ID: 934898306

View in Genome Browser
Species Human (GRCh38)
Location 2:98138096-98138118
Sequence ATGTGGAAGAGGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 2, 1: 0, 2: 7, 3: 97, 4: 952}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934898306_934898313 22 Left 934898306 2:98138096-98138118 CCATCCACTTTCCTCTTCCACAT 0: 2
1: 0
2: 7
3: 97
4: 952
Right 934898313 2:98138141-98138163 CTGAATGTCTGCCATCTCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 221
934898306_934898312 21 Left 934898306 2:98138096-98138118 CCATCCACTTTCCTCTTCCACAT 0: 2
1: 0
2: 7
3: 97
4: 952
Right 934898312 2:98138140-98138162 TCTGAATGTCTGCCATCTCTTGG 0: 1
1: 0
2: 0
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934898306 Original CRISPR ATGTGGAAGAGGAAAGTGGA TGG (reversed) Intronic
900479218 1:2890028-2890050 AGGTGGTAGAGGAAGGTGAAGGG + Intergenic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
902829325 1:19000063-19000085 AGGAGGAGGAGGAAAGGGGAGGG + Intergenic
902829884 1:19005570-19005592 AGGTGGCAGATGAAACTGGAGGG - Intergenic
903188484 1:21642792-21642814 ATGTGGAGGAGAAAAGTGTGTGG - Intronic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905498843 1:38419744-38419766 ATGTGGAGGAGCTGAGTGGAAGG - Intergenic
905893932 1:41533308-41533330 CTGTGGGAGAGGACAGTGGGTGG - Intronic
905954671 1:41982293-41982315 GTGCGGAAGAAGAAAATGGAAGG - Intronic
906268755 1:44457141-44457163 AGGAGGAAGAGGAGAGAGGAAGG - Intronic
906720866 1:48003518-48003540 ATGGGAATGAGGAAAGTGAAAGG + Intergenic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
907295210 1:53447070-53447092 GATTGGTAGAGGAAAGTGGAGGG - Intergenic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907597435 1:55732779-55732801 TTGGGGAAGAGGTATGTGGATGG + Intergenic
908420768 1:63956354-63956376 AAGCTGAAGAGGAAAGTGGATGG + Intronic
908737472 1:67291469-67291491 TTGGGGAAGAGGTATGTGGATGG + Intergenic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
908858857 1:68460319-68460341 ATATGAAAGAGGAAAGAAGAAGG - Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909577018 1:77186514-77186536 TTGGGGAAGAGGTATGTGGATGG + Intronic
909676209 1:78241657-78241679 CTGTGGAAGAAGCAACTGGAAGG - Intergenic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
910006782 1:82406982-82407004 ATTTGGAAGGCCAAAGTGGAAGG + Intergenic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910638896 1:89439318-89439340 ATGGGGAAGAGGTATATGGATGG - Intergenic
910730724 1:90392937-90392959 TTGGGCAAGAGGAGAGTGGAGGG - Intergenic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911257247 1:95646706-95646728 TTGGGGAAGAGGTATGTGGATGG - Intergenic
911620921 1:100065732-100065754 AAGGGGAAGAGAAAAGGGGAAGG - Intronic
911883663 1:103271119-103271141 TTGAGGAAGAGGCATGTGGATGG + Intergenic
911978491 1:104534564-104534586 AAGAGGAAAAGGAAAATGGAAGG + Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912157297 1:106937452-106937474 ACGTGGCAGTGGAAAGTAGAAGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912572991 1:110638103-110638125 ATGCCGAAGAGGAGAGGGGAGGG - Intergenic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
913078004 1:115357669-115357691 AAGTGGATGGGGAAAGTGGGAGG + Intergenic
913996568 1:143655631-143655653 ATATGAAAGAAGAGAGTGGAGGG - Intergenic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914393787 1:147245261-147245283 ATTTGGAAGGGGAAAGTGAGGGG + Intronic
914505685 1:148287180-148287202 ATATGAAAGAAGAGAGTGGAGGG + Intergenic
914506870 1:148296979-148297001 ATATGTAAGAAGAGAGTGGAGGG - Intergenic
914783465 1:150806873-150806895 ATGAGGAAGAGAAAGGTAGACGG + Intronic
914856651 1:151356921-151356943 ACTTGGAAGATGAAAGTGGGAGG + Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915366584 1:155320329-155320351 ATGTGAATGAGGGGAGTGGAGGG + Intronic
916003841 1:160641513-160641535 AAGAGGAAGAGGAAAAGGGAGGG + Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916339301 1:163710914-163710936 AAGGGGAAGAGGAAAGGGAAGGG - Intergenic
916339310 1:163710938-163710960 AAGGGGAAGAGGAAAGGGAAGGG - Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
916758130 1:167792529-167792551 CTATGCAAGAGGAAAGTGCAGGG - Intergenic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917217132 1:172690255-172690277 TTGGGGAAGAGGTATGTGGATGG - Intergenic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917834870 1:178933559-178933581 ACGTGGAAGAGGAGAGTCCATGG + Intergenic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918183976 1:182111125-182111147 AAGTGGAGGTAGAAAGTGGATGG + Intergenic
918206626 1:182315306-182315328 ATGTGGACTAGGAAGCTGGAGGG - Intergenic
918496962 1:185150948-185150970 AAATGGAAGAAGGAAGTGGAAGG + Intronic
918639634 1:186824078-186824100 ATGTGGAAGAGAATAGTAGAAGG + Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919914102 1:202129516-202129538 ATGTGGCACAAGAAAGTGGATGG - Exonic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
920197524 1:204239024-204239046 TTGGGGAAGAGGTATGTGGATGG + Intronic
920386866 1:205575713-205575735 AAGTGGGAGAGGGAAGAGGAAGG - Intronic
920442242 1:205989048-205989070 AGGTGGAATAGGATAGGGGAGGG - Intronic
920442921 1:205993389-205993411 ATGTTGAAGAGGGAAAAGGAGGG + Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
920913318 1:210237344-210237366 CTTTGGGAGAAGAAAGTGGAGGG + Intronic
920976644 1:210792066-210792088 AAGTGGAGGAGGAAAGAAGATGG - Intronic
921046318 1:211480227-211480249 ATCTGGAGGAAGAAAGGGGAGGG + Intronic
921097016 1:211895452-211895474 AAGAGGAAGAGGGAAGGGGAGGG - Intergenic
921425779 1:214999455-214999477 ATGAGGCAGAGAAAAGTGGGAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921742270 1:218699089-218699111 ATGTGGAAGATGAAATTAAATGG - Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
922388064 1:225108105-225108127 AACTGGCAGAGGAACGTGGAAGG + Intronic
922537093 1:226389428-226389450 TTATGGATGAGGAAAGTGCAAGG - Intronic
922684525 1:227628982-227629004 ATTTGGAAAAGCAAAGTGTAAGG + Intronic
922862175 1:228828666-228828688 CAGTGGAAGAGGAAACTGGCTGG + Intergenic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923402863 1:233632037-233632059 ACGTGGAAGAGGGAACAGGATGG - Intronic
924811387 1:247405614-247405636 ATGTGGGAGACCAAAGTGGGAGG - Intergenic
924813614 1:247424323-247424345 ATGAGGAAGAGGATTCTGGAGGG - Exonic
1063190103 10:3685687-3685709 ATGAAGAAGAGGAAAATGAAAGG - Intergenic
1063377752 10:5564165-5564187 AGGGGACAGAGGAAAGTGGATGG - Intergenic
1063777721 10:9283297-9283319 AGGTTGAAAAGGAAAGTGGCAGG - Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1064242971 10:13647255-13647277 TTGTGAAGGAGGAAAATGGAAGG + Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1065696834 10:28388127-28388149 AGGTGGAAGGGGAAAGGGAAGGG + Intergenic
1066166936 10:32798572-32798594 TTGGGGAAGAGGTATGTGGATGG - Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067333228 10:45340875-45340897 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068191898 10:53663323-53663345 ATGTGCAAGAGAAGAGTGGGTGG - Intergenic
1068272275 10:54744028-54744050 ATGTGCAAGAGAAAAGTCAAAGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068669270 10:59708259-59708281 ATTTGGTCCAGGAAAGTGGAAGG + Intronic
1069167039 10:65174032-65174054 ATGTGTATGAGAAAATTGGATGG - Intergenic
1069192218 10:65505714-65505736 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1069403179 10:68071056-68071078 CTGTGGAAGAGAAAAGTGACAGG - Intronic
1069408311 10:68126187-68126209 AGGTTGAAGAGGTAGGTGGAAGG + Intronic
1070509025 10:77142624-77142646 ATCTTGAAGAGGGAAGTAGATGG + Intronic
