ID: 934900161

View in Genome Browser
Species Human (GRCh38)
Location 2:98153662-98153684
Sequence GCTGCCAGTAAGCCATAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934900161 Original CRISPR GCTGCCAGTAAGCCATAAAC AGG (reversed) Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
908938363 1:69402491-69402513 GCTGCAAGTAAGCCATGATCAGG + Intergenic
917212087 1:172641692-172641714 GCTGCAACTGAACCATAAACGGG + Intergenic
918547667 1:185703678-185703700 GCTGTCTGTAAGTCATAAAATGG + Intergenic
1063038519 10:2313989-2314011 GCTGCCAGAATGCCACAATCAGG + Intergenic
1073475428 10:103749422-103749444 GCTGTCTGTAAGCCAGAACCAGG - Intronic
1074944661 10:118269807-118269829 CCTGGGAGTAAGCCATAATCAGG - Intergenic
1080784152 11:35459665-35459687 GCTTCCAGTATGCCAGGAACTGG - Intronic
1084844327 11:71887584-71887606 CCTGCCAGTGAGGCAAAAACAGG + Intronic
1085931805 11:81092469-81092491 GCTGCCAGCAGAGCATAAACTGG - Intergenic
1088599409 11:111461857-111461879 AAAGCCAGTAAGCCCTAAACAGG + Intergenic
1090237829 11:125162825-125162847 GGTGTCAGTGAGCCATAAATAGG - Intergenic
1091467794 12:700520-700542 ACTGCCAGTAGGACATGAACTGG - Intergenic
1099171179 12:79366566-79366588 GTTGCAACTCAGCCATAAACAGG + Intronic
1100686390 12:96990980-96991002 GCTGCAAGGAAGCCAAGAACAGG - Intergenic
1106273834 13:28183594-28183616 GCTCTGAGTAAGCTATAAACAGG - Intronic
1110089249 13:71424609-71424631 GCTGCCAGGAAGCCATGGTCTGG + Intergenic
1111131491 13:83982669-83982691 GCTACCAAGAAGCCTTAAACTGG + Intergenic
1112072535 13:95870521-95870543 GCTGCCAGCAACACATCAACTGG - Intronic
1116697335 14:48193744-48193766 GTAGCCAGTCAGACATAAACAGG + Intergenic
1117098126 14:52317631-52317653 GCTCCCCCTAAGCCATAAACAGG - Intronic
1117506059 14:56404199-56404221 ACTGCTACTAAGCCATAAAAAGG - Intergenic
1118800648 14:69186433-69186455 GCTGCCAGTGAGCCATGACTGGG - Intergenic
1127913257 15:63435609-63435631 GCAGCTAGTCAGGCATAAACAGG + Intergenic
1129521197 15:76187353-76187375 GCAGCCAGGAAGCCATTAGCTGG + Intronic
1130061518 15:80573791-80573813 GCTAACACTTAGCCATAAACGGG - Intronic
1130855075 15:87833208-87833230 GCTGCCAAAAAGCCATGAACTGG - Intergenic
1132652201 16:1026598-1026620 GCTGCCAGCAACCCATAGGCTGG + Intergenic
1139968448 16:70758656-70758678 GCTGCCAGGCAGCCAACAACTGG + Intronic
1142497197 17:312376-312398 GCTGTCTGCAAGCCATGAACAGG + Intronic
1142721080 17:1776364-1776386 ACTGCCAGAAAGCTATAACCTGG + Intronic
1143119415 17:4597713-4597735 GCTGCCAGTTAGCAAGGAACTGG + Intronic
1143347904 17:6263295-6263317 TCTGCCAATGATCCATAAACAGG - Intergenic
1143348026 17:6264516-6264538 TCTGCCAATGATCCATAAACGGG + Intergenic
1144922420 17:18775503-18775525 GCAGGCAGTCAGCCAAAAACTGG - Intronic
1145953087 17:28835511-28835533 TCTACCAGTAAGCCATAACTAGG - Intronic
1154038727 18:10833050-10833072 GCTGCCAGCAAGGCATATTCTGG - Intronic
1154256377 18:12784200-12784222 GCTGCCAAGAAGCCATAGAAGGG + Intergenic
1159514425 18:69439258-69439280 TCTGCCAGTACTCTATAAACAGG - Intronic
925987906 2:9230969-9230991 GCTGCCAGGAAGCAAGAAGCTGG - Intronic
928068260 2:28188527-28188549 GCTGCCTGTATCCCGTAAACAGG + Intronic
933108805 2:78371076-78371098 GCTGCAAGTGAGCCATTATCAGG - Intergenic
934900161 2:98153662-98153684 GCTGCCAGTAAGCCATAAACAGG - Intronic
937104916 2:119301673-119301695 GCTGGCGGTCAGCCATAATCAGG + Intergenic
937282090 2:120725066-120725088 GCTGCCAGTACCCCCCAAACAGG - Intergenic
938020396 2:127901529-127901551 GCTGCCAGCAAGCCAGGAAGAGG + Intergenic
941901282 2:170681224-170681246 TTTGCCAATAAGCCTTAAACAGG - Intergenic
943465933 2:188229237-188229259 GATGCCTGCAAGTCATAAACTGG + Intergenic
