ID: 934884412

View in Genome Browser
Species Human (GRCh38)
Location 2:98012046-98012068
Sequence AAGAAGTAGAAGGAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934884407_934884412 17 Left 934884407 2:98012006-98012028 CCCACTGCTAATGGAGGGAGGAA No data
Right 934884412 2:98012046-98012068 AAGAAGTAGAAGGAGCAGGAAGG No data
934884408_934884412 16 Left 934884408 2:98012007-98012029 CCACTGCTAATGGAGGGAGGAAG No data
Right 934884412 2:98012046-98012068 AAGAAGTAGAAGGAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934884412 Original CRISPR AAGAAGTAGAAGGAGCAGGA AGG Intergenic
No off target data available for this crispr