1070575420 10:77673526-77673548 AAGGGGAAGAGGAGAGTGAATGG - Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071266988 10:83973348-83973370 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1071345879 10:84692081-84692103 ATGTGGAGGTAGAACGTGGAGGG + Intergenic
1071409252 10:85372386-85372408 ATGTGGATGGGGGAAGTTGAGGG + Intergenic
1071822331 10:89291214-89291236 ATGAGGAAGAAGAGAATGGAGGG - Intronic
1072625134 10:97106352-97106374 ATGTGGAAGAGACTAGGGGAGGG + Intronic
1072893717 10:99347717-99347739 ACGTGGGAGAGGAAAGTAGTGGG - Intronic
1072972031 10:100025696-100025718 ATGTGGAGCTGGAAAGGGGATGG + Intergenic
1073557440 10:104466549-104466571 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1073638241 10:105221266-105221288 ATGTTGAAGGGGAAAGTGTTTGG - Intronic
1073656596 10:105423836-105423858 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1074174113 10:110978662-110978684 ATGTGGGAGAGGAGACTGCAAGG - Intronic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1074710049 10:116169681-116169703 ATGTGGAGCTGGAAAGGGGATGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075451436 10:122554470-122554492 ATGAGGACAAGGAAATTGGATGG - Intergenic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1075974779 10:126685827-126685849 ATGGGGAGGAGGAGATTGGATGG - Intergenic
1075993879 10:126860825-126860847 AAGTGGAAGAGGTCAGTGTAGGG - Intergenic
1076143896 10:128101438-128101460 AGGTGGCAGAGGAGAGCGGAGGG - Exonic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1076578174 10:131485597-131485619 ATGTGGAAGGGGAAATGGGTAGG + Intergenic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077838502 11:5946480-5946502 AGATGGAAAAGGAAACTGGAAGG + Intergenic
1078096726 11:8301954-8301976 ATGTGGATCAGGAAAGTGATGGG - Intergenic
1078359251 11:10655756-10655778 AGGTGGAGGAAGAAAGTAGAGGG - Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078639969 11:13085333-13085355 AGGTGGAAGAGGAAAAGGGTGGG - Intergenic
1079129236 11:17737876-17737898 AAGTTGCAGAGGAGAGTGGAGGG + Intronic
1079279748 11:19076563-19076585 ATAGGGATGAGGAAAGTGGATGG + Intergenic
1079365012 11:19801463-19801485 AAGAGGAAAAGGAAAGTGGGAGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1081374201 11:42339778-42339800 ATGTTGAAGAGGCAGCTGGATGG + Intergenic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1082168966 11:48978823-48978845 ATGTTGAAGATTCAAGTGGATGG - Intergenic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082850772 11:57762541-57762563 TTGTGGAAGTGGAAAGTTGCAGG + Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084776852 11:71382758-71382780 AGGAGGCAGAGGAGAGTGGAGGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1085824218 11:79826154-79826176 AAGATGAAGAGGAAAGTGGCTGG - Intergenic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1088002085 11:104894594-104894616 ATGTTGAATAGGCAAATGGATGG - Intergenic
1088005858 11:104939121-104939143 ATGGGGCAGAGGAAAGTGACTGG + Intergenic
1088097297 11:106115789-106115811 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088207109 11:107404831-107404853 GAGTAGAAGAGGAAAGTAGAGGG - Intronic
1088679685 11:112228290-112228312 ATGTTGAATTGAAAAGTGGAAGG + Intronic
1089302587 11:117507595-117507617 AGGTGGAAGATGACATTGGAAGG - Intronic
1089317140 11:117599918-117599940 AGGTGGAAGAGCACAGTGGAAGG + Intronic
1089680587 11:120116917-120116939 CTGTGGGAGAGAAAAGGGGAGGG + Intronic
1090234393 11:125136561-125136583 AGGAGGAAGAGGATAGAGGAAGG - Intergenic
1090851254 11:130572431-130572453 AGGTGAAAGAGGAAACTGGGAGG + Intergenic
1091156693 11:133381244-133381266 AAGTGGCAGAGGAAACTGGCAGG + Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091446472 12:546617-546639 GTGTGGAAGAGAGAAGAGGAGGG - Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091697087 12:2634998-2635020 ATTTGGAAGAGGAACGAGAAGGG + Intronic
1091920367 12:4299454-4299476 AAGTGGCAGAGAAAAGGGGAAGG - Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092672913 12:10883431-10883453 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1092672971 12:10884076-10884098 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093645809 12:21584303-21584325 TTGGGGAAGAGGTATGTGGATGG + Intronic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1094063628 12:26340836-26340858 TTGAGGAAGAGGGAAGTGGGAGG + Intronic
1094378476 12:29817188-29817210 ATCTGAAAGAAGAAATTGGAAGG + Intergenic
1094389706 12:29935591-29935613 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1094491237 12:30962222-30962244 AGGTGGAAGAGCCAGGTGGAAGG - Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095273328 12:40248922-40248944 ATGTGGAAGAGGCAACAGCATGG + Intronic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1095839358 12:46675443-46675465 TTGGGGATGAGGGAAGTGGAGGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096188416 12:49599084-49599106 ATGGGGCAGAGAAAAGTGGGAGG + Intronic
1096457374 12:51798816-51798838 TTGGGGAAGAGGTATGTGGATGG - Intronic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1096791734 12:54049187-54049209 ATGTGGAAGGGGAAAAATGAAGG - Intronic
1097077082 12:56403034-56403056 ACTTGGAAGAGGTATGTGGATGG + Intergenic
1097298323 12:57991198-57991220 AGGTGGGAGAGGAAAGAGCATGG + Intergenic
1097504052 12:60441965-60441987 ATGTTGAAGAGGAGAGGTGAGGG - Intergenic
1097564562 12:61251811-61251833 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1097843265 12:64342120-64342142 TTGGGGAAGAGGTATGTGGATGG - Intronic
1098231129 12:68372919-68372941 ATTTGGTAGAGAAAAGGGGAAGG + Intergenic
1098749929 12:74280228-74280250 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1099183297 12:79491971-79491993 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1100172134 12:91986980-91987002 AGGTGGAAGAGGGTAGAGGAAGG - Intronic
1100377360 12:94029802-94029824 ATGTGGTAGAGAAAACTTGATGG - Intergenic
1100638923 12:96462470-96462492 ATGTGGAATAGTAAAGCAGATGG + Intergenic
1101276678 12:103209736-103209758 ATGAGGAAGAGCAAGGCGGAGGG - Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101641161 12:106586586-106586608 AGATGGGAGCGGAAAGTGGATGG - Intronic
1102394265 12:112574254-112574276 AAGAGGAAGAGGAGAGTGGGAGG + Intronic
1102676636 12:114664026-114664048 ATGTGGAGGTGGAAGGTGTAGGG + Intergenic
1103035709 12:117654704-117654726 TTGGGGAAGAGGTATGTGGATGG + Intronic
1103246740 12:119464390-119464412 GGGAGGAAGAGGAAAGGGGAGGG - Intronic
1103701337 12:122850256-122850278 AGGTGGCAGAGGGCAGTGGAGGG - Intronic
1104184189 12:126413266-126413288 AAGAAGAAAAGGAAAGTGGAAGG + Intergenic
1104544506 12:129698743-129698765 AGGGGGAAGAGGAGAGGGGAGGG + Intronic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1106319349 13:28623816-28623838 ATGGGGAAGAGGAGAATTGAAGG + Intergenic
1106554768 13:30799937-30799959 GGGTGGAAGAGGAAAGGGAAGGG + Intergenic
1106693149 13:32141427-32141449 AAATGGAAGAGAAAACTGGAAGG + Intronic
1106898973 13:34334921-34334943 CTGAGGAAGAGGAGAGTGCAGGG + Intergenic
1107720029 13:43238632-43238654 AGGTGTAGGAAGAAAGTGGATGG + Intronic
1107823028 13:44303589-44303611 AGGTGGTAGAGGAAATAGGAAGG + Intergenic
1108415377 13:50193107-50193129 ATCTCGAAGAGGCAAGTGGAAGG - Intronic
1109335084 13:60983852-60983874 AAGTTGAAGAGGATTGTGGATGG - Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109788819 13:67220440-67220462 ATGTGAAATAGTAAAGTAGAGGG - Intronic
1109825113 13:67708961-67708983 ATATGGCAGAGAAAGGTGGAAGG + Intergenic
1109886891 13:68555288-68555310 ATTTGGGAGAGGATAGTGTATGG - Intergenic
1110377253 13:74807102-74807124 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1110740236 13:78986747-78986769 ATGTGAAAGAGGAAACTCCATGG - Intergenic
