ID: 934899497

View in Genome Browser
Species Human (GRCh38)
Location 2:98146728-98146750
Sequence CTCCTAGTTTAGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934899491_934899497 24 Left 934899491 2:98146681-98146703 CCCATCTCAGCTGTTCTCCATAG 0: 1
1: 0
2: 4
3: 13
4: 204
Right 934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 236
934899495_934899497 0 Left 934899495 2:98146705-98146727 CCTTATCAGTATGTTATTTTTGT 0: 1
1: 0
2: 4
3: 53
4: 571
Right 934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 236
934899494_934899497 1 Left 934899494 2:98146704-98146726 CCCTTATCAGTATGTTATTTTTG 0: 1
1: 0
2: 4
3: 51
4: 528
Right 934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 236
934899493_934899497 7 Left 934899493 2:98146698-98146720 CCATAGCCCTTATCAGTATGTTA 0: 1
1: 0
2: 0
3: 16
4: 157
Right 934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 236
934899492_934899497 23 Left 934899492 2:98146682-98146704 CCATCTCAGCTGTTCTCCATAGC 0: 1
1: 0
2: 4
3: 16
4: 247
Right 934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934899497 Original CRISPR CTCCTAGTTTAGAGGAAAAA AGG Intronic
902261957 1:15232527-15232549 CTCTTAGTTTGCAGGAAACATGG + Intergenic
905822375 1:41003607-41003629 CTCCCATTTTACAGAAAAAACGG - Intronic
905908250 1:41634008-41634030 CTCCGAGCTTGGAGGAAAAAGGG + Intronic
907641624 1:56196260-56196282 CTCACAGTCTAGTGGAAAAATGG - Intergenic
907842652 1:58172071-58172093 CTCCTTGATTAGAGTATAAAGGG - Intronic
909109912 1:71462062-71462084 CACCTAGTTTAAAAGAATAATGG - Intronic
909169491 1:72276949-72276971 CTCCTAGGTTGAAGGAATAAAGG + Intronic
909583956 1:77268580-77268602 CTACTAGTTTGGAGGAGAACTGG + Intergenic
912363228 1:109112372-109112394 GTTCTAGTCTAGAGGAACAAGGG - Intronic
913025999 1:114841067-114841089 CTTCAAGTTTAGAGGAAAGGAGG - Intergenic
913159557 1:116132850-116132872 CTCCTACTTTACGGGGAAAATGG - Intronic
914760552 1:150595090-150595112 CTCACAGTTTAGAGGTCAAAAGG + Intergenic
915924905 1:160009661-160009683 TTTCTAGGGTAGAGGAAAAATGG - Intergenic
916990068 1:170233514-170233536 CTCCTAGGTATGAGGAACAATGG - Intergenic
917059180 1:171017965-171017987 CTACTAGTTTGGAGGAAGCAAGG + Intronic
918654367 1:187006094-187006116 CTCTTAGTCTATAGGAGAAAGGG - Intergenic
919288401 1:195596165-195596187 CACGTAGTTTAGATGATAAAGGG - Intergenic
919670846 1:200336565-200336587 CTCATAGTTTACAGGAAGTAAGG - Intergenic
921788030 1:219256105-219256127 CTTCTATAGTAGAGGAAAAAAGG - Intergenic
922248845 1:223827666-223827688 GACCTAGTTGAGAGGGAAAATGG + Intronic
923799531 1:237193976-237193998 TTCAAAGTTTAGAAGAAAAAAGG - Intronic
1063327456 10:5118599-5118621 TAACTAGTTTAGAGGAAAAGAGG + Intronic
1063403192 10:5767702-5767724 CTTCTAGTTGAAAGGAAAATGGG + Intronic
1063435878 10:6029637-6029659 CTGCTAATTTAAAGAAAAAATGG + Intronic
1064874166 10:19974471-19974493 CTCTTAGCTCAGAGGAAGAAGGG + Intronic
1066683265 10:37956259-37956281 CTCAGAGTTTAAAGAAAAAATGG + Intronic
1067341358 10:45407538-45407560 CTCCAAATTTAAAGGGAAAAGGG + Intronic
1067971289 10:50973697-50973719 CTCCTAATGTAAAGGGAAAAGGG - Intergenic
