ID: 934896516

View in Genome Browser
Species Human (GRCh38)
Location 2:98124455-98124477
Sequence GATCCTAGGAGGGATCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934896505_934896516 17 Left 934896505 2:98124415-98124437 CCCTGAAACCTGGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 20
4: 314
Right 934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 151
934896506_934896516 16 Left 934896506 2:98124416-98124438 CCTGAAACCTGGGAGGCCAGAAA 0: 1
1: 1
2: 6
3: 69
4: 430
Right 934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 151
934896511_934896516 0 Left 934896511 2:98124432-98124454 CCAGAAAGTCGGTGGTGGTCAAG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 151
934896508_934896516 9 Left 934896508 2:98124423-98124445 CCTGGGAGGCCAGAAAGTCGGTG 0: 1
1: 0
2: 1
3: 10
4: 163
Right 934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934896516 Original CRISPR GATCCTAGGAGGGATCTGAG AGG Intronic
903046295 1:20566546-20566568 GATCCAAGGAGGGGAGTGAGTGG + Intergenic
903768507 1:25749729-25749751 GATGCTGAGTGGGATCTGAGTGG - Intronic
904396186 1:30224111-30224133 GACCCTCTGAGGGAGCTGAGAGG + Intergenic
904590782 1:31614304-31614326 GAGCCTAGGAGGCCACTGAGCGG - Intergenic
905217353 1:36418252-36418274 GGTCCTATGAGGGAAATGAGAGG + Exonic
906516060 1:46439515-46439537 GATCCTAGAGGGGGGCTGAGAGG - Intergenic
912869231 1:113288733-113288755 GATCATAGGGGTGAGCTGAGGGG - Intergenic
913007823 1:114652042-114652064 CATCCTAGGAGGGAGCCGACTGG + Intronic
915446041 1:155975598-155975620 GAGCCCAGGAGGGAGCTGAGAGG - Intronic
915446640 1:155978136-155978158 GATCCCGGGAGGGAGCGGAGCGG - Intronic
915660886 1:157403942-157403964 GCTCCTAAGAGGGATCTCAGGGG + Intergenic
916599990 1:166283349-166283371 GATCCTAGCAGGGCTGAGAGAGG - Intergenic
917959123 1:180128538-180128560 GATCCTGGGGTGGGTCTGAGTGG - Intergenic
918949835 1:191123163-191123185 GATTCAAGATGGGATCTGAGTGG + Intergenic
922899486 1:229124895-229124917 GATCCTAGCAGCTTTCTGAGTGG + Intergenic
923631251 1:235650293-235650315 GATCACTGGAGGGATCTGCGGGG + Intronic
924668088 1:246094363-246094385 TACCCTAGGAGGGCTCTGATAGG + Intronic
1063964137 10:11332667-11332689 GATCCTAACAGGGTGCTGAGCGG - Exonic
1066229418 10:33417896-33417918 GTTCCCAGGAGTGGTCTGAGGGG + Intergenic
1071294184 10:84207283-84207305 AAACCCAGGAGGGATCAGAGAGG + Intronic
1072786358 10:98285776-98285798 CCTGCTAGGAGAGATCTGAGGGG - Intergenic
1072829280 10:98640380-98640402 GATCCCTGGAGGGATCAGATTGG + Intronic
1073134033 10:101209759-101209781 GCTCCTGGGAGGCTTCTGAGAGG + Intergenic
1074139700 10:110661168-110661190 TATCCTAGGTGGGCTCAGAGAGG - Intronic
1076459657 10:130632902-130632924 GATCAGAGGTGGGAGCTGAGTGG + Intergenic
1077472349 11:2769954-2769976 GACCCTAGCAGGGAGCTCAGTGG - Intronic
1077472889 11:2772512-2772534 TATCCTAGCAGGCATCTCAGTGG + Intronic
1078351928 11:10601987-10602009 GATCCTCTGAGGGATCTAACTGG - Intronic
1078434431 11:11312744-11312766 GCTGCTAGGAGGGCTCTGTGAGG + Intronic
1080449182 11:32364569-32364591 GTGCCTAGGAGAGATCGGAGTGG + Intergenic
