ID: 934886468

View in Genome Browser
Species Human (GRCh38)
Location 2:98029723-98029745
Sequence GAGAAAAGGCGGAAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934886465_934886468 -6 Left 934886465 2:98029706-98029728 CCATTTATTATTGATAAGAGAAA No data
Right 934886468 2:98029723-98029745 GAGAAAAGGCGGAAGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934886468 Original CRISPR GAGAAAAGGCGGAAGACAGA AGG Intergenic
No off target data available for this crispr