1068355659 10:55905856-55905878 ATTTCAGTTTAGAGGAAAAAGGG + Intergenic
1068680638 10:59816255-59816277 TTCTAAGTTTAGAGAAAAAAAGG + Intronic
1069099596 10:64303065-64303087 ATCCTAGTTTAAATGGAAAATGG - Intergenic
1073665553 10:105529314-105529336 CTCCTATTAAAGAGAAAAAATGG + Intergenic
1074394186 10:113083950-113083972 CTCCAAGTCTAGATGTAAAAGGG - Intronic
1076194418 10:128506352-128506374 CTTCTAGTTTTCAGGAAATATGG - Intergenic
1076604655 10:131681571-131681593 CTACTAGTTTAGAGTAAAGCAGG + Intergenic
1076765718 10:132631860-132631882 CTCCTACCTTAAAGGAAAAAAGG - Intronic
1077660631 11:4065506-4065528 TTCCCAGTTTAAAGGATAAAAGG - Intronic
1077973933 11:7225947-7225969 CTACTTGATGAGAGGAAAAATGG + Intergenic
1080074348 11:28131129-28131151 TTTCTAGGTTAGAGGAAAGAAGG + Intronic
1082192192 11:49259704-49259726 CTCACAGTCTAGAGGACAAAAGG + Intergenic
1085325228 11:75601576-75601598 CTCCTAGCTTAGAGCAAGAGAGG + Intronic
1085921863 11:80967022-80967044 TTGGTAGTTTAGAGGAACAAAGG + Intergenic
1086424051 11:86666722-86666744 CTCCTAGTTGAGAGAAACAGTGG - Intronic
1086583441 11:88425170-88425192 CACATAGGTTAGAGGTAAAAGGG + Intergenic
1086673938 11:89581339-89581361 CTCACAGTCTAGAGGACAAAAGG - Intergenic
1087352999 11:97057158-97057180 CTTCAACTTTAGAGAAAAAAGGG + Intergenic
1088746387 11:112808193-112808215 CTCCTGTTTTAGTGGAAGAAGGG + Intergenic
1091103547 11:132897738-132897760 CACTTTGCTTAGAGGAAAAATGG + Intronic
1093006383 12:14055870-14055892 CTCCTTGTTAAATGGAAAAAGGG + Intergenic
1094349531 12:29508568-29508590 CTTCTAGTTTAGTGAAGAAAAGG - Intronic
1094432698 12:30387690-30387712 CTACCAGCTTAGAGTAAAAATGG - Intergenic
1097802894 12:63934474-63934496 CTACGAGTTCAGAGGAAAGAAGG - Intronic
1098033847 12:66282194-66282216 CAACTAGTTTGGAGGAAAGATGG - Intergenic
1098322265 12:69258070-69258092 ATCCTAGTTTCCAGGAACAAAGG - Intronic
1099068954 12:78021426-78021448 TTGCTATTTTAGAGGAAATATGG - Intronic
1102539551 12:113608814-113608836 CTCCCAGTATGGAGGAAAGAAGG + Intergenic
1103981613 12:124740473-124740495 CAACTAGCTTAGGGGAAAAAAGG - Intergenic
1106163018 13:27217144-27217166 CTCCTTGATTAGAGGATAGAGGG - Intergenic
1107583737 13:41820912-41820934 CTCCTAGTTAGGACAAAAAAAGG + Intronic
1108025016 13:46168647-46168669 CTCCTAGTTTCTAGGCAAGACGG + Intronic
1108911225 13:55553788-55553810 CTCCATGTGTAGTGGAAAAATGG - Intergenic
1109085609 13:57967241-57967263 CTCCAAATTTAAAGGAGAAAGGG - Intergenic
1111937812 13:94574549-94574571 TTCCTAGTTTCTAGGAGAAAGGG + Exonic
1112537148 13:100270572-100270594 CTACTTATTTAGAGAAAAAAAGG + Intronic
1113742279 13:112719736-112719758 CTCCTATTTTTGAGAAAAACCGG + Intronic
1114303346 14:21397945-21397967 CTCATAGCCTAGAAGAAAAAGGG + Exonic
1115762567 14:36590038-36590060 CACCAAGTGTAGAGGAGAAAGGG + Intergenic
1115791251 14:36881446-36881468 CTCCTAGCTCATAGGAAAAAAGG - Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1119012418 14:71008042-71008064 CTCCTAAGTTAGGGAAAAAAAGG - Intronic
1119023064 14:71131317-71131339 CTCCTGGTGAAGAAGAAAAAAGG - Intergenic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1120899935 14:89566931-89566953 TTCCCACCTTAGAGGAAAAAAGG - Intronic