1110775446 13:79404183-79404205 AAGGGGAGAAGGAAAGTGGATGG - Intronic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1110834051 13:80063997-80064019 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1110932779 13:81243457-81243479 ATAGGGAAGGGGAAAGTGGTAGG - Intergenic
1111072982 13:83193872-83193894 ATGTGGCTGAGAAAATTGGATGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111535285 13:89595805-89595827 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1111725165 13:91998303-91998325 ATCTTGAAGAGCAAAGTGGAAGG - Intronic
1111741504 13:92211344-92211366 ATGAGGAAGAGCAAGATGGATGG - Intronic
1112207306 13:97337448-97337470 ATATGGAAGAGGAAAATGGTGGG - Intronic
1112249841 13:97769647-97769669 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1112610202 13:100948051-100948073 AGGTGGGAGAGCACAGTGGAAGG - Intergenic
1112705040 13:102059187-102059209 ATGTCTAGGAGGCAAGTGGAAGG + Intronic
1112920529 13:104606051-104606073 AAATGGAAGAGAAGAGTGGATGG + Intergenic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113954653 13:114091222-114091244 ATGTGGGACATGACAGTGGAGGG - Intronic
1114407632 14:22471630-22471652 ATGTGGAAGAGGGATGTTGAGGG + Intergenic
1114553417 14:23547482-23547504 ATGTGGAGGAGGGAAGAGAAAGG - Intronic
1114730469 14:24987582-24987604 GTGTGGAAGATGAAATAGGATGG - Intronic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116763152 14:49039499-49039521 GTATGGAAGTGGAAAGTGAAGGG - Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1118122348 14:62859537-62859559 TTGGGGAAGAGGTATGTGGATGG - Intronic
1118385585 14:65253139-65253161 ATGTGGAATAAGAATGTGGTGGG + Intergenic
1118504417 14:66395240-66395262 ATGTTTAGGAGGAAAGTAGAGGG + Intergenic
1118661769 14:68021617-68021639 AAGATGAAGAGTAAAGTGGAAGG - Intronic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1119439787 14:74620423-74620445 ATGGGGGAGAGGAAACTGGGTGG - Intergenic
1119444894 14:74654931-74654953 GTGTGGCAGAGGAAAGTCAAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120281612 14:82445879-82445901 ATCTGGAAGAAGAAAAAGGATGG + Intergenic
1120310980 14:82828185-82828207 AAATGGAGGAGGTAAGTGGATGG - Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120530532 14:85625738-85625760 AAGGGGAAGAGGACAGTAGAAGG - Exonic
1120555906 14:85929805-85929827 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120892577 14:89504358-89504380 ATTTGGAAATGGGAAGTGGATGG + Intronic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121593306 14:95137315-95137337 AAGGGGAAGAGGAAAGGGAAAGG + Intronic
1121940558 14:98066413-98066435 AAGTGGAAGGTGACAGTGGATGG + Intergenic
1122589491 14:102837005-102837027 ATGAGGAGGAGGAAAGAGCAAGG - Intronic
1123795870 15:23769395-23769417 AGCAGGAAGAGGAACGTGGAAGG - Intergenic
1124180259 15:27466733-27466755 AAGTGGCAGAGGGAAGAGGAAGG + Intronic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124654546 15:31497851-31497873 GTGGGGAAGAGGAAATGGGAAGG + Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125468106 15:39975039-39975061 ATAGGGAAGAGGACAGTGTAGGG - Intronic
1125586730 15:40825920-40825942 TTTTGCAAGATGAAAGTGGAGGG - Intronic
1125801206 15:42449090-42449112 GTGTGGGAAAGGAAAGTGGGGGG + Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126790910 15:52220459-52220481 ATGTGGGAGACTGAAGTGGAAGG - Intronic
1127269127 15:57385192-57385214 ATGTTAAACAGGAAAATGGATGG - Intronic
1127385044 15:58460364-58460386 ATGTGCAAAAGGAAAGGTGAAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128568422 15:68716155-68716177 TTGGGGAAGAGTAAAGTTGATGG - Intronic
1128604464 15:69026641-69026663 ATGTGAAAGAGGCAAGTGTTGGG + Exonic
1128642893 15:69352857-69352879 TTGGGGAAGAGGTATGTGGATGG + Intronic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129249678 15:74302093-74302115 ATGTGGAGGAGACAGGTGGAGGG - Intronic
1129787327 15:78318508-78318530 ATGTGGAGGAGGAAATTGAAAGG + Intergenic
1130119814 15:81038184-81038206 ACATGGAGGAGGAAAGAGGAGGG + Intronic
1130690286 15:86076347-86076369 ATGTTGAATAGGAAAGAGCAAGG + Intergenic
1130919798 15:88334525-88334547 GTCTGGAAGAGGAAAGGAGAAGG + Intergenic
1131111012 15:89765566-89765588 AAGGGGAAGAGGAAAGGGAAGGG + Intronic
1131523303 15:93133127-93133149 ATGCGGAAAGGGAAATTGGAGGG - Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1131920976 15:97328299-97328321 GATAGGAAGAGGAAAGTGGAAGG + Intergenic
1131943119 15:97589135-97589157 ATGAGGAAGAGGGAATTGCATGG + Intergenic
1132012900 15:98291708-98291730 AAGAGGAAGAGAAAAGTGGGTGG + Intergenic
1133512336 16:6472140-6472162 ATGTGGAATTGAGAAGTGGATGG - Intronic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1134814757 16:17196700-17196722 AGGGTGAAAAGGAAAGTGGATGG - Intronic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1135104657 16:19638194-19638216 ACCTGGAAGAGGGAAGTGAAGGG - Intronic
1135186082 16:20316982-20317004 AAGGGGAAGAGGAAAGGGAAAGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135530309 16:23247345-23247367 AGCTGGAAGAGGAAAGGGCATGG - Intergenic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136234154 16:28904159-28904181 ATCTGGAAGGGGAAAGAGAAGGG - Exonic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1137036456 16:35573765-35573787 ATGAGGAAGAAGAAACTGAAGGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137953254 16:52803635-52803657 AGGAGGAAGAAGAAAGGGGAAGG + Intergenic
1138373695 16:56547818-56547840 AGGGGGATGAGGAAAGTGGGAGG - Intergenic
1138868466 16:60851415-60851437 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1139206745 16:65036418-65036440 CTGTGGAAGAGGAACATGGCAGG - Intronic
1139266034 16:65639328-65639350 ATTGGGAAGAGGAAAGTAGGGGG - Intergenic
1139620719 16:68139505-68139527 ATGTGAAAATGGAAAGTAGAAGG + Intronic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141436940 16:84005177-84005199 ATGGGGAAGAGGAAAAGGGGAGG + Intergenic
1141664131 16:85457193-85457215 ATAAGGATGAGGAGAGTGGAAGG + Intergenic
1141874308 16:86811887-86811909 ATGTGGAAGACCAAACTAGATGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142816224 17:2428010-2428032 AAGTGGAAGAGGGAAGGAGAGGG + Intronic
1143767422 17:9146740-9146762 ATTTGGAGGAGGAAAGTGAGGGG + Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1144171496 17:12663884-12663906 ATGAGAAGAAGGAAAGTGGAGGG - Intergenic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144726394 17:17504671-17504693 AGGTGGAAGAGGAGAGGGGCTGG + Intergenic
1145722699 17:27088539-27088561 ATGAGGAGGAGGAAAGAGGGTGG - Intergenic
1145978912 17:28999968-28999990 ATGTGCTAGAAGAAAGTGAAGGG + Intronic
1146394670 17:32454705-32454727 ATGTGGAAGGGAAAACTGGGAGG + Intronic
1146556789 17:33831826-33831848 ATCTTGAAGAGGAGAGAGGAGGG + Intronic
1146824667 17:36012199-36012221 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
1146974066 17:37096151-37096173 GTGTGGAGGAGGGAATTGGAGGG - Intronic
1147025414 17:37578463-37578485 AGGTGGAAGAGTGTAGTGGAAGG + Intronic
1147772041 17:42874487-42874509 ATGTGAAGGAGGGCAGTGGAGGG - Intergenic
1147773838 17:42886474-42886496 AGAAGGAAGAGGAAAGAGGAAGG - Intergenic
1147782361 17:42952758-42952780 CAGAGGAAGAGGAAAATGGACGG + Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148352376 17:46950330-46950352 AGGTGGCAGAGGCAAGTGAAAGG + Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1149919793 17:60646552-60646574 ATGTGGAAGAGGAGACAGAAAGG - Intronic
1150398695 17:64840010-64840032 AAGTGAAAAAGGAAAGGGGAAGG + Intergenic
1150844787 17:68644499-68644521 TTGTTGAAGAGGAAACTAGATGG - Intergenic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151037716 17:70820967-70820989 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1151283655 17:73094497-73094519 TGATGGAAGAGAAAAGTGGATGG + Intergenic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1152102671 17:78311784-78311806 TTGTGGGATTGGAAAGTGGAAGG - Intergenic
