ID: 934886465

View in Genome Browser
Species Human (GRCh38)
Location 2:98029706-98029728
Sequence TTTCTCTTATCAATAATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934886465_934886474 24 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886474 2:98029753-98029775 GGAAACTGATGGCATCACCCAGG No data
934886465_934886471 3 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886471 2:98029732-98029754 CGGAAGACAGAAGGGCCTGTGGG No data
934886465_934886469 -5 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886469 2:98029724-98029746 AGAAAAGGCGGAAGACAGAAGGG No data
934886465_934886476 26 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886476 2:98029755-98029777 AAACTGATGGCATCACCCAGGGG No data
934886465_934886475 25 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886475 2:98029754-98029776 GAAACTGATGGCATCACCCAGGG No data
934886465_934886472 13 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886472 2:98029742-98029764 AAGGGCCTGTGGGAAACTGATGG No data
934886465_934886468 -6 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886468 2:98029723-98029745 GAGAAAAGGCGGAAGACAGAAGG No data
934886465_934886470 2 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886470 2:98029731-98029753 GCGGAAGACAGAAGGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934886465 Original CRISPR TTTCTCTTATCAATAATAAA TGG (reversed) Intergenic
No off target data available for this crispr