ID: 934892508

View in Genome Browser
Species Human (GRCh38)
Location 2:98083049-98083071
Sequence TTCTTCACTCCTCAAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934892500_934892508 25 Left 934892500 2:98083001-98083023 CCAGCCCTAATTCTTTTAATGTT No data
Right 934892508 2:98083049-98083071 TTCTTCACTCCTCAAGAGGGGGG No data
934892502_934892508 20 Left 934892502 2:98083006-98083028 CCTAATTCTTTTAATGTTAAACT No data
Right 934892508 2:98083049-98083071 TTCTTCACTCCTCAAGAGGGGGG No data
934892501_934892508 21 Left 934892501 2:98083005-98083027 CCCTAATTCTTTTAATGTTAAAC No data
Right 934892508 2:98083049-98083071 TTCTTCACTCCTCAAGAGGGGGG No data
934892499_934892508 26 Left 934892499 2:98083000-98083022 CCCAGCCCTAATTCTTTTAATGT No data
Right 934892508 2:98083049-98083071 TTCTTCACTCCTCAAGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934892508 Original CRISPR TTCTTCACTCCTCAAGAGGG GGG Intergenic
No off target data available for this crispr