1152390896 17:80003108-80003130 AAGGGCAAGAGGAAAGTGGGAGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1153250292 18:3115205-3115227 ATGAGGAAGAGAAAAGTTCAAGG - Intronic
1153579901 18:6562482-6562504 ATGTGGTAGAGGAAACTTGAAGG - Intronic
1153726163 18:7957634-7957656 AGGTGGGTGAGGAAAGTGAAAGG + Intronic
1153949889 18:10049555-10049577 TTGGGGAGGAGGAAAGTGAATGG - Intergenic
1153950749 18:10055718-10055740 ATGTTGAAGAGAAATTTGGAAGG + Intergenic
1154235004 18:12596938-12596960 AGGTGGAGGAGGAAACAGGAAGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155094667 18:22544299-22544321 ATGAGGAAGAGGCAAATGAAAGG - Intergenic
1155793666 18:30006178-30006200 ATATGGTAGAGGAATCTGGAGGG + Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156598831 18:38579740-38579762 AGGTGGAAGAGAAAAGGAGAGGG + Intergenic
1156752947 18:40483051-40483073 AAGGGGAAGAGCAAAGTGAATGG - Intergenic
1156998664 18:43498358-43498380 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157173874 18:45433051-45433073 AAGTGAAAGAGAAAAGTTGATGG - Intronic
1157341295 18:46780653-46780675 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157434869 18:47659833-47659855 AAGTGGAAAAGGGAATTGGAAGG - Intergenic
1157470281 18:47983160-47983182 AGGAGGAAGGGGAAAGGGGAAGG - Intergenic
1157795696 18:50572800-50572822 AGGTGGAAGAGAAAACTAGAAGG - Intronic
1157913928 18:51645836-51645858 GTGTGGCAGAGAAAAGGGGAAGG - Intergenic
1158114571 18:53980309-53980331 ATGTAGAAGGTGTAAGTGGATGG - Intergenic
1158212470 18:55066690-55066712 ATGTGGAACAGGAATGGAGAAGG - Intergenic
1158257899 18:55573633-55573655 ATGAGGAGGAGTTAAGTGGATGG - Intronic
1158473636 18:57760461-57760483 AGGTGGAAGAGCAAAGACGAAGG - Intronic
1158917914 18:62154776-62154798 ATGGGGAAGAGAAAAATGGGAGG + Intronic
1159559016 18:69974735-69974757 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1160036753 18:75308952-75308974 ATTAGGATGAGGAAACTGGAGGG - Intergenic
1160127468 18:76189597-76189619 ATGGGGAGATGGAAAGTGGATGG - Intergenic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161939436 19:7393713-7393735 GTGTGGAAGTGGATAGGGGAGGG + Intronic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1162513100 19:11131613-11131635 ACATGGAAGATGAAAGGGGAGGG + Exonic
1163088687 19:15002744-15002766 ATGTGAAAGAGCACAGGGGAGGG + Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164117171 19:22233943-22233965 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1164250010 19:23468037-23468059 AAGTGGAAGAGGAGAGGAGAAGG - Intergenic
1164672660 19:30081732-30081754 GTGAGGAAGAGGAAAGTGTTGGG + Intergenic
1164908169 19:31984587-31984609 GTTTGGAGGAGGAAAGTGGTAGG - Intergenic
1165641495 19:37391774-37391796 ATGAGGAAGATGAAGGTGTAGGG + Intronic
1165811641 19:38615235-38615257 AGGGGGAGGAGGAAAGTGGGAGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
1166386256 19:42383225-42383247 GTGTTGAAGAGGAGAGTGGCTGG + Intergenic
1166400197 19:42473072-42473094 AGGTTGGAGAGGAAGGTGGAGGG + Intergenic
1166536771 19:43579592-43579614 ATGTGGATGAGTAAAATGAAAGG + Intronic
1166773638 19:45299574-45299596 ATGTGGAAGATGAAAGGGAGGGG - Intronic
1166788076 19:45381360-45381382 ATGTACAAGAAGGAAGTGGAGGG - Intronic
1166826723 19:45614451-45614473 TTGTGTAAGAGGAAAGGGTAGGG - Intronic
1167608166 19:50492792-50492814 AAGAGGAGGAGGAAAGAGGAAGG + Intergenic
1167628258 19:50606601-50606623 ATGTGGACGTGGAAAGTGACTGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168333339 19:55582195-55582217 CTGTAGAAGAGAAAAATGGAAGG + Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168588803 19:57615727-57615749 ATAAGGAAGAGGGAAGGGGAAGG + Intronic
925460808 2:4061075-4061097 TTGGGGAAGAGGTATGTGGATGG + Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
928427640 2:31192259-31192281 AGGTGGAAGAGCAAGGTGGGAGG - Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929277525 2:40042316-40042338 AAGGGGAAGAGGAAAGGGAAGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
930016312 2:46973207-46973229 TTGTGGAACAGCAAAGTGAAGGG + Intronic
930231905 2:48851848-48851870 AGGTGGAAGAGGGAAATGGAAGG - Intergenic
930288535 2:49465377-49465399 AAGGGGAGAAGGAAAGTGGAAGG - Intergenic
930480855 2:51946720-51946742 AGCAGGAAGAAGAAAGTGGAAGG - Intergenic
931216070 2:60245975-60245997 AAGTGGAAGAGGAGACTGGCAGG + Intergenic
931492731 2:62767043-62767065 ATGAGGGAGAGGTAAGAGGAAGG + Intronic
931836032 2:66098955-66098977 ACGTGGAGGAGGCATGTGGAGGG + Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
933162577 2:79042145-79042167 TTGTGGAAGTTGAAAGTGGGAGG - Intergenic
933305411 2:80591563-80591585 AAGTGGAATATGCAAGTGGAAGG - Intronic
933359281 2:81258292-81258314 ATGTGAAAGAGGACATTTGAAGG - Intergenic
933394386 2:81712725-81712747 TTGGGGAAGAGGTATGTGGATGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
934053643 2:88233031-88233053 AAGTGGAAGAGAAAATTGGAAGG + Intergenic
934117496 2:88811060-88811082 ATGCTGGAGAGGAAAGGGGAGGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935821609 2:106898484-106898506 AGTTGGAGGAGGCAAGTGGAAGG + Intergenic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936161098 2:110084796-110084818 ATGCTGGAGAGGAAAGGGGAGGG + Exonic
936183565 2:110286558-110286580 ATGCTGGAGAGGAAAGGGGAGGG - Intergenic
936765663 2:115845547-115845569 ATGGGGAAGAGGAAAATAGAAGG - Intronic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937785115 2:125887097-125887119 TTGGGGAAGAGGTATGTGGATGG - Intergenic
937852481 2:126648107-126648129 TTGGGGAAGAGGTATGTGGATGG - Intergenic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938419325 2:131131629-131131651 ATGTGGGAGAAGAAAGTAAAAGG + Intronic
938588524 2:132715184-132715206 ATGTGCAAGAGGAAAAAGCAAGG - Intronic
938750994 2:134329962-134329984 ATGTGGTAGAGAGAAGTGCAGGG + Intronic
938879371 2:135568884-135568906 ATGTGTAAGAGGACAGCGAAGGG + Intronic
939500266 2:142975334-142975356 ATGAGGAACTGGAAAGGGGATGG - Intronic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941343698 2:164339909-164339931 ATGTGGAAAAGGAAAATGAAGGG + Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
942275959 2:174324040-174324062 ATAAGGAAGAGGGAAATGGATGG + Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943383983 2:187180462-187180484 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943517510 2:188906627-188906649 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943743188 2:191433435-191433457 ATGTGGAAGCCGAAACTGGCAGG + Intergenic
943833528 2:192490516-192490538 TTGGGGAAGAGGTATGTGGATGG - Intergenic
944034555 2:195278131-195278153 AGCAGGCAGAGGAAAGTGGAAGG - Intergenic
944349403 2:198709165-198709187 AAGAGAAAGAGGAAAATGGAAGG - Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944769785 2:202902517-202902539 AGGAGGCAGAGGAATGTGGAAGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946175714 2:217920994-217921016 AGAGGGAAGAGGAGAGTGGAGGG + Intronic
946305331 2:218853807-218853829 TTCAGGAAGAGGAAAGTGGGCGG - Intergenic
946381126 2:219349810-219349832 ATGGGGAAAAGTAAAGTGGGTGG + Intergenic
946387970 2:219397222-219397244 ATGTGGAACAGGAAAGAGACGGG - Intronic
946634387 2:221708110-221708132 ACTGGGAATAGGAAAGTGGAGGG - Intergenic
946703676 2:222437165-222437187 TTGGGGAAGAGGTATGTGGATGG - Intronic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
946762469 2:223008341-223008363 TTGTGCAAAAGGAAAGCGGAAGG + Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947540455 2:230973935-230973957 AGGTGGAAGGGGACAGTGGGAGG - Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
