ID: 934900106

View in Genome Browser
Species Human (GRCh38)
Location 2:98153030-98153052
Sequence GGGTAGGCCTAGAAGTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934900106_934900108 -10 Left 934900106 2:98153030-98153052 CCCTTTCACTTCTAGGCCTACCC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 934900108 2:98153043-98153065 AGGCCTACCCCACCCACGACAGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934900106 Original CRISPR GGGTAGGCCTAGAAGTGAAA GGG (reversed) Intronic
900465516 1:2823460-2823482 GGGCATCTCTAGAAGTGAAAAGG - Intergenic
901026060 1:6279324-6279346 GGGTAGGCTTACAAGTAAATGGG + Intronic
901412068 1:9091322-9091344 GGGTTGGGCTAGAAGTCTAAGGG - Intergenic
902804226 1:18850795-18850817 GGGTAGGGCTAGATGGGGAAGGG - Intronic
908155655 1:61350049-61350071 GGGTAGGCATGGAGGTGAAAGGG - Intronic
909685841 1:78347450-78347472 GTGTATACCTAGAAGTGGAATGG + Intronic
913573694 1:120147479-120147501 GTGTAGGTCTAGTAATGAAATGG - Intergenic
914294951 1:146312282-146312304 GTGTAGGTCTAGTAATGAAATGG - Intergenic
914555992 1:148763065-148763087 GTGTAGGTCTAGTAATGAAATGG - Intergenic
916329679 1:163600570-163600592 TGGTATTGCTAGAAGTGAAATGG + Intergenic
917193915 1:172446725-172446747 GGGTAGGCCTAGAATACAACTGG + Intronic
917529336 1:175820338-175820360 GGGTGGGACTGGAAGTTAAAAGG - Intergenic
918412474 1:184273890-184273912 GGGAAAGCCCAGAAGTGAGAAGG + Intergenic
918916276 1:190642917-190642939 GAGTAAGCAGAGAAGTGAAATGG + Intergenic
920199348 1:204249950-204249972 AGTTAGGCCTTGAAGTTAAAAGG - Intronic
920403428 1:205691796-205691818 GGGTAGGCATAAGAGTAAAATGG - Intergenic
1062766345 10:68816-68838 GGGCAGGCAGTGAAGTGAAATGG - Intergenic
1065188461 10:23191352-23191374 GGGAAGGCATTGAAGTTAAAGGG - Intergenic
1065847531 10:29758399-29758421 GGGTAGAACTAGAACTGCAAGGG + Intergenic
1070129948 10:73648882-73648904 GGGGAGGCCAAGAGGTAAAATGG + Intronic
1071524860 10:86352720-86352742 GGGAAGGTCTAGAAGTGTTATGG - Intronic
1072007414 10:91266859-91266881 GGGTTGGACTAGTAGTGAAGTGG - Intronic
1072975913 10:100057616-100057638 GGGTAGGCCTAGTACTGTAGGGG + Intronic
1073695341 10:105860429-105860451 GGGAAGGCATAGGAGTGAAAAGG - Intergenic
1074778087 10:116780959-116780981 GGATGGGGCTAGGAGTGAAAGGG - Intergenic
1076557605 10:131338175-131338197 GTGCATGCCCAGAAGTGAAATGG + Intergenic
1076733079 10:132447820-132447842 GGGTTGGCCTTGATGAGAAATGG - Exonic
1078162256 11:8851624-8851646 GGGGATTCCTAGAAGTAAAAGGG - Intronic
1078169354 11:8916875-8916897 GGGTGGTCCTAGAAGGGAACAGG - Intronic
1084516449 11:69640467-69640489 GGGTAACCCTAAAAGTTAAAGGG - Intergenic
1084948530 11:72652048-72652070 GGGCAGGCCTGGCAGGGAAAAGG + Intronic
1086739753 11:90352566-90352588 GGGAAAGGCTAGAAGTGGAAAGG - Intergenic
1088577090 11:111282977-111282999 AGGTAAGCCCAGCAGTGAAATGG - Intronic
1088596915 11:111448009-111448031 AGGTAGGCATAGAAGTAAGAGGG - Intronic
1089015343 11:115160876-115160898 GCGAAGGCCTGGAAGTGGAAGGG - Intergenic
1089295015 11:117462111-117462133 GGGAAGGCAAAGAAGGGAAAAGG + Intronic
1090047346 11:123347566-123347588 GGGAAGGGGTAGAAGGGAAAGGG - Intergenic
1091047505 11:132337509-132337531 GGGTGGGGCTAGGGGTGAAAGGG - Intergenic
