ID: 934882538

View in Genome Browser
Species Human (GRCh38)
Location 2:97996092-97996114
Sequence CTTCACGGCCAGACAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934882534_934882538 -2 Left 934882534 2:97996071-97996093 CCCGCTCTCGGAGGCCTGCGGCT 0: 1
1: 0
2: 2
3: 9
4: 135
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882524_934882538 19 Left 934882524 2:97996050-97996072 CCCTGGGCCCCACCTCCTCGTCC 0: 1
1: 0
2: 7
3: 55
4: 583
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882519_934882538 29 Left 934882519 2:97996040-97996062 CCCCGGAGCCCCCTGGGCCCCAC 0: 1
1: 0
2: 3
3: 43
4: 461
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882535_934882538 -3 Left 934882535 2:97996072-97996094 CCGCTCTCGGAGGCCTGCGGCTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882532_934882538 4 Left 934882532 2:97996065-97996087 CCTCGTCCCGCTCTCGGAGGCCT 0: 1
1: 0
2: 1
3: 6
4: 97
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882521_934882538 27 Left 934882521 2:97996042-97996064 CCGGAGCCCCCTGGGCCCCACCT 0: 1
1: 0
2: 5
3: 63
4: 638
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882526_934882538 12 Left 934882526 2:97996057-97996079 CCCCACCTCCTCGTCCCGCTCTC 0: 1
1: 0
2: 5
3: 50
4: 612
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882528_934882538 10 Left 934882528 2:97996059-97996081 CCACCTCCTCGTCCCGCTCTCGG 0: 1
1: 0
2: 2
3: 31
4: 362
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882520_934882538 28 Left 934882520 2:97996041-97996063 CCCGGAGCCCCCTGGGCCCCACC 0: 1
1: 0
2: 9
3: 78
4: 710
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882527_934882538 11 Left 934882527 2:97996058-97996080 CCCACCTCCTCGTCCCGCTCTCG 0: 1
1: 0
2: 0
3: 13
4: 206
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882523_934882538 20 Left 934882523 2:97996049-97996071 CCCCTGGGCCCCACCTCCTCGTC 0: 1
1: 0
2: 3
3: 58
4: 522
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882522_934882538 21 Left 934882522 2:97996048-97996070 CCCCCTGGGCCCCACCTCCTCGT 0: 1
1: 0
2: 3
3: 33
4: 497
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882525_934882538 18 Left 934882525 2:97996051-97996073 CCTGGGCCCCACCTCCTCGTCCC 0: 1
1: 0
2: 4
3: 89
4: 1085
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
934882530_934882538 7 Left 934882530 2:97996062-97996084 CCTCCTCGTCCCGCTCTCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934882538 Original CRISPR CTTCACGGCCAGACAGAACC AGG Intergenic
900198554 1:1390603-1390625 CTTCACGGCCAGCAAGACTCAGG + Intronic
905731327 1:40301158-40301180 CATCAGGCCCAGACAGAGCCTGG - Exonic
908097702 1:60757735-60757757 GTCCAGAGCCAGACAGAACCGGG + Intergenic
908581439 1:65521353-65521375 CTCAAAGGCCTGACAGAACCAGG + Intronic
909931236 1:81502501-81502523 CATCATGGCCAAACAGATCCTGG + Intronic
910219498 1:84876218-84876240 CTTTACTACCAGACAGAACACGG - Intronic
914984702 1:152446480-152446502 CTTCCTGGCCAGACAGCATCAGG - Intergenic
915328517 1:155093774-155093796 CTTCAGGGCCTGGCAGGACCTGG + Intergenic
918662622 1:187108039-187108061 CTTCAAGGACAGAAATAACCTGG - Intergenic
919777810 1:201205613-201205635 CTTCTCATCCAGACTGAACCTGG - Intronic
920869830 1:209784694-209784716 CTTTCCGGCCAGACTGAACGCGG + Intergenic