1081538341 11:44012007-44012029 GATGCTAGGAGGGATGTGGGAGG + Intergenic
1082090332 11:48083856-48083878 GATCCTTTTAGGGATCTGTGAGG + Intronic
1085738144 11:79057225-79057247 GAGCCACGGAGGGTTCTGAGTGG - Intronic
1088070839 11:105782718-105782740 GTTCCTTGGTGGGATCTGAGAGG - Intronic
1088699540 11:112399875-112399897 GATCATAGGAGGGATCGATGGGG - Intergenic
1089395688 11:118135400-118135422 GCCCCTAGGAGGGATGAGAGAGG - Exonic
1090480021 11:127059814-127059836 GCTCACAGGAGGAATCTGAGTGG + Intergenic
1092152599 12:6261301-6261323 GGTCCAAGGATGGAGCTGAGAGG + Intergenic
1092435049 12:8440952-8440974 GATACTAGGAAGGATATCAGAGG - Intergenic
1096261740 12:50096978-50097000 GAACCTAGGAGAGGTCTGAAGGG + Intronic
1097154091 12:57000235-57000257 GATCCTATGACGTATCTGACTGG + Exonic
1098311900 12:69156993-69157015 GACCCCAGAAGGGGTCTGAGGGG - Intergenic
1101851932 12:108410222-108410244 ACTCCTAGGAGAGAGCTGAGTGG - Intergenic
1102702872 12:114854887-114854909 TATCATAGGAGGGACCTGATGGG - Intergenic
1103037542 12:117668397-117668419 GATCATAGGCTGGATCTGATGGG + Intronic
1107049440 13:36031865-36031887 GGGCCTAGCAGGGATCTGGGTGG - Intronic
1107188495 13:37550677-37550699 TATCCTAGGAGGGACCCGATGGG + Intergenic
1108586816 13:51877058-51877080 GTTCCTAGGAGTGGCCTGAGAGG + Intergenic
1116037281 14:39642705-39642727 GATTCTAGGAGGCTTCTGAGTGG + Intergenic
1119437262 14:74605577-74605599 GGGGCTAGGAGGGCTCTGAGAGG + Intronic
1121904840 14:97730259-97730281 GTTCCTTTGAGGGATTTGAGAGG + Intergenic
1124348708 15:28939920-28939942 GATCCACGGAGGCAGCTGAGGGG + Intronic
1127260779 15:57324530-57324552 GAGGATAGGAGGGACCTGAGAGG - Intergenic
1127462119 15:59208834-59208856 GATGCCAGGAGGGTTCTGATGGG + Exonic
1129523450 15:76199877-76199899 CTTCCCAGGAGGGATGTGAGGGG + Intronic
1130555298 15:84918396-84918418 GATCCTGTCAGGCATCTGAGTGG + Intronic
1131318747 15:91366337-91366359 GATGGTAGGAGGGCTCTTAGTGG - Intergenic
1138265087 16:55654823-55654845 GATCCAAGGAGGCTTCAGAGAGG - Intergenic
1142129062 16:88424432-88424454 GATCCTGGCAGGGATGGGAGGGG + Intergenic
1142759172 17:2033529-2033551 GATCTCAGGGGGGATCTGATTGG - Exonic
1142878394 17:2866240-2866262 CAGCCAAGGTGGGATCTGAGCGG - Intronic
1146552529 17:33794116-33794138 GCTCCTAGGAGGCAGCTCAGTGG - Intronic
1147864717 17:43545008-43545030 GATCCTGGAAGAGATCTGAGGGG + Exonic
1152278665 17:79372564-79372586 CATCCTGGCAGGGATCTGGGGGG - Intronic
1152684522 17:81687507-81687529 GGGCCTGGGAGGGCTCTGAGCGG + Intronic
1153410681 18:4789338-4789360 GCCCCTAGGAGGTATCTGGGGGG - Intergenic
1153415390 18:4840731-4840753 TATCCTGGAAAGGATCTGAGTGG - Intergenic
1155220813 18:23684023-23684045 GCTTCTAGGAGGACTCTGAGAGG - Intergenic
1156960448 18:43022285-43022307 GATGCTAGGAAGGGTGTGAGTGG + Intronic
1159089357 18:63830272-63830294 GATCCTTGGAAGGACCTAAGGGG - Intergenic
1162087512 19:8257379-8257401 CCTCCAAGGAGGGAGCTGAGAGG - Intronic
1162844496 19:13381918-13381940 GAGCCATGGAGGGTTCTGAGGGG + Intronic
1162982714 19:14249332-14249354 GAACCTCGGAGGGTTCTGGGGGG - Intergenic