1095351959 12:41223890-41223912 GGGAAGGGCTAGGAGTGGAAAGG + Intronic
1097502900 12:60428170-60428192 GGTGAGGCTGAGAAGTGAAAAGG + Intergenic
1100143482 12:91648230-91648252 GAGGAGGCCAAGAAGTGGAAAGG + Intergenic
1103175038 12:118855602-118855624 GGGTATGACTGGAAGGGAAAGGG + Intergenic
1109471121 13:62805383-62805405 AGGTAGGGCTAGAAAGGAAAAGG + Intergenic
1109732863 13:66438537-66438559 GTGTAAGCCCAGAAGAGAAAGGG - Intronic
1109962734 13:69653411-69653433 GTGTAGGCTGAGAAATGAAAAGG + Intergenic
1110627151 13:77664318-77664340 GGAAAAGCCTAAAAGTGAAAAGG - Intergenic
1110764578 13:79268155-79268177 GGGTAGTCCGAGAAAAGAAAGGG + Intergenic
1111179555 13:84645348-84645370 GAGAAGTCCTAGAACTGAAATGG - Intergenic
1113697830 13:112359903-112359925 GGGGAGGACTAGAAGTGGGAGGG - Intergenic
1114083523 14:19220600-19220622 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1114617150 14:24074397-24074419 TGGGAGGCCTAGGAGTGACAGGG - Intronic
1115742438 14:36402833-36402855 GGGTGGGACTAGAAATGAGAAGG - Intergenic
1118154526 14:63225792-63225814 GGACAGGCCTAGAGGGGAAAAGG + Intronic
1118968660 14:70612741-70612763 GAGAAGGACTAGGAGTGAAAAGG + Intergenic
1120715449 14:87836391-87836413 GGATAGGTTTTGAAGTGAAAGGG - Intergenic
1122928816 14:104923949-104923971 GGGTGGGCCAGGAAGTGAATGGG - Intergenic
1202895130 14_GL000194v1_random:2369-2391 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1124463637 15:29916882-29916904 GGGTAGGGCTTGAAAGGAAATGG - Intronic
1129117716 15:73374614-73374636 GGGCTGGCCTAGAGATGAAAGGG - Intergenic
1129121176 15:73397676-73397698 TGGTGGGCCTAGCAGTGATAGGG + Intergenic
1130833442 15:87626516-87626538 GGGTAGTTGGAGAAGTGAAAGGG + Intergenic
1130898492 15:88189165-88189187 AGGTGGGCTTAGAAGGGAAATGG + Intronic
1131408599 15:92186926-92186948 AGATGGGCCTAGAAGTCAAAAGG + Intergenic
1139777408 16:69325024-69325046 GGGTAGCTCAAGAAGGGAAAAGG - Exonic
1148717982 17:49729406-49729428 TGGTATGACTAGAAGAGAAAGGG + Intronic
1148998048 17:51729154-51729176 GGGTGGGGCTAGAGGTCAAATGG - Intronic
1152959214 18:68387-68409 GGGCAGGCAGTGAAGTGAAATGG - Intronic
1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG + Intergenic
1153992989 18:10416547-10416569 GGGGATGCCTAGAATTCAAAGGG + Intergenic
1154386015 18:13892402-13892424 GGGTAGGCCCTCAAGGGAAAGGG - Intronic
1154500202 18:14992262-14992284 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1159246763 18:65815848-65815870 GAGTAGGCATAGAAGGGAAGAGG - Intronic
1161014558 19:1977308-1977330 GGGTGAGCCTAGAGGTGAACAGG - Intronic
1164743974 19:30597415-30597437 GGTTAGCCCGAGAAGTGAATGGG + Intronic
1166722178 19:45002849-45002871 GGGAAGGGCTAGAAGAGGAAGGG + Intronic
1167263516 19:48472137-48472159 GGGTAGGCCATGAAGTGCAAAGG + Intronic
1168151296 19:54450199-54450221 GGGTAGGGCTGGGAGAGAAAAGG - Intronic
1202638466 1_KI270706v1_random:61907-61929 GGGTAGGGCTGGAAGAAAAAAGG - Intergenic
928340421 2:30438648-30438670 CGGTAGGCCTAAAAGGGTAAAGG + Intergenic
928939256 2:36710912-36710934 GAAAAGGCCTGGAAGTGAAATGG + Intronic
930085227 2:47492262-47492284 GGGGAGGAATAGAAGGGAAATGG + Intronic
934900106 2:98153030-98153052 GGGTAGGCCTAGAAGTGAAAGGG - Intronic
934950615 2:98572800-98572822 AGGCAGGCCTGGAAGAGAAAAGG - Exonic
