528555 GCTTCTGCTGGCAGACAGCCCGG + Intergenic
953363563 3:42322442-42322464 GCTACTGGTTCCACACAACAGGG - Intergenic
953588988 3:44233372-44233394 GGCTCTGGTGCCAAACAGCCTGG - Intergenic
954653383 3:52178774-52178796 TATTCTGGTGCCTCACAGCCTGG - Intergenic
955223720 3:57044142-57044164 GCTCAGGGTGCCACACAGCCTGG - Intronic
958641126 3:96806531-96806553 GCTTCTGGAGCCAGACTGCCTGG + Intergenic
959909506 3:111747961-111747983 GCTTCTGGTCCTACAGAGCTGGG + Intronic
961558392 3:127712144-127712166 TCTTCTTATGCCACACAGCCTGG + Intronic
964440547 3:156704267-156704289 GCCTCTGGTGCCAGACGGCCTGG - Intronic
968600860 4:1508655-1508677 GCTGCTGGGGCCACACACCTGGG - Intergenic
968631091 4:1651884-1651906 GCTCCAGTTCCCACACAGCGGGG + Intronic
968833596 4:2946800-2946822 GCTGCAGCTGCCACACAGAGTGG - Intronic
969998827 4:11343372-11343394 GCTGCTTGTGCCACACAGGGTGG - Intergenic
970794766 4:19898250-19898272 GCTTCCTGTGCCAAACAGGGAGG - Intergenic
970952681 4:21775434-21775456 GCTCCTTGTGCCACTCAGCTGGG - Intronic
971444009 4:26722917-26722939 GCTTCTGAAGCCAGACAGCTTGG - Intronic
972973852 4:44609805-44609827 CCATCTGGTGCCACACAGATTGG + Intergenic
977462043 4:97337534-97337556 GCTTCTTGTGCCACCCAACTGGG + Intronic
981029746 4:140112534-140112556 GCTTCTGGCCACACACAGCTGGG + Intronic
984953607 4:185024320-185024342 GCTTCTGGAGTCAGACAGCCTGG + Intergenic
985535974 5:465966-465988 GGTTCAGGTGCGGCACAGCGGGG + Intronic
985999677 5:3620615-3620637 GCTTCAGGGGGCTCACAGCGAGG + Intergenic
986613545 5:9593700-9593722 GATTCTGGTGCCTCCCACCGTGG + Intergenic
988047797 5:25980679-25980701 ACTTATGGTTCCACACAGCTGGG + Intergenic
989708865 5:44372210-44372232 GCTTCTGGTGCCACATTCCTTGG + Intronic
997692593 5:135836863-135836885 GATTCTGGTGCCAGGCAGCCTGG - Intronic
1001097693 5:168788489-168788511 GGTTCTGGAGCCAGACAGCATGG + Intronic
1003837344 6:10085984-10086006 TCTTCTGGTCCCACATAGAGTGG + Intronic
1005179164 6:23084023-23084045 GCTTCTGGTGGCTCACAGCAAGG - Intergenic
1006503453 6:34473040-34473062 GCTTCTGGAGCCAGACTGCATGG - Intronic
1007374501 6:41447048-41447070 GACTCTGGAGCCAGACAGCGTGG + Intergenic
1008506659 6:52237288-52237310 GGTTCTGGAGCCACACAGCCTGG + Intronic
1010563142 6:77375629-77375651 GGTTCTGGAGCCACACTGCTTGG - Intergenic
1010702629 6:79068894-79068916 GATACTGGTGCCAAACAGCAGGG - Intronic
1013432037 6:110064005-110064027 GCTTCTTGTGGCCCACAGCCCGG - Intergenic
1018494688 6:164337473-164337495 GCTTCTGGTGCCGCACTCCCTGG - Intergenic
1020715202 7:11665741-11665763 GCTTTTGGTCCCACACAACCTGG - Intronic
1021587854 7:22228849-22228871 GCCTCTGGGGCCACACTGCCTGG - Intronic
1022973937 7:35540036-35540058 GCTTCTGCTGCCACCCTTCGTGG + Intergenic
1022992296 7:35720476-35720498 GCTTCTGATTCCACACCGCGAGG + Intergenic
1023847912 7:44133398-44133420 CCTTCTGGTGCCTCAAAGCTAGG + Intergenic
1028985420 7:97005383-97005405 GCCCCGGGCGCCACACAGCGCGG + Intergenic
1031887073 7:127253737-127253759 GCTCGAGGTACCACACAGCGCGG + Intergenic
1032083068 7:128869670-128869692 GCTGCTGGAGCTGCACAGCGCGG - Intronic
1032238672 7:130144445-130144467 GTTGCTGGTTACACACAGCGAGG - Intergenic
1033714536 7:143986043-143986065 GCTTTTGTTGACACACAGCAAGG + Intergenic
1034507621 7:151506853-151506875 GCTGGTGGTGCTACACAGCTGGG + Intronic
1034644544 7:152633572-152633594 GCTTCTGGAGCAACACTGCATGG - Intergenic
1035361676 7:158317677-158317699 GCTACTGCTTCCACACAGGGCGG + Intronic
1035422659 7:158742312-158742334 CCCTCTGGTGCCACACAACCTGG + Intronic
1038650156 8:29395109-29395131 CCTCCTGGTCCCACACAGAGAGG + Intergenic
1039656347 8:39412114-39412136 GCTTCAGGTGTGACACAGCAGGG + Intergenic
1040986274 8:53297219-53297241 GCATCTGGTCCCATACAGAGTGG + Intergenic
1049755127 8:144308029-144308051 ACTTCTAGTGCCACACCACGGGG + Intronic
1057171313 9:92964901-92964923 GCTTCTGGAGACACACTGTGTGG - Intronic
1060519411 9:124285765-124285787 GGTTCTGGAGCCACACAACCGGG + Intronic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1061193384 9:129094864-129094886 GCCTCTGGTTCCACTCAGCTTGG - Exonic
1062004718 9:134233428-134233450 GCTTCTGGTGGCACCCTGTGGGG - Intergenic
1062476346 9:136729261-136729283 GCTGGTGGGGCCACACAGGGAGG - Intergenic
1062617754 9:137405610-137405632 GCTTCTGCTGCCTTACAGAGTGG - Intronic
1203781967 EBV:105763-105785 GCACCGGGCGCCACACAGCGAGG - Intergenic
1186744025 X:12547298-12547320 GCTTCTGGAGCCAGACTGTGTGG - Intronic
1187261375 X:17687785-17687807 GCTGCTGGTGCCACGGGGCGCGG - Exonic
1191690801 X:63935972-63935994 GCCTCTGGAGCCACACTGCCTGG - Intergenic
1193328366 X:80207914-80207936 GCTTCTGTTGCCCCACAAAGAGG - Intergenic