924950267 1:248875729-248875751 CTACACGATCAGACGGAACCAGG + Intergenic
1063076252 10:2719609-2719631 CTTCAGGGCCAGACAAAAGGCGG + Intergenic
1069373290 10:67769092-67769114 CTGAAAGGGCAGACAGAACCAGG + Intergenic
1072219630 10:93316473-93316495 CTTCACAGACAGACAGGAGCTGG + Intronic
1077309938 11:1883811-1883833 CGTCAGGGCCACAGAGAACCTGG + Intronic
1084192655 11:67505819-67505841 CTACACGCCCAGGCAGAAACGGG + Intronic
1084934868 11:72581461-72581483 CTTCACCATCAAACAGAACCTGG + Exonic
1085508225 11:77072113-77072135 TTTCAGGGCCAGCCACAACCTGG + Intronic
1089406396 11:118201099-118201121 CCTCAGGGCCAGACAGCACTAGG + Intronic
1092448732 12:8582559-8582581 CTTAATGGCCAATCAGAACCTGG - Intergenic
1092999693 12:13982390-13982412 CTTGAAGGCAAGAAAGAACCCGG - Intergenic
1094409733 12:30156519-30156541 ATTCAAGGCCAGACAGAAAAAGG + Intergenic
1097042432 12:56163828-56163850 CACCACAGACAGACAGAACCGGG + Intronic
1098841783 12:75486122-75486144 CTTCATGGCCAGGCAGAATTAGG + Intronic
1101345623 12:103883398-103883420 CTGCAGGGCCAGACAGACCAAGG + Intergenic
1102875543 12:116445936-116445958 CTTCAGGGCTACACAGAAACAGG - Intergenic
1103039933 12:117686483-117686505 CTTTGGGGTCAGACAGAACCAGG - Intronic
1106235027 13:27854097-27854119 CTTAATGGCCAGCCAGAAGCTGG - Intergenic
1106704065 13:32261780-32261802 CCTCACAGCCAGCCAGATCCTGG + Exonic
1113748070 13:112759289-112759311 CTTCAGAGCAAGACAGATCCAGG - Intronic
1114483334 14:23048321-23048343 CATCACGGCCTTGCAGAACCCGG - Exonic
1119188265 14:72660450-72660472 CCTCTAGGTCAGACAGAACCAGG - Intronic
1119193734 14:72702101-72702123 CTTCAAGGGCAGACAGACCAGGG - Intronic
1129294029 15:74589842-74589864 CATCATGGCCAAACAGATCCTGG + Exonic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1141764378 16:86048901-86048923 CTTTACAGCCACTCAGAACCGGG - Intergenic
1145118146 17:20231185-20231207 CTCCAAGGGCAGACAGAACCCGG - Intronic
1148888105 17:50788180-50788202 CTCCATGTGCAGACAGAACCTGG + Intergenic
1149746628 17:59105668-59105690 CTGTAGGGCCAGAAAGAACCTGG + Intronic
1153944200 18:10004298-10004320 CTTCACGCCCAGAAAGAAGAAGG - Intergenic
1155405690 18:25484486-25484508 CTAGACGGACAGACAGAAGCTGG - Intergenic
1156584396 18:38415815-38415837 CTTCACGGGCAGACTGCTCCAGG + Intergenic
1157447289 18:47755070-47755092 AGGCAGGGCCAGACAGAACCGGG + Intergenic
1157587989 18:48817402-48817424 CTGCACAGCCAGACAGCACCAGG + Intronic
1157715409 18:49882281-49882303 TTTCACAGCCACACAGATCCTGG + Intronic
1160333761 18:78018486-78018508 CTGCAAGGCCAGGCAGAGCCCGG + Intergenic
1161590959 19:5128923-5128945 CTGCAAGGCCAGACAGGACCTGG + Intronic
1161683423 19:5691758-5691780 ATTCACGACCAGGCAGCACCCGG - Intronic
1164398829 19:27889012-27889034 CTTCAGAGCCAGGCAGGACCTGG - Intergenic
1164701152 19:30285557-30285579 ATTCACTGGCAGACAGAAGCAGG - Intronic
1167488946 19:49780921-49780943 CTTCTCCTCCAAACAGAACCTGG - Intronic
1167768108 19:51497547-51497569 CTTCCCGGACAGAAAGAACAAGG + Intronic
925754661 2:7121964-7121986 CTTCACGGCTAGAGGGAACTTGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933842234 2:86297193-86297215 CTTCACAGCCAGGCAGAACAGGG - Intronic
934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG + Intergenic
935254762 2:101299934-101299956 CTTCACAGCCAGACAGACCTGGG + Intronic