935816346 2:106849602-106849624 GGAAAGGCCTAGAAGGGGAAAGG - Intronic
936933546 2:117815111-117815133 TCGTAAGCCTAGAAGTGAACGGG - Intronic
939510672 2:143100559-143100581 GGGTAGGCCTAGAATTGTTGGGG + Intronic
941028514 2:160485178-160485200 GAGTGGGTCTAGAAGTGAAGAGG + Intronic
943599596 2:189899114-189899136 GGGTAGCTCTAGAACTGACATGG - Intronic
944301134 2:198126239-198126261 GGGTAAGCACAGAAGAGAAATGG - Intronic
945846353 2:214949754-214949776 GGGGAGGACTGGAAATGAAAGGG + Intronic
1171410041 20:24940318-24940340 TGGTGTTCCTAGAAGTGAAATGG - Intergenic
1173207400 20:41005884-41005906 GGGTAGTCCTAGAATAGGAAGGG - Intergenic
1176614834 21:9018356-9018378 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1176710374 21:10145515-10145537 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1177858297 21:26424096-26424118 GGGAAGGCCTTGATGTGAAGGGG + Intergenic
1179448871 21:41454037-41454059 GGGAAGGCCTAGAAGGGGAGAGG + Intronic
1180294452 22:10872667-10872689 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1180497258 22:15902081-15902103 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1183395310 22:37568093-37568115 GTCCAGGCCTAGAAGAGAAATGG - Exonic
952193034 3:31043651-31043673 GGGTGGGGCTAGAAGAGACAGGG - Intergenic
952483284 3:33784329-33784351 CTGTAGGTCTAGAACTGAAAGGG + Intergenic
953753620 3:45628643-45628665 GTAAAGGCCTAGGAGTGAAATGG - Intronic
954052021 3:47987426-47987448 TGGGAGGTCTAGAAGGGAAAGGG + Intronic
954053895 3:48006032-48006054 CGGTATTCCTAGAAGTGAAACGG + Intronic
954551473 3:51485230-51485252 GAGAAGGCCAAGAAATGAAATGG + Intronic
954863743 3:53711765-53711787 CAGAAGGCCTAAAAGTGAAAAGG + Intronic
956455744 3:69419141-69419163 GGGGAAACTTAGAAGTGAAAAGG + Intronic
962396634 3:135020421-135020443 GGGGAGGAGTTGAAGTGAAATGG - Intronic
970280100 4:14445585-14445607 GGGTGGGCCTAGAAGCAGAAAGG + Intergenic
971534661 4:27734224-27734246 GGGATGGCATAGAAGCGAAAGGG + Intergenic
972337306 4:38118614-38118636 GGGCAGGGCAAGAAGAGAAAGGG - Intronic
978551141 4:109928561-109928583 GGAAAGGCCTAGAAATGAATGGG + Intronic
979193783 4:117895726-117895748 GGAGAGGCAAAGAAGTGAAAGGG + Intergenic
980014818 4:127637010-127637032 GGGTAGCCTTAGAGGAGAAATGG - Intronic
982443009 4:155458587-155458609 GGGTAGGCCTAGAATTGTCGGGG + Intergenic
983097879 4:163586387-163586409 GGGTAGGACTAGAAGTGTGTTGG - Intronic
987330503 5:16852967-16852989 GGGTAGAACTAGGAATGAAATGG + Intronic
991690676 5:69222315-69222337 GGATAGGCATGGAAGTGGAATGG + Intronic
991957347 5:72008231-72008253 GGGTAGGAGGTGAAGTGAAAAGG - Intergenic
993149868 5:84147410-84147432 GGGTACACTTAGGAGTGAAATGG + Intronic
995452826 5:112321238-112321260 GGGTTGGGGTAGAAGTGAAAAGG + Intronic
996417869 5:123229505-123229527 GGGTAGCCCTCCAAGAGAAAGGG - Intergenic
997375311 5:133393574-133393596 GGGTAGGCCCAAAAGTGGAAGGG + Intronic
997531116 5:134581787-134581809 GGCTTGGCCTGGGAGTGAAAGGG - Exonic
1009294342 6:61926281-61926303 GGGTGAGCTTAGAAGGGAAAGGG + Intronic
1011378354 6:86716041-86716063 GGATAGGCTTAACAGTGAAATGG - Intergenic
1012096979 6:94975238-94975260 GGGGAGGCCTAGAAGGAAACCGG - Intergenic
1013547704 6:111175283-111175305 GGGAAAACCTGGAAGTGAAAAGG + Intronic