1121814782 14:96920875-96920897 CTCCAAATTTAAAGGGAAAAGGG + Intronic
1129084851 15:73078195-73078217 CTACTAGATTAGAAGAACAATGG - Intronic
1129809325 15:78494967-78494989 CTCCTATTTAGGGGGAAAAAAGG - Intronic
1130029527 15:80298955-80298977 CTCCTACTTTACAGAGAAAATGG - Intergenic
1130355918 15:83130239-83130261 GTCATAGCTTAGAGGAAAATGGG + Exonic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1130867629 15:87946034-87946056 CTCCTAGTTGAAATGAAAATTGG - Intronic
1130871520 15:87975837-87975859 CTCATTCTTTATAGGAAAAATGG + Intronic
1131603110 15:93870339-93870361 CTCCTACTTTAGATTAAAAGTGG + Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1133900330 16:9968095-9968117 CTCCCATTTTGCAGGAAAAAAGG + Intronic
1134516307 16:14889899-14889921 CTGCTACTTTACAGGAAATAGGG + Intronic
1134703981 16:16288551-16288573 CTGCTACTTTACAGGAAATAGGG + Intronic
1134963562 16:18423563-18423585 CTGCTACTTTACAGGAAATAGGG - Intronic
1134967857 16:18506162-18506184 CTGCTACTTTACAGGAAATAGGG - Intronic
1138015404 16:53423704-53423726 TTCCTAGTTTAGAGGGTTAAAGG - Intergenic
1140060378 16:71564361-71564383 CTCAGACTTTAAAGGAAAAATGG - Intronic
1140207631 16:72946755-72946777 CTCCTAGTTCTGAGGATCAAGGG + Intronic
1141590250 16:85063653-85063675 CTCACAGTTCAGAGGGAAAAAGG - Exonic
1141943716 16:87295966-87295988 CTACAAGTTTACAGGAAACACGG + Intronic
1144685229 17:17221705-17221727 CTACCAGTTTAAAGAAAAAATGG + Intronic
1146136493 17:30325878-30325900 CCCTTATTGTAGAGGAAAAAAGG - Intronic
1146535626 17:33648080-33648102 CTCACAGTTCAGAGGCAAAAAGG - Intronic
1148109897 17:45138414-45138436 CTGCTTGCTCAGAGGAAAAAAGG - Intronic
1148943721 17:51239544-51239566 CTTCTGATTTAGAGGTAAAAGGG - Intronic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1151039478 17:70841897-70841919 ATCATATATTAGAGGAAAAATGG + Intergenic
1151318286 17:73337266-73337288 CACCCAGTTTACAGGCAAAAAGG - Exonic
1151351512 17:73534752-73534774 CCCCTAGATGAGAGGAAGAAAGG - Intronic
1153741896 18:8138228-8138250 CTCCTAGTTAGGATGAAGAAGGG - Intronic
1154053188 18:10983152-10983174 CTACAAATTGAGAGGAAAAAGGG + Intronic
1155860839 18:30897359-30897381 CTCTGAGTTTGGTGGAAAAAAGG + Intergenic
1156956043 18:42964660-42964682 CTCCAAATTTAAAGGAGAAAGGG - Intronic
1162709625 19:12582900-12582922 CTTGTATTTTAGGGGAAAAATGG - Exonic
1163352962 19:16790907-16790929 CTCCCAATTCAGAGAAAAAAAGG - Intronic
1165635148 19:37334176-37334198 CTCCTACTCTAGGGGACAAAGGG + Intronic
1165789355 19:38482289-38482311 CTCCCAGTTTACAGGAAATATGG - Intronic
1168280357 19:55302377-55302399 CTCCCAGGTTTGAGGGAAAAAGG + Intronic
1168632747 19:57970197-57970219 CTTCTTATTTACAGGAAAAAAGG - Intronic
926367600 2:12147220-12147242 CTCCAAGGTTAGAGGAGAAGTGG - Intergenic
929707554 2:44229570-44229592 TTCCCAGTTTACAGGAAAAAAGG - Intronic
930353795 2:50291795-50291817 CCCTTTGTTTAGAGGAAACAGGG - Intronic
930820482 2:55641627-55641649 TTCATAGATTAGAGAAAAAAGGG - Intronic
932074955 2:68654181-68654203 CTCTCAGTTTAGAGCTAAAAGGG - Intronic