937640827 2:124209156-124209178 CTTCAAGGCCCTACACAACCAGG + Intronic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
944049889 2:195455612-195455634 CTACACTGTCAGGCAGAACCAGG + Intergenic
948307232 2:236957353-236957375 CTTCAGCTCCAGACATAACCAGG + Intergenic
948565816 2:238885280-238885302 CTTCAGTGCCACACAGTACCTGG + Intronic
1168977100 20:1974934-1974956 CTTCAAGTCCAGACAGAGCATGG + Intergenic
1172184651 20:33023764-33023786 CTCCAGGGACAGACAGAACCTGG - Intergenic
1174547467 20:51336366-51336388 CTTTAGGGCCTAACAGAACCTGG - Intergenic
1175493554 20:59395908-59395930 CTTCAGGGACAGCCAGCACCAGG - Intergenic
1175493560 20:59395936-59395958 CTTCAGGGACAGCCAGCACCAGG - Intergenic
1175878306 20:62241541-62241563 CTGCACGGCCAGACAAGACATGG - Intronic
1176379760 21:6106353-6106375 CTTCACGGCCTGACACGGCCAGG - Intergenic
1179743714 21:43431884-43431906 CTTCACGGCCTGACACGGCCAGG + Intergenic
1181012789 22:20052272-20052294 CTTCAAGGCCAGGCAGCCCCTGG - Intronic
950765526 3:15270253-15270275 ATTCATGGCAAGTCAGAACCAGG + Intronic
961543564 3:127617070-127617092 CTCCTCGGTCAGCCAGAACCAGG - Exonic
961575536 3:127833066-127833088 CTGGAAGGCCACACAGAACCTGG - Intergenic
963934113 3:151034867-151034889 CTTCACGGCCACTAAGAACATGG + Intergenic
965246463 3:166277626-166277648 CTTCACATACAGACAGATCCAGG + Intergenic
967320405 3:188189703-188189725 CTTCCCAGCCAGACTGAAGCAGG - Intronic
969672687 4:8598432-8598454 CTTCACCTCCAGCCAAAACCTGG - Intronic
971651632 4:29283081-29283103 TTTCACGGCCCGACAGGCCCTGG - Intergenic
985651200 5:1108587-1108609 CTACTCGGCAGGACAGAACCTGG + Intronic
985845077 5:2338528-2338550 CTGCACCACCTGACAGAACCGGG - Intergenic
986436922 5:7743312-7743334 CTTCACTGCCAGTGAGATCCTGG - Intronic
992273336 5:75088705-75088727 CCTCAAGGCCAGCCAGAACCAGG - Intronic
992965278 5:81993095-81993117 CTTCACAGTCAGACAGATCCAGG + Intronic
1003567959 6:7236381-7236403 CCTCACTGCCAGATAGAAGCAGG - Intronic
1006509532 6:34514650-34514672 CTTCACGGCCACAGAGACGCTGG - Intronic
1007623678 6:43229945-43229967 GCTCAAGGTCAGACAGAACCAGG + Intergenic
1010408152 6:75529018-75529040 CTTCACTGCTAGACAACACCGGG + Intergenic
1015710354 6:136132427-136132449 CTTCAAGGTCAGAAAGACCCAGG + Intronic
1020280709 7:6648674-6648696 ATTCACACCCAGACAGAGCCCGG + Intronic
1022389246 7:29929076-29929098 CTTGAGGGCCAGACAGCACTCGG + Intronic
1023051146 7:36252309-36252331 CTTCACCGCCAGAATAAACCTGG - Intronic
1025969677 7:66310599-66310621 CTTCATGGGCAACCAGAACCAGG - Intronic
1029571851 7:101375145-101375167 AGTCAGGGCCACACAGAACCTGG - Intronic
1035543201 8:458150-458172 CTGCACAGCGTGACAGAACCAGG - Intronic
1035604306 8:919637-919659 CTTCTCGGCCGGACGGATCCCGG - Intergenic
1036822984 8:11954744-11954766 CCTCACCACCAGACAGACCCAGG + Intergenic
1037839196 8:22231965-22231987 CTGCACAGCCAGACAGGAGCTGG - Exonic
1039440969 8:37595111-37595133 CTGCATGTCCAGACAGATCCGGG + Intergenic
1046264665 8:111815174-111815196 CTTCCCAGCCATACAGAACTGGG - Intergenic
1049030354 8:140031960-140031982 AGTCGAGGCCAGACAGAACCTGG + Intronic
1051897114 9:21998434-21998456 CTTCATGGCCAGCAAGAGCCAGG + Intronic
1061371927 9:130202163-130202185 CAACAGGGCCAGACTGAACCAGG - Intronic
1062410804 9:136423270-136423292 CTCCCCGGCCTGACAGACCCAGG + Exonic
1195603948 X:106780778-106780800 CTTTAAAGCCAGATAGAACCTGG + Intronic