1020329247 7:7001440-7001462 AGGTAAGCCTAGAAGAGTAAAGG + Intergenic
1029906736 7:104100478-104100500 GGGAAGGCCTAGAAGAAAGATGG - Intergenic
1030728661 7:112957432-112957454 GAGTAGGCTTAAAAGTGAATGGG - Intergenic
1031344468 7:120648564-120648586 GAGCAGGCAAAGAAGTGAAAAGG + Intronic
1031362416 7:120862510-120862532 GGGTTGTCCTAGCAGTGAACAGG - Intergenic
1036716550 8:11130113-11130135 GTCTAGTTCTAGAAGTGAAAAGG - Intronic
1037303842 8:17483890-17483912 GTGTAGTTCTTGAAGTGAAATGG - Intergenic
1038381015 8:27094338-27094360 GTGAATTCCTAGAAGTGAAATGG - Intergenic
1040736708 8:50516820-50516842 TGGTGTGCCTAAAAGTGAAAGGG + Intronic
1042366966 8:67948199-67948221 GGGAAGGCTTAGAAGTCAGATGG + Intergenic
1042820330 8:72923283-72923305 GGGGAGACCTAGAAATGGAAAGG + Intronic
1043256260 8:78141053-78141075 TGGAAGACATAGAAGTGAAAAGG - Intergenic
1044181313 8:89198775-89198797 GGAGAGGCCGAGAAGTGTAAAGG - Intergenic
1044542806 8:93426720-93426742 GCCTTGGCCTAGAAGTAAAATGG - Intergenic
1045061723 8:98417048-98417070 AGGTGGGCCTAGAATGGAAAGGG + Intronic
1045878869 8:107014769-107014791 GGGCAGGCCTGGCACTGAAAAGG - Intergenic
1047294755 8:123560824-123560846 TGGTCTGCCTAGAACTGAAAGGG - Intergenic
1047777151 8:128081969-128081991 GGGTAGGCCTGAAAGTGAGGGGG - Intergenic
1048802307 8:138205847-138205869 GGGTGGGCCTAGGAGTGGGAAGG + Intronic
1049174111 8:141180923-141180945 GGGTCAGCCCTGAAGTGAAAGGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1052735090 9:32333898-32333920 GGGTAGACCTGGAGGCGAAAGGG - Intergenic
1053647354 9:40131213-40131235 GTGTCCGCCTTGAAGTGAAAGGG - Intergenic
1053758373 9:41332630-41332652 GTGTCCGCCTTGAAGTGAAAGGG + Intergenic
1055720872 9:79173261-79173283 GTATAGGCCTAGAGGTGACATGG - Intergenic
1055917335 9:81418420-81418442 GGGTAGGCTTTTAAATGAAAGGG - Intergenic
1056168600 9:83961275-83961297 AGTTATGCATAGAAGTGAAATGG + Intergenic
1058254344 9:102742717-102742739 GGGAAGACGTAGTAGTGAAAGGG + Intergenic
1058879067 9:109271091-109271113 GGCTAGTCCAAGAGGTGAAATGG + Intronic
1062406116 9:136397501-136397523 GGGTAGGCTCAGAAGCTAAAGGG + Intronic
1062738901 9:138155492-138155514 GGGCAGGCAGTGAAGTGAAATGG + Intergenic
1202795138 9_KI270719v1_random:114510-114532 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1185611150 X:1394383-1394405 GGGAAGGGAAAGAAGTGAAAAGG - Intergenic
1187495868 X:19795107-19795129 GGGTGTGCATAGAAATGAAAGGG - Intronic
1187599317 X:20809387-20809409 GTGTATACCTAGAAGTGAAATGG + Intergenic
1187662383 X:21563843-21563865 GAGTAGGGCTAGAGGTAAAATGG + Intronic
1187948616 X:24450643-24450665 TTGTAGACCTAGAAGTGGAATGG - Intergenic
1189366081 X:40389759-40389781 GTCTAGGCCTAGAACTGACATGG - Intergenic
1192339844 X:70254940-70254962 GGGAAGGCCTAGAATTGAGTTGG + Intergenic
1196580697 X:117375733-117375755 TGGGAGGCCTAGAACTGACAGGG + Intergenic
1197117575 X:122851451-122851473 GGGAAGGGCTAGGAGTGCAAAGG - Intergenic
1197133208 X:123030042-123030064 GGGTAGGAATAGAAGTGAAGAGG - Intergenic
1198834268 X:140784713-140784735 GGGGAAGCCTAGATTTGAAAAGG - Exonic
1199550950 X:149060822-149060844 TGCTAGACCTAGAAGTAAAAAGG + Intergenic
1200173210 X:154094357-154094379 GGGTAGGACAAGATGTGAACAGG - Intronic