934095551 2:88599754-88599776 CTACTGCTTTAGAGGAAAAGAGG - Intronic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
937844446 2:126564486-126564508 AGACTAGTTTAGAGGGAAAAAGG + Intergenic
937902628 2:127033040-127033062 TTACTAGTTTATAGGAAAAAAGG + Intergenic
938756516 2:134384925-134384947 CTTTTAGTTTAGAGAAAGAAGGG + Intronic
939299619 2:140318798-140318820 CTCCTATTTTACAGATAAAATGG - Intronic
939601363 2:144195073-144195095 CACCTGTTTTACAGGAAAAAAGG - Intronic
940007384 2:149020420-149020442 CTCATAGTTTGGAAGAAACACGG - Intronic
940727261 2:157348170-157348192 TTCACATTTTAGAGGAAAAAAGG - Intergenic
941297785 2:163761654-163761676 CAGCTAGTTTAAAGGAAGAAGGG - Intergenic
941777951 2:169413249-169413271 TTCCTAGGTTGGAGGAAGAAGGG + Intergenic
941885410 2:170522574-170522596 TTCCTATTTTAGACCAAAAAAGG + Intronic
942428211 2:175881464-175881486 CTCCCACTTCAGAAGAAAAATGG - Intergenic
943152934 2:184137675-184137697 GTCCTCATTTAGAGGAAAGAAGG + Intergenic
943332411 2:186575398-186575420 CTCCTAGTTGAAAAAAAAAAAGG + Intergenic
943801081 2:192058485-192058507 CTTGTAATTTAGAGGAAAAAAGG - Intronic
944341466 2:198605687-198605709 CCCCTATTTTATAGGTAAAATGG + Intergenic
946343276 2:219086579-219086601 CTCCAAGTATAGTGGAAAATAGG + Intronic
946960798 2:224983904-224983926 CTAGTTGTTTAGAGTAAAAATGG - Intronic
1168833786 20:862952-862974 CTCATAGTTTTGAGGACAACTGG + Intergenic
1169697279 20:8404459-8404481 CACCTAGTAGAGAGGATAAAAGG + Intronic
1169720449 20:8670645-8670667 CTCCAGATTTAGGGGAAAAATGG + Intronic
1170229322 20:14027867-14027889 CACCTAGTCAAGAGGTAAAAGGG + Intronic
1172210926 20:33198015-33198037 CTCATAGTTTAGAGCAAGAAAGG - Intergenic
1175226388 20:57446621-57446643 CTCCAAATTTAAAGGAGAAAGGG + Intergenic
1175337869 20:58207704-58207726 CTCCTGGCTTTGAGGAGAAATGG - Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1177164249 21:17581879-17581901 CTACTAGTACAAAGGAAAAATGG - Intronic
1177412036 21:20741593-20741615 CTCCGAGTTATGAGGAAACATGG + Intergenic
1177749494 21:25262755-25262777 CTCCAAATTTAAAGGAGAAAGGG - Intergenic
1184310089 22:43635651-43635673 CTCCCAGTTTACATGAAAAGCGG + Intronic
949922295 3:9012630-9012652 CTCCTAGGTGAGAGGAGACAAGG + Intronic
951037982 3:17954721-17954743 CTCCCAGTTTACAGGAAATATGG - Intronic
953398921 3:42595396-42595418 CTACTAGTTTACAGGAAAAGTGG - Intronic
954837216 3:53480508-53480530 CTGGGAGATTAGAGGAAAAAGGG + Intergenic
956824595 3:72986058-72986080 CTCCATGTTCAGATGAAAAATGG + Intronic
956942688 3:74182043-74182065 ATCCTAGTTTTGAGGAAACATGG - Intergenic
959362452 3:105410314-105410336 GTCTTAAATTAGAGGAAAAAAGG + Intronic
959436102 3:106317114-106317136 CTCCCAGCTTAGAGAGAAAAGGG - Intergenic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
961518497 3:127453423-127453445 CTCCTAGTTCAGTGGAAAGCTGG - Intergenic
962041132 3:131708452-131708474 CTCCAAGTATAGATGATAAATGG + Intronic
963603323 3:147395200-147395222 CTTCTAGTTAACAGAAAAAAAGG - Intronic
963931983 3:151012891-151012913 CTCCTAGGATATAGGAAACAGGG - Intergenic
965167854 3:165219717-165219739 CTTCTAGTTTAGAGGAAAACGGG + Intergenic