1166120081 19:40681054-40681076 GATCCTAGGAGGGGCCGGGGAGG + Exonic
1167587014 19:50380955-50380977 GAGCCGCGGAGGGTTCTGAGCGG - Intronic
925633737 2:5922203-5922225 GTTCCTGGCAGGGAGCTGAGTGG - Intergenic
927417542 2:22894315-22894337 GCCTCTAGGAGGAATCTGAGTGG - Intergenic
932091735 2:68811798-68811820 GGTCCTAGGAGGGAAGGGAGGGG - Intronic
932233606 2:70103105-70103127 GATCCTTTCAGGGGTCTGAGAGG - Intergenic
934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG + Intronic
935422229 2:102881091-102881113 GAACCCAGGATGGATCAGAGTGG + Intergenic
937849021 2:126616608-126616630 GATCATAGGAGGGAATTCAGAGG + Intergenic
939870996 2:147525707-147525729 GACCCTAGGATGGATATTAGAGG - Intergenic
940846751 2:158650645-158650667 CTTCCTAGGAGGGAGCTGTGTGG - Intronic
943022976 2:182597514-182597536 GGTCCTGGGAGGGTCCTGAGAGG + Intergenic
945180738 2:207088541-207088563 GCTCATGGGAGGGATGTGAGTGG - Exonic
1169252759 20:4072906-4072928 GATCCCTGGAGGAATCTGTGTGG + Intronic
1172898879 20:38319796-38319818 GATGCTGGGAGGGTTTTGAGAGG - Intronic
1177684863 21:24422844-24422866 GAACCAAGGTAGGATCTGAGGGG - Intergenic
1178040887 21:28639931-28639953 GAAACCAGCAGGGATCTGAGGGG + Intergenic
1178587970 21:33885715-33885737 GCTTCTCCGAGGGATCTGAGTGG + Intronic
1178865130 21:36320552-36320574 GAGACTAGGAGGGAGCTGGGAGG - Intronic
1179585195 21:42370203-42370225 GATCCCAGGAGGGATCCTGGAGG - Intergenic
1182015012 22:27032258-27032280 GATCCTAGGAGGCGTGGGAGAGG + Intergenic
1184515984 22:44963080-44963102 GTTACGAGGAGGGATCTGGGGGG - Intronic
949392362 3:3577340-3577362 GAGCTGAGGAGGGGTCTGAGGGG - Intergenic
949589481 3:5478992-5479014 GATTCTAGGAAAGATCAGAGAGG - Intergenic
950905854 3:16537168-16537190 GATCATAGGAGGGACTTGTGTGG - Intergenic
951273323 3:20654587-20654609 TATTTTAGGAGGGATCTAAGTGG - Intergenic
954386593 3:50247269-50247291 GATCTCAGGAAGGATCAGAGTGG + Intronic
955746246 3:62143069-62143091 GAGCCTGGCAGGGATCTGAGCGG - Intronic
959560308 3:107772204-107772226 GATCCTAGGACCTATCTCAGAGG - Intronic
959786206 3:110301510-110301532 GTTATCAGGAGGGATCTGAGAGG + Intergenic
960405490 3:117254223-117254245 CATGTTTGGAGGGATCTGAGTGG - Intergenic
966157952 3:176937796-176937818 CATCCTAGAAAGAATCTGAGAGG + Intergenic
970113682 4:12668779-12668801 GAAACTAGGTGGGAACTGAGGGG + Intergenic
970604352 4:17665611-17665633 GATCCTGGGAGGTGTCTCAGGGG + Intronic
971085508 4:23270662-23270684 GAGCATGGGAGGGATGTGAGGGG + Intergenic
974897721 4:67958819-67958841 TGTCGTAGGAGGGATCTGATGGG + Intronic
976234397 4:82880833-82880855 TATCCAAGGATGGATCAGAGAGG + Exonic
977359655 4:95985992-95986014 GATCATCTGAGGGATCTCAGGGG - Intergenic
985559251 5:574214-574236 GATCCTGGCCAGGATCTGAGAGG + Intergenic
986838035 5:11663908-11663930 GATACTAAAAGGGATCTGATTGG + Intronic
987824950 5:23019175-23019197 GATAAAAGGATGGATCTGAGAGG - Intergenic
990140294 5:52695408-52695430 GATATTAGGAGACATCTGAGAGG - Intergenic
992230286 5:74657043-74657065 GAGCCTTAGAGGGAGCTGAGAGG - Intronic
994001707 5:94788950-94788972 GATCCATGGAAGGATTTGAGGGG + Intronic