948437684 2:237965332-237965354 ATAAGGAAGAGGGAAGTGCAGGG + Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169029894 20:2398826-2398848 ATGTGGTAGAGGGAGGTGGTGGG - Intronic
1169178616 20:3542542-3542564 AGGTGGAAGGGGGAAGGGGAAGG - Intronic
1169428479 20:5514268-5514290 GTGGGGATAAGGAAAGTGGAAGG + Intergenic
1169443978 20:5656410-5656432 ATGTGAATGAGGAACGTGCATGG - Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1169951748 20:11052306-11052328 TTTTGGAAGAAGAAAGTGTAGGG - Intergenic
1170336586 20:15276770-15276792 ATGTGGAAGAGAAGAGGTGATGG + Intronic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1170511827 20:17085520-17085542 ATGTAGTAGAGAAAAGTTGATGG + Intergenic
1170623299 20:18011678-18011700 AGGGGGAAGAGCAAAGTCGAAGG - Intronic
1170723646 20:18905868-18905890 ATCTGGAAGAGGAAAGGAGTTGG + Intergenic
1170788920 20:19491734-19491756 GAGTGGGAGAGGAAAGAGGAAGG + Intronic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171117365 20:22536606-22536628 ATCTGCAAAAGGAAAGTGAAAGG - Intergenic
1171118443 20:22547525-22547547 GTGGGGAAGAGGGCAGTGGAAGG + Intergenic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1172791203 20:37506679-37506701 ATGGGGCAGAGGAAAATGAAAGG - Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173053019 20:39583667-39583689 AAAGGGAAGAGGAAAGGGGAAGG + Intergenic
1173127902 20:40357146-40357168 AAGTGGGAGAGGAAAGTGAGAGG - Intergenic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1173194133 20:40900099-40900121 ATGTGGGAAAGAAAAGTGGTAGG - Intergenic
1173349541 20:42232560-42232582 ATGAGGAAGAGGAAACAGAAAGG - Intronic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1174370782 20:50085966-50085988 CGGTGGTGGAGGAAAGTGGATGG - Intronic
1174988344 20:55481043-55481065 ATGTTTAAGAGGAAAGTAGGTGG - Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175300529 20:57939803-57939825 ATGTGGACAGGGAAAGTGGAGGG - Intergenic
1175486315 20:59349065-59349087 ATGAGGCACAGGAGAGTGGAGGG + Intergenic
1176084639 20:63290382-63290404 ATGGGGAAGACGAAAGTGGCGGG + Intergenic
1177046991 21:16183157-16183179 AAGTGGAAGGTAAAAGTGGAAGG - Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178319407 21:31593891-31593913 ATGTGGAAAAGGAAAAAGAAAGG - Intergenic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179239217 21:39574137-39574159 ATTTGGAAGAAGCAAGTGAATGG - Intronic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179612791 21:42563346-42563368 GTGTGGGAGAGGAAACTGCACGG - Intronic
1179945327 21:44670333-44670355 TTGTGGAAGAGGCAAGTGTCAGG - Intronic
1180228875 21:46414478-46414500 AGGAGGAAGAGGAGAGTGGGCGG - Intronic
1181375176 22:22452383-22452405 ATGTGGAAGGGGAGAGGGTAAGG - Intergenic
1182109027 22:27709921-27709943 TTGTGGAAGAGCAAAGGAGACGG - Intergenic
1182118199 22:27769973-27769995 ATGAGGAAAAGGAGAGTCGATGG + Intronic
1182310245 22:29399573-29399595 ATGTGGAAAACCACAGTGGAAGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182659349 22:31914355-31914377 ACGTGAACAAGGAAAGTGGAAGG - Intergenic
1182690988 22:32162452-32162474 ATGTGGAAAACCAAAGTGGAAGG + Intergenic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1184189026 22:42882631-42882653 TTGAGGAAGAGAAAACTGGAGGG + Intronic
1184306535 22:43606874-43606896 ATGTGGGAAATGAGAGTGGACGG - Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184436164 22:44478640-44478662 ATCTGGAAGAGGAAAGTCAGAGG - Intergenic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
1185408437 22:50670918-50670940 ACCTGGGAGAGGAAGGTGGAGGG + Intergenic
949245961 3:1925554-1925576 TTGGGGAAGAGGTATGTGGATGG + Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
950279534 3:11694734-11694756 GTTTGCAAGATGAAAGTGGAGGG + Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951229413 3:20159755-20159777 ATGTGGAATAGGAATTTGCAGGG - Intergenic
951291434 3:20876114-20876136 TTGGGGAAGAGGTATGTGGATGG - Intergenic
951384609 3:22028148-22028170 TTGGGGAAGAGGTATGTGGATGG + Intronic
951528998 3:23681446-23681468 AGCTGGCAGAAGAAAGTGGAAGG + Intergenic
951970677 3:28441259-28441281 TTGGGGAAGAGGTATGTGGATGG - Intronic
952101664 3:30020377-30020399 ATGGGGAGGAGGAAAGTTGGAGG - Intergenic
952777204 3:37058160-37058182 ATGTGGAAAAGGACAGTGCCAGG + Intronic
952966922 3:38626812-38626834 ATCTGGTAGAGGAACGTGGGAGG + Intronic
953043408 3:39274582-39274604 ATTTTGAAGAGGAAAGGGAAGGG - Intronic
953383569 3:42492221-42492243 AGGAGGAAGAGAAAAGAGGAAGG - Intronic
953446888 3:42976096-42976118 ATGTGGAACAGGTCAGTGGCAGG + Intronic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
954054247 3:48008587-48008609 TTGGGGAAGAGGTATGTGGATGG + Intronic
954154431 3:48677463-48677485 AAGGGGAAGAGAAAAATGGAAGG - Intronic
954185032 3:48910434-48910456 ATTTGGAAGAGGAAAGCTCATGG + Intergenic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
955056166 3:55457810-55457832 AATGGGAAGAGGAAAATGGAAGG - Intergenic
955964401 3:64373462-64373484 CTGTGGGAGACCAAAGTGGAAGG + Intronic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
957039163 3:75323093-75323115 ATGTACAAGAGGAAAGTAAATGG + Intergenic
957247482 3:77733266-77733288 TTGGGGAAGAGGTATGTGGATGG - Intergenic
957550947 3:81703733-81703755 ATTTGGAAAAGAAAAGTGGATGG + Intronic
958404609 3:93738487-93738509 ATCTGGAAGAGGACATTTGAAGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959291781 3:104484583-104484605 ATTTGGAAGGAGTAAGTGGATGG + Intergenic
959659104 3:108845373-108845395 ATGTGGGCTAGGAAAATGGATGG + Intronic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
959837668 3:110939505-110939527 ATGAGGAAGAGAAAAATGAAGGG + Intergenic
959867200 3:111284297-111284319 ATGTAGAAGAGAAAAGGGAAAGG - Intergenic
959922883 3:111888923-111888945 ATGTGGAAGAGAACAATGAAGGG - Intronic
959951822 3:112187743-112187765 ATGTGGAAGAAGAAATGAGAAGG - Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960494657 3:118360124-118360146 TTGGGGAAGAGGTAAGTGGGTGG - Intergenic
960659840 3:120045480-120045502 ATAAGGAAGAGGGAAGGGGAAGG - Intronic
960715349 3:120569521-120569543 ATGAGGAACAGGAGAGTTGATGG + Intergenic
960906418 3:122606225-122606247 ATGTGGAAGAATATAGGGGATGG - Intronic
961030710 3:123601124-123601146 AGCAGGAGGAGGAAAGTGGAAGG + Intergenic
961524413 3:127487495-127487517 GTGTGGAGGAGGTCAGTGGAGGG - Intergenic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
961630455 3:128294724-128294746 AAGTGGAAAAGGTAAGGGGAGGG + Intronic
961674734 3:128557760-128557782 AGGAGAAAGAGGAAAGGGGAAGG + Intergenic
961817330 3:129557914-129557936 AGGTTGAAGATGAAAGAGGATGG - Intronic
962270274 3:133973065-133973087 AAGTGGAAGATGAGAGAGGATGG + Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962477700 3:135770985-135771007 AAGTGGGAGAGGAAAGGGTAGGG - Intergenic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963106789 3:141654177-141654199 GAGGGGAAGAGGAAAGTGGGGGG + Intergenic
963301606 3:143603346-143603368 ATGTGAGAGAGGAATGTAGAGGG - Intronic
964429040 3:156584702-156584724 ATGTGTAAGAGAAAATTAGAAGG + Intergenic
964679148 3:159318285-159318307 TTGGGGAAGAGGTATGTGGATGG - Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965215885 3:165864365-165864387 ATTTGGCAAAGGAAAGTGAAGGG - Intergenic
965787455 3:172351180-172351202 ATGTGGAAGACCACAGAGGAAGG + Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966348126 3:179001278-179001300 ATGGGGAACTGGAAAGTGTATGG + Intergenic
966739985 3:183223615-183223637 AAGAGAAAGAGGAAAGAGGACGG + Intronic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