966489147 3:180507039-180507061 CTACTAGTTGAGTTGAAAAATGG - Intergenic
967421640 3:189279713-189279735 CACCCAGTTTGGAGGAGAAATGG + Intronic
968077009 3:195821553-195821575 CTCTCCCTTTAGAGGAAAAAGGG + Intergenic
969161482 4:5263080-5263102 CTCATAGTCTAGTGGAAAGAGGG - Intronic
969667322 4:8567560-8567582 CTCCAAATTTAAAGGAGAAAGGG + Intronic
970464297 4:16307511-16307533 CTCCTGGTGGAGGGGAAAAATGG + Intergenic
970914530 4:21317397-21317419 CTCCTTATTTTGAGAAAAAAAGG + Intronic
971676207 4:29632656-29632678 ATCCTAGTTGAGAGAAGAAATGG - Intergenic
972050398 4:34725335-34725357 CTCTTGGTTTAGTGGGAAAAAGG - Intergenic
973697051 4:53500328-53500350 CACCTAGCTTGGTGGAAAAAGGG + Intronic
974770611 4:66406616-66406638 CTCCTAGTTCCTATGAAAAAGGG - Intergenic
977831366 4:101597520-101597542 TCCATAGTTTAGAGGTAAAAGGG + Intronic
983922818 4:173365718-173365740 CTCCTGGTTCAGAGGAAATGGGG + Intergenic
984973089 4:185208057-185208079 CAACTATTTTAGAGGCAAAAGGG + Intronic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985292371 4:188399801-188399823 CTCCTGATTTAAAGGGAAAAGGG + Intergenic
985892529 5:2726679-2726701 CTCCAAGTTGAGAGATAAAATGG + Intergenic
986092649 5:4525305-4525327 CTCCTCATTTAGTGGAAAACAGG - Intergenic
987930173 5:24391586-24391608 CTCCTAGATTAGAGTATAGAGGG - Intergenic
988805717 5:34738611-34738633 TTCCTAATTCAGAGGAATAAAGG - Intronic
989479931 5:41918840-41918862 TTCCCATTTTAGAGGAAAAGAGG + Exonic
989598922 5:43183700-43183722 TCCATAGTTTAGAGTAAAAAAGG - Intronic
989643957 5:43608912-43608934 CTCCAATTTTAGTGGGAAAATGG + Intronic
989960870 5:50413454-50413476 TTCCCAGTTTACAGGAAACATGG + Intronic
990568511 5:57054484-57054506 TTCCTAGTTTAGAAGGAAAGAGG + Intergenic
990574105 5:57108305-57108327 CTACCAGTTTATAGGAAATATGG + Intergenic
991432505 5:66562899-66562921 TTCTTATTTAAGAGGAAAAATGG - Intergenic
992178791 5:74176469-74176491 CTCTTAGTTTAGCGCAAGAATGG - Intergenic
993153470 5:84191056-84191078 CTGCTAGTGTAAATGAAAAAGGG - Intronic
993351963 5:86861352-86861374 ATGCTAGTTTAGAAGAACAAAGG - Intergenic
993372083 5:87105408-87105430 CTCTTAGGTTGGAGGAACAAAGG + Intergenic
993656701 5:90586577-90586599 CTTCCAGTTTACAGGAAAAATGG - Intronic
993871033 5:93254226-93254248 CTACTGGTTTAGAAGGAAAATGG - Intergenic
994231452 5:97313846-97313868 CTCCTTGATTAGAGTATAAAGGG + Intergenic
995000773 5:107125706-107125728 CTTCCATTTTAGAGGAAATATGG - Intergenic
996014876 5:118521967-118521989 CTTCTAGTCTAGAGGAATCAAGG - Intergenic
996282932 5:121753884-121753906 CTCCAAATTTAAAGGGAAAAGGG + Intergenic
1000982918 5:167835857-167835879 CTCCTAGTTTCCATTAAAAAGGG - Intronic
1002153537 5:177256642-177256664 CTACAAGTTTACAGGAAATATGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1007152078 6:39703407-39703429 TTCCCATTTTAGATGAAAAACGG - Intronic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1008158675 6:48049633-48049655 ATAGGAGTTTAGAGGAAAAATGG - Intronic
1009213656 6:60893528-60893550 TTCCAAATTCAGAGGAAAAAAGG + Intergenic
1010791702 6:80072493-80072515 CTCCTAATAAAGAGTAAAAAGGG + Intergenic