996449089 5:123598199-123598221 GATTCTAAGAGGGAACCGAGAGG - Intronic
998113207 5:139517842-139517864 GATCCAATGTGGGATCTAAGGGG + Intergenic
1001883797 5:175270388-175270410 GACCATAGGACGGATCTGTGTGG - Intergenic
1002278017 5:178115535-178115557 GATGCAAGGTGGGATCCGAGAGG + Intronic
1005307378 6:24527044-24527066 GATCCTAGGAGATTTCAGAGAGG + Intronic
1005397226 6:25395891-25395913 GATCCTAGGAGCCATCCAAGTGG - Intronic
1006463507 6:34177477-34177499 GACCCCAGGTGGGAGCTGAGAGG - Intergenic
1006636901 6:35467663-35467685 AATCCGAGGAGAGATCTGAAGGG + Intergenic
1014986643 6:128019499-128019521 GAATCTGGGAGGGTTCTGAGAGG + Intronic
1016856350 6:148674294-148674316 GATCCAAGGTGGTCTCTGAGAGG + Intergenic
1022127887 7:27375593-27375615 GACACTAGGAGGGCTCTGTGGGG - Intergenic
1022356875 7:29624044-29624066 GATGGTAGGTTGGATCTGAGTGG - Intergenic
1022384503 7:29888894-29888916 GCTCCTGGGAGGGTTTTGAGGGG - Intronic
1022894647 7:34737775-34737797 GATCCAAGCATTGATCTGAGGGG - Intronic
1023013065 7:35940410-35940432 CATCAGAGGAGGGATTTGAGAGG + Intergenic
1025126346 7:56347999-56348021 CATCAGAGGAGGGATTTGAGAGG + Intergenic
1029363483 7:100102808-100102830 GTAGCTAGGAGGGGTCTGAGAGG + Intronic
1029488212 7:100856098-100856120 GATGCTAGGATGGAGCTAAGAGG + Intronic
1031154505 7:118094055-118094077 GATACTGGGTAGGATCTGAGCGG + Intergenic
1033659026 7:143391230-143391252 GATCATGGGAGGGAGCTGAGGGG - Exonic
1034331459 7:150286862-150286884 GGCCATAGGAGGCATCTGAGAGG - Intronic
1034396938 7:150833459-150833481 GAGCCTAGGAGAGGTCTCAGAGG - Intronic
1034666584 7:152822999-152823021 GGCCATAGGAGGCATCTGAGAGG + Intronic
1037119141 8:15262264-15262286 GATCCTGGTAGGGATCATAGAGG - Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038871344 8:31497254-31497276 GATCCTAACAGGGAGCTTAGTGG - Intergenic
1039777368 8:40750466-40750488 GATACAGGGAGGGATCTGGGAGG - Intronic
1043172941 8:76987899-76987921 GATCCTATGAGACATCTAAGTGG + Intronic
1043886872 8:85611067-85611089 CATCCTAGGAAGGATCTAATTGG - Intergenic
1049005670 8:139854148-139854170 GACCCTGGGAGGGATTTGCGAGG + Intronic
1050654824 9:7816189-7816211 TAACCTAGGAGGCATGTGAGTGG - Intronic
1052796952 9:32931571-32931593 CCTCCCAGGAGGGATCTGGGCGG - Intergenic
1055730502 9:79275534-79275556 GATCCTAGGATGGATCTCTGAGG - Intergenic
1056169767 9:83973179-83973201 AATCTTTGGAGGGAACTGAGAGG + Intronic
1057786905 9:98094617-98094639 GCTCCCAGGAGCAATCTGAGGGG + Intronic
1058217722 9:102255641-102255663 TATCCTAGGAGGGACCTGGTGGG + Intergenic
1061038055 9:128124408-128124430 GCTCCCAGGAGGGAACTCAGGGG + Intronic
1061356684 9:130110836-130110858 GATCTCAGGAGTGAACTGAGGGG - Intronic
1061968885 9:134032934-134032956 GCTCCTCGGAGGGAACAGAGCGG - Exonic
1186935604 X:14447614-14447636 GATCCTAGGGGCAATCTTAGAGG + Intergenic
1188677336 X:32958167-32958189 GATCCAAGTGGTGATCTGAGTGG + Intronic
1192361667 X:70444838-70444860 GTCCCCAGGATGGATCTGAGTGG - Intergenic
1199357021 X:146874640-146874662 TGTCCTAGGAGGGACCTGATGGG + Intergenic
1200285941 X:154822453-154822475 GATCGGAGGAGGGATGTGAAGGG - Intergenic