966979066 3:185113767-185113789 ATGTGGAACAGGGAAGGGGGAGG + Intronic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967210240 3:187162101-187162123 AACGGGGAGAGGAAAGTGGATGG - Intronic
967320155 3:188187046-188187068 ATGTGGAGAGGAAAAGTGGAGGG - Intronic
967413267 3:189188520-189188542 ATGTGGAGGAGGAAAAGGGAAGG - Intronic
967579547 3:191136290-191136312 ATGTTGAAATGGAAAGTGTAGGG + Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
967854880 3:194109853-194109875 ATGTTGAAGCGATAAGTGGATGG + Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968800275 4:2738762-2738784 TTGAGGAAGAGGTATGTGGATGG + Intergenic
968907094 4:3459042-3459064 TTGGGGAAGAGGTATGTGGATGG + Intergenic
969334542 4:6499920-6499942 ACTTGGAAGAAGAAAGGGGAAGG - Intronic
970005868 4:11410227-11410249 ATGTGGAAGATGCACGTGGAAGG + Intronic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970891080 4:21044983-21045005 ATATGGAAGAGACAAGTGAAGGG + Intronic
970948620 4:21725930-21725952 TTCTGGAAGAGTAAAGTGAAAGG + Intronic
971360023 4:25929086-25929108 TTGGGGTGGAGGAAAGTGGAAGG + Intronic
971374375 4:26044972-26044994 ATGGGAAAGAGGGGAGTGGATGG - Intergenic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
971443898 4:26721415-26721437 ATTTGGAAGATAAAATTGGAAGG - Intronic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
972229525 4:37055014-37055036 AGGTGAAAGAGGACACTGGAGGG - Intergenic
972234470 4:37114934-37114956 ATGAGGAAGAAGATAGTGAAAGG - Intergenic
972828666 4:42788957-42788979 ATGGGGAAGAGGCATATGGATGG + Intergenic
973120911 4:46520275-46520297 TTGGGGAAGAGGTACGTGGATGG - Intergenic
973130101 4:46639068-46639090 TTGGGGAAGAGGTATGTGGATGG - Intergenic
973163668 4:47050844-47050866 ATATGGAAAAAGAGAGTGGAAGG - Intronic
973616391 4:52682640-52682662 AGGAGGCAGAGGAAAGTGGAAGG - Intergenic
974289650 4:59913372-59913394 TTGGGGAAGAGGTATGTGGATGG + Intergenic
974297825 4:60025545-60025567 CTGTGGAAGACCAAAGTGGAAGG - Intergenic
974746825 4:66088275-66088297 TTGGGGAAGAGGTATGTGGATGG - Intergenic
974910105 4:68107602-68107624 AAGTGGAAGAGGGAAGATGATGG + Intronic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
976561911 4:86511614-86511636 AGGAGGAAGAGGAAAGAAGAAGG + Intronic
976892858 4:90071611-90071633 ATATGGGAGAGGAGAGTGGATGG - Intergenic
976971795 4:91112756-91112778 AGATGGAAGAGGACAGAGGATGG - Intronic
977011853 4:91645562-91645584 AGATGTAAGAGGGAAGTGGAGGG - Intergenic
977257166 4:94754199-94754221 GGGTGGAAAAGGAAAGTGGTAGG + Intergenic
977444427 4:97111393-97111415 ATGTGGAACAGAAAAATGGAAGG - Intergenic
977459644 4:97309086-97309108 ATGGGGAAAATGAAACTGGAGGG + Intronic
977489996 4:97699445-97699467 TTATGGAAGAGGTATGTGGATGG - Intronic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
977664943 4:99635450-99635472 AAGTGGAAGATGAAAGTAGAGGG + Intergenic
977766708 4:100806673-100806695 TAGTGGAAGAGAAAAGTTGATGG + Intronic
977833143 4:101617208-101617230 TTGGGGAAGAGGTATGTGGATGG - Intronic
977923041 4:102666857-102666879 ATTAGGAAGAGGCACGTGGATGG - Intronic
978341495 4:107724919-107724941 TTGGGGAAGAGGTATGTGGATGG - Intergenic
978357588 4:107893331-107893353 ATATGGAAGAGTAAAGTTGAAGG + Intronic
978724540 4:111955137-111955159 ATCAGGAAAAGGAAAGAGGAGGG - Intergenic
979307008 4:119158034-119158056 ATGCAGAATGGGAAAGTGGATGG + Exonic
979892792 4:126120969-126120991 ATGAGGTAGAGGAAAGAGTAAGG + Intergenic
979898329 4:126188438-126188460 TTGGGGAAGAGGTATGTGGATGG - Intergenic
980006148 4:127544562-127544584 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
980385700 4:132086407-132086429 TTGAGGAAGAGGTATGTGGATGG - Intergenic
981308102 4:143267934-143267956 ATGGGGAAGAGAAATGTGGTTGG + Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981643351 4:146969990-146970012 AAGTGGAAGAGGCATGAGGAGGG + Intergenic
982597686 4:157406415-157406437 TTGGGGAAGAGGTATGTGGATGG - Intergenic
983185152 4:164692203-164692225 TTGGGGAAGAGGTATGTGGAAGG + Intergenic
983973424 4:173902049-173902071 ATGTGAAAGATGAGAGTGGATGG + Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984447233 4:179852130-179852152 CTGTGGGAGATGAAAGTGGTGGG - Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
986045840 5:4036837-4036859 AAGTGAAAGAGAAAAGTGAATGG + Intergenic
986261542 5:6151893-6151915 TTGGGGAAGAGGTATGTGGATGG - Intergenic
986743038 5:10720389-10720411 TTGGGGAAGAGGTATGTGGATGG + Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987468059 5:18296015-18296037 TTGGGGAAGAGGTATGTGGATGG - Intergenic
987550405 5:19372710-19372732 AGCAGGCAGAGGAAAGTGGAAGG + Intergenic
988107837 5:26773175-26773197 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988188869 5:27901871-27901893 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
988616877 5:32783204-32783226 TTGTGGAAGAGAAGACTGGAAGG - Intronic
988970302 5:36460204-36460226 ATGAGAAAGAGCAAAGTGGTTGG + Intergenic
989209113 5:38842693-38842715 AGATGGAAGATGAAAGAGGATGG + Intergenic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
989665265 5:43846550-43846572 AAGTGGAAAAGCAAAGTGCAAGG + Intergenic
989759292 5:44993096-44993118 AGGTGGGAGAGGGAAGAGGAGGG + Intergenic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
991330653 5:65489054-65489076 TTGGGGAAGAGGTATGTGGATGG - Intergenic
991480852 5:67077550-67077572 ATGGTGAGGAGCAAAGTGGATGG - Intronic
992243040 5:74790482-74790504 TTGGGGAAGAGGTATGTGGATGG + Intronic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
994219615 5:97180815-97180837 ATGTGGAAGGGTAAAGGGAACGG + Intronic
994243433 5:97450501-97450523 ATGAGCATGAGGAAAATGGAAGG - Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
994849184 5:105032298-105032320 ATGTGGAAGAATCAAGTGAAAGG + Intergenic
994984330 5:106915098-106915120 TTGGGGAAGAGGTACGTGGATGG - Intergenic
995400637 5:111737096-111737118 ATGTGGAAAAGTAAGGTGGTTGG - Intronic
995867363 5:116706055-116706077 TTGAGGGAAAGGAAAGTGGAAGG - Intergenic
996018646 5:118568490-118568512 TTGGGGAAGAGGTATGTGGATGG + Intergenic
996347723 5:122505049-122505071 ATGTGGAAGATGAAAGTTGTAGG + Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996449716 5:123607093-123607115 ATGTGAAAGAAGAAAGTGGTGGG + Intronic
996490314 5:124087005-124087027 TAGTGGTAGAGGAAAGTGGTTGG - Intergenic
996534601 5:124564463-124564485 AGGAGGAAGAGGAAAGAGAAGGG + Intergenic
996705791 5:126497162-126497184 ATGTGGTAATGAAAAGTGGAAGG + Intergenic
996825652 5:127678470-127678492 TTGGGGAAGAGGTATGTGGATGG + Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
998566094 5:143217171-143217193 ATAAGGAAGAGGAAAAGGGAGGG + Intronic
998603200 5:143605935-143605957 ATGTGAGAGAGGAAACTTGAAGG + Intergenic
998908183 5:146929140-146929162 ATGTGGAAGAAGAGAGAGGTAGG - Intronic
998997577 5:147882402-147882424 ATGGGGGATAGGAAAGTGAAGGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000802155 5:165740934-165740956 CAGTGGAAAAGAAAAGTGGATGG + Intergenic
1000874573 5:166620109-166620131 ATTTGGATGGGGAAAGTGAAGGG + Intergenic
1001322450 5:170693804-170693826 ATTAGCAAGAAGAAAGTGGAGGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001753421 5:174148337-174148359 ATGTGGAAGAGAATAGCGAAGGG - Intronic
1001783724 5:174393448-174393470 AGGATGAAGAGGAAAATGGAAGG + Intergenic
1001829462 5:174773442-174773464 ATGCAAAAGAGCAAAGTGGATGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002819072 6:706911-706933 ATGTGCTAGAGGACAGTGGTGGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003714496 6:8631536-8631558 ATGCTGAAGTGGAAACTGGAAGG - Intergenic
1003758698 6:9150709-9150731 TTGGGGAAGAGGTATGTGGAGGG + Intergenic