1011026994 6:82880275-82880297 CTCCTGGTTCAGAGAAGAAAGGG + Intergenic
1011749637 6:90442098-90442120 CTCCTTATTTAAAAGAAAAAAGG - Intergenic
1012049083 6:94316728-94316750 TTCCTAATTTGGAGGAGAAATGG - Intergenic
1012640585 6:101606811-101606833 TTCCTGCATTAGAGGAAAAATGG + Intronic
1014401288 6:120993585-120993607 CTCCTATTTTACAGTGAAAATGG - Intergenic
1016166743 6:140954609-140954631 CTTCTAGTTTGGAGGAATTAAGG + Intergenic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1017873663 6:158506078-158506100 CTCCAAGTTTGCAGGAAATAAGG - Intronic
1018056462 6:160056434-160056456 CTCCCAGTTGAGAGAAAAGATGG - Exonic
1024668218 7:51566465-51566487 TTCTGAATTTAGAGGAAAAAGGG - Intergenic
1027209684 7:76135537-76135559 CTCCTGGGTTGGAGGCAAAAGGG - Intergenic
1027496677 7:78895814-78895836 TTTATAGTTTTGAGGAAAAAGGG + Intronic
1027876005 7:83769498-83769520 CTCATTGTTTAGTGGAAAAAAGG + Intergenic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031380388 7:121078697-121078719 CTCCCAGTTTGGAGGTGAAAAGG - Intronic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1032903508 7:136337967-136337989 CTTCTAGTTTAAAGGCAAGATGG + Intergenic
1034641876 7:152610673-152610695 CTACTAGTTTATAGAAAATATGG + Intergenic
1038436473 8:27540109-27540131 TTCCTGCCTTAGAGGAAAAACGG + Intronic
1038602367 8:28958392-28958414 CTTAAAGTTTACAGGAAAAATGG - Intronic
1041266350 8:56069192-56069214 TTCCTAGGTTAAAGGAAATAAGG + Intronic
1041554739 8:59141085-59141107 CTCCTGGTATAGAAAAAAAAAGG + Intergenic
1043711047 8:83419527-83419549 CTCCTAGTTGGGAGAAATAATGG + Intergenic
1043814499 8:84785529-84785551 CACCGAGTTTGAAGGAAAAAAGG - Intronic
1044476201 8:92629319-92629341 TCCTGAGTTTAGAGGAAAAATGG - Intergenic
1044609039 8:94073898-94073920 CTCCTAGGTTAGAGGCTAAGAGG - Intergenic
1045161206 8:99547121-99547143 ATGCTAGTTTAGATAAAAAAGGG + Intronic
1047032315 8:120896142-120896164 CTCCCAGTTGTGAGAAAAAAGGG - Intergenic
1048009835 8:130446650-130446672 CTCCTGGTAGAGAGGAGAAAGGG - Intergenic
1048507703 8:135035602-135035624 CTCCCAGGTTAGAAGACAAAAGG - Intergenic
1051194990 9:14554423-14554445 CTCCTAGTTTGAAGCTAAAAGGG + Intergenic
1053242900 9:36510908-36510930 CTTATAGTCCAGAGGAAAAAAGG + Intergenic
1056207319 9:84333074-84333096 CTCCAAATTTAAAGGAGAAAGGG + Intronic
1056534207 9:87513833-87513855 CACCTGGTTTAGAGGAAGCAAGG - Intronic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1059609086 9:115872399-115872421 GTCCTATTTTAGAGGATAAGTGG + Intergenic
1059952210 9:119477612-119477634 GTCCTAGTGTACCGGAAAAATGG + Intergenic
1061733290 9:132633918-132633940 CTACTAGTTTACAGGAAGTATGG + Intronic
1186055693 X:5647302-5647324 CTCCAAATTTAAAGGGAAAAGGG + Intergenic
1188097794 X:26044548-26044570 CTCCTTGATTAGAGTATAAAGGG - Intergenic
1189130438 X:38492611-38492633 GTCTTAGTTTAGTGGAAAGATGG - Intronic
1193298794 X:79864528-79864550 CTCCCATGTTGGAGGAAAAAAGG - Intergenic
1195225437 X:102787688-102787710 CTCCAAATTTAAAGGGAAAAGGG - Intergenic
1195793367 X:108615495-108615517 CTGCTATTTTAGGGGCAAAAAGG - Intronic
1200079550 X:153569190-153569212 CTCCGGGTTTAGAGGAAGCAGGG + Intronic