ID: 934888588

View in Genome Browser
Species Human (GRCh38)
Location 2:98046459-98046481
Sequence CTGTATGGTCTAATAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934888581_934888588 1 Left 934888581 2:98046435-98046457 CCATGGCAACATCAGGAAGTTAC 0: 321
1: 501
2: 713
3: 770
4: 745
Right 934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG No data
934888576_934888588 29 Left 934888576 2:98046407-98046429 CCACCAGCACCATGACAGTATAC No data
Right 934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG No data
934888577_934888588 26 Left 934888577 2:98046410-98046432 CCAGCACCATGACAGTATACAAA No data
Right 934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG No data
934888578_934888588 20 Left 934888578 2:98046416-98046438 CCATGACAGTATACAAATGCCAT No data
Right 934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG No data
934888575_934888588 30 Left 934888575 2:98046406-98046428 CCCACCAGCACCATGACAGTATA No data
Right 934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934888588 Original CRISPR CTGTATGGTCTAATAAGGGG AGG Intergenic
No off target data available for this crispr