1003791317 6:9550676-9550698 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004044045 6:12009545-12009567 ATGTGGAGGATGAATGTGAATGG - Intronic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005185259 6:23157694-23157716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005568803 6:27124596-27124618 ATGCGGACAAGGAATGTGGAGGG + Intergenic
1005925540 6:30442143-30442165 ATGTGGATTAGGAAATGGGATGG - Intergenic
1005939869 6:30552959-30552981 ATGTGCAAGAGGCCAGGGGAAGG - Intronic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1007464984 6:42045545-42045567 TTGGGGAAGAGAAAAGTGAAGGG + Intronic
1007649673 6:43411406-43411428 ATGTGAAAGAAGAATGTGAAGGG + Intergenic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1008477478 6:51948076-51948098 ATGTGGAGGTGGTAAGTGGTTGG - Intronic
1009660602 6:66606300-66606322 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010368010 6:75075116-75075138 ATGTGGAGGAGGAAAATGAAGGG - Intergenic
1010431639 6:75784463-75784485 ATGGAGAAGAGCAAAGTGAAAGG + Intronic
1010636474 6:78264980-78265002 ATGTGGAAAAGCATTGTGGAAGG - Intergenic
1010846004 6:80708706-80708728 ATTTGCAAGAGAAAATTGGAAGG + Intergenic
1010960835 6:82143961-82143983 AAGTGGAAGAGCAGAGGGGAGGG + Intergenic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1011872204 6:91910137-91910159 AGGAGGAAGAACAAAGTGGAAGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012797694 6:103783971-103783993 ATGAGGAAGAGGTGAGTTGAGGG + Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013357291 6:109357425-109357447 AAGTGGAAGAGCGAAGTGGCAGG + Intergenic
1013381781 6:109579891-109579913 ATGTTGAAAAGGCAAATGGAAGG + Intronic
1013535098 6:111056718-111056740 TTGTTGAAGAGAAATGTGGATGG - Intergenic
1013639628 6:112060507-112060529 GTGTGGAAGAGCAGAGTGGAAGG + Intronic
1014363317 6:120507723-120507745 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1014534102 6:122595974-122595996 TTGCAGAAGAGGTAAGTGGATGG - Intronic
1014631728 6:123797430-123797452 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015686826 6:135873189-135873211 TTGTGGTAGAGAAAAGTGAAGGG - Intronic
1016119841 6:140332063-140332085 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1016142874 6:140634544-140634566 AAGTGGAAGACTAAGGTGGAAGG - Intergenic
1016307173 6:142696527-142696549 AGGCAGAAGAGGAGAGTGGAGGG - Intergenic
1016360382 6:143261088-143261110 ATGTTGCAGAGGAATGGGGAAGG + Intronic
1016401948 6:143690357-143690379 CAATGCAAGAGGAAAGTGGAAGG - Intronic
1016419528 6:143870040-143870062 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017227718 6:152040462-152040484 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017534623 6:155333540-155333562 ATGTGGAAAAGGTCAGGGGAAGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018493062 6:164316421-164316443 AGGTGAAAGAGCACAGTGGATGG + Intergenic
1018599978 6:165528166-165528188 TTGGGGAAGAGGTATGTGGATGG + Intronic
1018950797 6:168377627-168377649 AAGTAGAAGAGGAAATCGGAAGG - Intergenic
1019226298 6:170512754-170512776 ATGTGGATGAGCCATGTGGAGGG + Intergenic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020342795 7:7130977-7130999 AAGGGGAAGAGGAAAGAGAAGGG - Intergenic
1020442607 7:8234341-8234363 ATGTGGACGAAGCAAGGGGAGGG - Intronic
1020952434 7:14696743-14696765 ATGTGGAATAATAAAGTAGATGG - Intronic
1021181488 7:17511083-17511105 AGGTGGAAGAGTAAAGTAGAGGG - Intergenic
1021629814 7:22633653-22633675 ATGATGAAGAGGAGAGGGGATGG + Intergenic
1022299962 7:29093778-29093800 TTATGGATGAGGAAAATGGAAGG + Intronic
1023191787 7:37590980-37591002 ATGTGGCAGAGGAAAGATGTAGG + Intergenic
1023337278 7:39183562-39183584 ATGTGGAAGAGGGACCTGGTGGG - Intronic
1023444234 7:40215440-40215462 ATGTTCAAGAGGAGAGTGGGTGG - Intronic
1023620962 7:42072056-42072078 AAGTGGATTAGTAAAGTGGATGG + Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024880364 7:54078851-54078873 CTGTGGAAGAGCAAAGAGGGAGG + Intergenic
1025055375 7:55760725-55760747 AAGTGGAAGAGGGAGGTAGAAGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1025945395 7:66100454-66100476 ATGAGGAGGAGGAAAGAGGGAGG + Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027685888 7:81278586-81278608 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027929258 7:84510096-84510118 ATCAGGCAGAGGAAAGTGGATGG + Intergenic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1028753530 7:94409539-94409561 ATGAGGAAAAGGAAAGGAGAAGG - Intronic
1028935103 7:96455694-96455716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030644527 7:112045115-112045137 ATGAGGAAGGGGAAAATGGCAGG - Intronic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031101737 7:117489309-117489331 ATGCTGAAGAAGAAAGTGGTAGG + Intronic
1032049539 7:128639073-128639095 AACTGGAAGAGGGAAGTAGAAGG - Intergenic
1032285884 7:130538197-130538219 GTCTGGAAGATGAAAGTGGGAGG + Intronic
1032444703 7:131972280-131972302 ATTTGGAGAAAGAAAGTGGATGG + Intergenic
1033076346 7:138253675-138253697 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033193580 7:139307096-139307118 ATGAGGAAGATGTAACTGGAGGG - Exonic
1033460152 7:141539853-141539875 CTATGGAAGAGGAAAATGGCTGG + Intergenic
1033559927 7:142521528-142521550 ATGGTGGAGAGGTAAGTGGAGGG + Intergenic
1033638680 7:143238636-143238658 TTGTGGAAGAGGCAAGTGCCAGG + Intergenic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1033887413 7:145965319-145965341 AGGAGGTAGAGGAAAGTGCATGG + Intergenic
1034168282 7:149042653-149042675 AGGAGGAAGAGGGAAGGGGAGGG + Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034636643 7:152572565-152572587 ATGGGGAGGAGGAAAGCGGGAGG - Intergenic
1036150220 8:6290124-6290146 ATGTGGAAGATGCAACCGGAAGG + Intergenic
1036468186 8:9022857-9022879 ATAAGGAAGAGGAAAGTGGGTGG - Intronic
1036597796 8:10229829-10229851 ATTTGGAAGAGGAAAGGGAGAGG + Intronic
1037044672 8:14283326-14283348 TTGCGACAGAGGAAAGTGGATGG - Intronic
1037219837 8:16504981-16505003 ATGTAGAAGAGGAAAGTTGGTGG + Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037570295 8:20152216-20152238 AAATATAAGAGGAAAGTGGAGGG + Intronic
1037673680 8:21036816-21036838 AGATGGAAGAGGTCAGTGGAGGG + Intergenic
1037753453 8:21697079-21697101 ATGGGACAGAGGAAAGGGGAAGG + Intronic
1037838723 8:22229554-22229576 ATGGGGAAGAGCAAAGGGAAGGG + Intronic
1038392513 8:27216569-27216591 ATGAGGAGGAGGAAATTGGTGGG + Intergenic
1039958169 8:42223125-42223147 ATTTGGAAGAGGAAATTTGTAGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041986269 8:63925098-63925120 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1043394326 8:79822010-79822032 TTTTGGAAGAGCAGAGTGGAGGG - Intergenic
1043563694 8:81524061-81524083 ATGACGAAGAGGACAATGGAAGG - Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1044202477 8:89453118-89453140 TTGGGGAAGAGGTACGTGGATGG + Intergenic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1045566576 8:103322556-103322578 ATGTGGAAAAGGTCAGTGAATGG - Intronic
1045713598 8:105015376-105015398 TTGTGGAGAAGCAAAGTGGAGGG - Intronic
1045724209 8:105152047-105152069 AGGTGAGAGAGGAAAGTGCATGG + Intronic
1045734132 8:105275392-105275414 ATGTAGGAGTGGAAAGTGGGTGG - Intronic
1046522759 8:115346340-115346362 ATTTGGCAGAGGTGAGTGGAAGG + Intergenic
1046526649 8:115389500-115389522 TTGTGGAAGAGCAGAGTAGATGG - Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047148773 8:122237061-122237083 ATCATGAATAGGAAAGTGGATGG + Intergenic
1047172632 8:122508790-122508812 AGGTGGAAGAGGAAAGTAAAAGG - Intergenic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1047945337 8:129870994-129871016 GTTTGGGAGAGGAAAGTTGAGGG + Intronic
1048805098 8:138232939-138232961 GTGGTGAAGAGGAAAGTGGGAGG - Intronic
1048811736 8:138294235-138294257 ATCAGAAAGAGGAGAGTGGAAGG + Intronic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1050163219 9:2739233-2739255 ATGAGGAACAGCAAAGAGGAAGG + Intronic