944536185 2:200712531-200712553 ACTTCAAGTAAGCCATAAAATGG + Intergenic
945264706 2:207879582-207879604 CCTGCCATTAGGCCATAACCCGG - Intronic
948718084 2:239878901-239878923 GCTGACAGCAAGCAAGAAACGGG - Intergenic
1169700288 20:8438707-8438729 GCTGTCCATAAGCCATAAAGAGG - Intronic
1178695448 21:34789133-34789155 GCTGGAAGAAACCCATAAACAGG + Exonic
1183082350 22:35464590-35464612 GCTGCCAGCATCCCTTAAACAGG + Intergenic
1183916511 22:41124998-41125020 GCTGCAAGTAAGCCATGATCAGG - Intronic
949403421 3:3689273-3689295 ACTGCCAGTAAACCACAAGCTGG + Intergenic
951171628 3:19548858-19548880 GCTGCCATTAAGATATAAGCAGG - Intergenic
951958894 3:28292216-28292238 GCTGCCCCTATGCCATAAAAGGG - Intronic
966996277 3:185283510-185283532 TCTGCCGGGAAGCCAGAAACAGG - Intronic
970176926 4:13348962-13348984 GCATCTAGTAAGCAATAAACTGG + Intergenic
971387231 4:26151985-26152007 GCTCCCAGTTTGCCATAAAGAGG - Intergenic
973704809 4:53571079-53571101 GCTGCCAGTAAGCCAAGATTAGG - Intronic
974404389 4:61447065-61447087 GCATCCAGTCATCCATAAACTGG - Intronic
982650294 4:158080047-158080069 GCAACCAGTGGGCCATAAACTGG + Intergenic
985935024 5:3090877-3090899 ACTGCCAGATAGCCACAAACTGG + Intergenic
987415483 5:17657188-17657210 ACTGCTACTCAGCCATAAACAGG - Intergenic
989385093 5:40846997-40847019 GATACCAGAAAGCCATTAACTGG + Intronic
989837069 5:46006608-46006630 TCAGCCAGTAAGCCATTAAAAGG - Intergenic
996003663 5:118393951-118393973 TCTGCCAGTAAGCTATAGATTGG + Intergenic
996072561 5:119150046-119150068 GCTGCAAGTAAGGCATATAAAGG - Exonic
1000149188 5:158482934-158482956 ACTGCCAGTAAGCTACCAACAGG + Intergenic
1000636488 5:163649797-163649819 GCTCCCAGGAAGGCATAAACAGG - Intergenic
1005234826 6:23747729-23747751 GAAGGCATTAAGCCATAAACTGG + Intergenic
1007540366 6:42637173-42637195 CCTGCAAGTAAGCGAGAAACTGG - Exonic
1018423238 6:163658208-163658230 GATGCCATTAAGCAATAACCTGG - Intergenic
1021477734 7:21081682-21081704 TCTGCCAGGAAGGCATAATCTGG - Intergenic
1022101528 7:27172299-27172321 GCTCTCAGCAAGCCAAAAACGGG - Intronic
1022709026 7:32834304-32834326 GCTGCCAAGCAGCCATGAACTGG - Intergenic
1029326741 7:99816307-99816329 GCTTCCATTAAGCCACAAATAGG - Intergenic
1030932730 7:115545095-115545117 GCTCCCAGTAAGCCAGAAGGTGG + Intergenic
1034108700 7:148515133-148515155 GCTGTCATTAAGCCCTAAAGTGG + Intergenic
1036903765 8:12690859-12690881 CCTGCCAGTAAGGCAAAAACAGG - Intergenic
1038635892 8:29286901-29286923 GTTATCAGTAAACCATAAACCGG + Intergenic
1039480611 8:37870603-37870625 GCAGCCAGTAAGCCAGACAAGGG + Intronic
1039791439 8:40879010-40879032 GCTTCCAGGAAGCCACAGACAGG - Intronic
1041195290 8:55395942-55395964 GCTGCCTGTAAACCAGAAAGTGG - Intronic
1041758209 8:61336847-61336869 TCTGCCAGTAATAAATAAACAGG + Intronic
1045840948 8:106580020-106580042 GCTGCCAGTCAATCATACACAGG - Intronic
1046191991 8:110808381-110808403 GCTAACAGTCAGCCAAAAACAGG - Intergenic
1047713768 8:127576908-127576930 CCTGGCAGTAATCCAAAAACTGG - Intergenic
1049285406 8:141772379-141772401 GGTGCAAGTAAGACATGAACAGG - Intergenic
1061583018 9:131548999-131549021 GCTGCCAAACAGCCATGAACTGG - Intergenic
1185502096 X:604721-604743 GCTGCAAGTGAGCCATGATCAGG + Intergenic
1186314291 X:8351905-8351927 TCTCCCTGTAATCCATAAACAGG - Intergenic
1186609233 X:11122811-11122833 TGTACCAGTAATCCATAAACTGG + Exonic
1189000357 X:36937608-36937630 GCTCCCAGAATGCCATCAACTGG + Intergenic
1189317823 X:40068228-40068250 ACGCCCAGTAAGCCCTAAACAGG + Intronic
1193013956 X:76711240-76711262 GCTTCCAGAAAGATATAAACAGG - Intergenic
1195588733 X:106599322-106599344 GCTGCCTGTAAACCAGAAAGAGG - Intergenic