1050330591 9:4541505-4541527 GTGTGAAAGAGGAAAGAGGGAGG + Intronic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050600454 9:7245278-7245300 ATTTGGAAGATGGAAGTTGAGGG + Intergenic
1050901868 9:10960262-10960284 TTGAGGAAGAGGTATGTGGATGG + Intergenic
1050942192 9:11473285-11473307 AAGAGGAAGAGGAAAGGGAAGGG + Intergenic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051496686 9:17731380-17731402 AAGAGGAAGAGGAAAAGGGAGGG + Intronic
1051656909 9:19391771-19391793 ATGTTCAAAAAGAAAGTGGAAGG + Intergenic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1052049564 9:23830020-23830042 ATGTAAAACAGGACAGTGGAAGG - Intergenic
1052074749 9:24127396-24127418 AAGTGGAGGAGGAACGTGGAGGG + Intergenic
1052227670 9:26109000-26109022 TTGGGGAAGAGGTATGTGGATGG + Intronic
1052368736 9:27641465-27641487 GTGAGGAAGAGGTATGTGGATGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052597649 9:30580834-30580856 AAGAGGAACAAGAAAGTGGAGGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1052737256 9:32354949-32354971 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1052805823 9:33012402-33012424 ATGTGGAAGGGGACTATGGAAGG - Intronic
1052986564 9:34492190-34492212 ATGTGGAATAGGAGACTGGGGGG + Intronic
1053826927 9:42034967-42034989 ATCTGGGAGACGAAGGTGGAAGG - Intronic
1054603633 9:67152464-67152486 ATCTGGGAGACGAAGGTGGAAGG + Intergenic
1054916332 9:70498228-70498250 GTGGGGAGGAGGAAACTGGAGGG + Intergenic
1055494113 9:76837562-76837584 ATGTGGAAAAGGATAGAGCAGGG + Intronic
1055686048 9:78775920-78775942 TTGTGAAACAGGAAACTGGAAGG + Intergenic
1056040822 9:82665047-82665069 ATATGGAAGAGAAAACTGAAGGG + Intergenic
1056156760 9:83845833-83845855 TTGGGGAAGAGGTATGTGGATGG + Intronic
1056314145 9:85372317-85372339 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056353776 9:85777693-85777715 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1057051721 9:91928851-91928873 ATGTAGATGAGGAAAGTGCAGGG - Intronic
1057947821 9:99344973-99344995 ATGAGGAAGAGAGGAGTGGATGG + Intergenic
1058270091 9:102961428-102961450 ATGGTTAAGAGGAAAGTGAAGGG - Intergenic
1058407355 9:104691702-104691724 TTGAAGTAGAGGAAAGTGGAAGG - Intergenic
1058443551 9:105032491-105032513 ATCTGGAAGAGCAAAGTAGTAGG - Intergenic
1058561429 9:106233118-106233140 AGGAGGAGGAGGAAAGAGGAAGG - Intergenic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059441631 9:114310736-114310758 AAGAGGAAGAGGCAAGGGGAGGG + Exonic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060190354 9:121588602-121588624 ATGGGGAAGAGGGAAGGGAAGGG + Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060429978 9:123542643-123542665 ATTAGGAGGAGGAAAGTGGAAGG + Intronic
1060712002 9:125876401-125876423 AGGAGGAAGAGGAAAGGGGTTGG - Intronic
1060828749 9:126700926-126700948 AGGTGGAAGGTGAGAGTGGAGGG - Exonic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061587619 9:131578954-131578976 AAGGGGAAGCGGAAAGTGAAAGG + Exonic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062179240 9:135181893-135181915 ATCAGGCAGAGGAAGGTGGAAGG + Intergenic
1062302016 9:135879087-135879109 ATGAGGAGGAGGGGAGTGGAGGG + Intronic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1203378359 Un_KI270435v1:3030-3052 ATCTGCAAGAGGAAATTGGGAGG + Intergenic
1185770136 X:2759735-2759757 ATGAGAAAGAGGAAAATGGCTGG - Intronic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186033148 X:5391750-5391772 ATCTGCAAGAGGAAATTGAATGG + Intergenic
1186219743 X:7336878-7336900 ATGTGGAGGAGTAAAGAGAAAGG + Intronic
1186384008 X:9091133-9091155 TTGGGGAAGAGGTATGTGGATGG - Intronic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1186463476 X:9766071-9766093 AGGAGGAGGAGGGAAGTGGAAGG + Intronic
1186927842 X:14354957-14354979 AACTGGAAGAGGGAAGTGGGAGG - Intergenic
1187083706 X:16019786-16019808 ATGTGGAAGAGATAAGAGTATGG - Intergenic
1187128219 X:16474469-16474491 ATGTGGTAGATGCAGGTGGAGGG + Intergenic
1187419920 X:19125251-19125273 CTATGGAAGAGGAAAGAGGTTGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188006462 X:25019138-25019160 ACCTAGAAGAGGAGAGTGGAAGG + Intergenic
1188063081 X:25625047-25625069 ATCTGGAAGGCGGAAGTGGATGG + Intergenic
1188832339 X:34914475-34914497 ATGTGGAATAGGAAAATTTAAGG + Intergenic
1188842465 X:35033150-35033172 ATGTGGTCGAAGAAACTGGAAGG + Intergenic
1189075221 X:37907266-37907288 TTGTGGGAGAGAAAAATGGATGG + Intronic
1189154797 X:38746105-38746127 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1189200118 X:39186631-39186653 AGGTGAAAGAGGAAATAGGAGGG - Intergenic
1189784713 X:44549108-44549130 AATTGGAAGAGTAAAATGGAGGG + Intergenic
1190246076 X:48691235-48691257 GCCTGGAAGAGGAGAGTGGAGGG - Exonic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191719155 X:64215085-64215107 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1191832748 X:65432504-65432526 ATGTGGAAGAGAAACTTGGAGGG + Intronic
1191941178 X:66483251-66483273 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192248441 X:69391698-69391720 ATGTGGAAGAGGGGAGAGCAGGG - Intergenic
1192265940 X:69538326-69538348 GGGTGGAACAGGACAGTGGAGGG - Intergenic
1192481486 X:71490054-71490076 AAGTAGGAGGGGAAAGTGGAGGG - Intronic
1192831817 X:74758156-74758178 TTGGGGAAGAGGAGAGTGGGTGG + Intronic
1192880770 X:75281299-75281321 ATGTTGAAGAGGAATGGTGAGGG + Intronic
1192889430 X:75373222-75373244 ATGTGGAAAATGCAAGTAGAAGG - Intronic
1192898791 X:75472533-75472555 TTGGGGAAGAGGTATGTGGATGG + Intronic
1193137511 X:77988635-77988657 GTGCTGAAGATGAAAGTGGAAGG + Exonic
1193228688 X:79016406-79016428 ATGTTGAAGAGGAATGGTGAGGG - Intergenic
1193447239 X:81619388-81619410 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195748847 X:108144735-108144757 TTGGGGAAGAGGTATGTGGATGG - Intronic
1195789133 X:108562065-108562087 ATCTGAAAGAGTCAAGTGGATGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196135877 X:112209213-112209235 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1196591482 X:117490385-117490407 GGGTGGAAGATGAATGTGGAGGG - Intergenic
1196761744 X:119207070-119207092 ATGGGGTAAAGGAATGTGGATGG + Intergenic
1197002381 X:121453545-121453567 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1197084118 X:122452872-122452894 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197244963 X:124158365-124158387 TTGGGGAAGAGGTATGTGGATGG - Intronic
1197329411 X:125134951-125134973 AGGTACAAGAGAAAAGTGGATGG + Intergenic
1197379921 X:125727277-125727299 TTGTGGAAGAGGTATGTAGATGG - Intergenic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1197409245 X:126095818-126095840 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198126140 X:133645823-133645845 ATGTGGAAGATGAGAGTGGGTGG + Intronic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1198867017 X:141133908-141133930 TTGAGGAAGAGGAGACTGGAGGG + Intergenic
1199310350 X:146313773-146313795 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199650812 X:149944912-149944934 AGGTGGAAGAAGAAAGGAGAAGG + Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200017245 X:153176352-153176374 ATGTGGAAGATTCAAGTGAATGG + Intergenic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200258697 X:154600031-154600053 AGGGGGAAGAGCAAGGTGGAGGG + Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201300388 Y:12499737-12499759 ATGAGAAAGAGGAAAATGGCTGG + Intergenic
1201589186 Y:15595010-15595032 ATGTGGAGGAGTAAAGAGAAAGG + Intergenic
1201796583 Y:17903010-17903032 TTGAGGAAGAGGTATGTGGACGG - Intergenic
1201804972 Y:18002975-18002997 TTGAGGAAGAGGTATGTGGACGG + Intergenic