ID: 934900166

View in Genome Browser
Species Human (GRCh38)
Location 2:98153714-98153736
Sequence GAATTCAACTGAATTTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934900166_934900170 -3 Left 934900166 2:98153714-98153736 CCAGCTAAAATTCAGTTGAATTC 0: 1
1: 0
2: 0
3: 18
4: 184
Right 934900170 2:98153734-98153756 TTCAGCGGATGGAGCCGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 108
934900166_934900169 -8 Left 934900166 2:98153714-98153736 CCAGCTAAAATTCAGTTGAATTC 0: 1
1: 0
2: 0
3: 18
4: 184
Right 934900169 2:98153729-98153751 TTGAATTCAGCGGATGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934900166 Original CRISPR GAATTCAACTGAATTTTAGC TGG (reversed) Intronic
901792285 1:11660668-11660690 GAACTCCACTGATTTCTAGCTGG + Intronic
902929956 1:19723958-19723980 GAGATCAAATGCATTTTAGCCGG + Intronic
905555572 1:38880045-38880067 GAATACAACTATATTTTAGAAGG - Intronic
905559928 1:38918551-38918573 GAATTCTTCTGAATTTCAGTAGG - Intronic
906272722 1:44493676-44493698 TAAAACTACTGAATTTTAGCTGG + Intronic
907500840 1:54878841-54878863 GAATCCAATAGAATTTTACCAGG + Intronic
913191921 1:116420105-116420127 TAATGAAACTGCATTTTAGCCGG - Intergenic
913278871 1:117165847-117165869 GAATTCAATAAAATATTAGCTGG - Intronic
916678387 1:167083144-167083166 GACATCACCTGCATTTTAGCAGG - Intronic
918019433 1:180671322-180671344 TATTTCAACAGAATTTTAACTGG - Intronic
918118259 1:181515517-181515539 AAATTCCACTGTCTTTTAGCAGG - Intronic
919295012 1:195686788-195686810 GAATTCAGCTGGAAATTAGCTGG + Intergenic
921512799 1:216053052-216053074 GAATACAACTGATTTTTACAAGG + Intronic
922709930 1:227819792-227819814 GAACACAACTGATTTTTGGCCGG + Intronic
923289605 1:232531688-232531710 GAATGCAACTGAATTTGGGTAGG + Intronic
1063799432 10:9556128-9556150 CAAATAAACTGAATGTTAGCTGG + Intergenic
1063886504 10:10585022-10585044 GAATTAAAGAGAATTTTAACAGG + Intergenic
1064177598 10:13088724-13088746 AAAATTAACTGAATATTAGCTGG + Intronic
1066616316 10:37298620-37298642 AATTGCAACTGAAATTTAGCAGG - Intronic
1075092494 10:119451557-119451579 GAACTCAGCGGACTTTTAGCTGG - Intronic
1075477415 10:122748249-122748271 CAATTCAACTTAACATTAGCTGG + Intergenic
1078664385 11:13312531-13312553 GCCTTCAACTAAATTTTATCTGG - Intronic
1079026486 11:16952120-16952142 GATTTTTAGTGAATTTTAGCTGG + Intronic
1080247663 11:30197877-30197899 GAAGTCAACTGGATTTTGGCTGG + Intergenic
1080511322 11:32975263-32975285 GAATACAACTGTATTTTCTCTGG - Exonic
1082775478 11:57241292-57241314 TAATTCAACAGACTTTTACCAGG - Intergenic
1085994867 11:81899207-81899229 GTACTCAACTGAATTCTAGAGGG - Intergenic
1086176497 11:83897548-83897570 GTATTCAAGTAAATTTTAGAGGG - Intronic
1086396124 11:86416945-86416967 GAAGTCAATTGAAGGTTAGCCGG + Intronic
1089103701 11:115984757-115984779 GAATTTAAATGAATTTATGCTGG + Intergenic
1095358363 12:41305219-41305241 AAGTTCAACAGTATTTTAGCAGG - Intronic
1098490279 12:71067909-71067931 CAATTGAACTGAGTTTGAGCTGG - Intronic
1100063406 12:90609633-90609655 GCATTCAGGTGAAGTTTAGCTGG - Intergenic
1100535258 12:95502822-95502844 GAATTCAAAAGTATTTGAGCAGG - Intronic
1102069960 12:110010394-110010416 AAATTCAGTTGAAGTTTAGCAGG - Intronic
1104076029 12:125390847-125390869 GAATTCAAGAGCATTTTTGCTGG - Intronic
1105651539 13:22383900-22383922 GACTTCATCTGAATGTTTGCAGG + Intergenic
1106359063 13:29012998-29013020 GAATTCAAGTGTATGTTTGCAGG - Intronic
1106718057 13:32411682-32411704 GATTTTAAATGAATTTGAGCGGG - Intronic
1107266293 13:38560063-38560085 GAATTCTATTGATTTTTGGCTGG + Intergenic
1107270381 13:38609077-38609099 CAATGCAAATGAATTTTATCTGG + Intergenic
1107883351 13:44852969-44852991 AAATTCAACTGAATTTCACTTGG + Intergenic
1108402213 13:50057869-50057891 AAATCCAATTGCATTTTAGCTGG + Intergenic
1108853417 13:54764158-54764180 GAAGACAACTCAATTTTGGCCGG + Intergenic
1109153120 13:58869560-58869582 GAATTCAACAGCACTTTAGAAGG + Intergenic
1112665045 13:101560329-101560351 CAAAGCAAATGAATTTTAGCTGG + Intronic
1112855199 13:103760144-103760166 GAGTCCAAGTGAATTTCAGCAGG + Intergenic
1112989497 13:105494862-105494884 GATTTTACCTGAATTTTAGGAGG - Intergenic
1113058906 13:106300117-106300139 GAATTCAACAGAATTTCATTTGG - Intergenic
1116835713 14:49767858-49767880 GAAAGCTGCTGAATTTTAGCCGG - Exonic
1116884121 14:50202328-50202350 GAATTAAACTCTAATTTAGCAGG + Intronic
1117551271 14:56839077-56839099 GAATTAAACTGAATTACAGCGGG + Intergenic
1117555743 14:56881393-56881415 GAAGTCAACAGAAGTTTGGCAGG - Intergenic
1118106018 14:62660377-62660399 GAATTCAACAGAACATTAGAAGG + Intergenic
1118384015 14:65240202-65240224 GAATTGAACTAATTTTTAGCTGG + Intergenic
1118692731 14:68355316-68355338 GAATTCACCTTAATGTTACCTGG + Intronic
1119334342 14:73819932-73819954 GAATTCAACTCAGTTTTAACTGG - Intergenic
1120138512 14:80900054-80900076 GAATTCAACAGAATTCTAAATGG - Intronic
1120983778 14:90314813-90314835 GAATTTGACTGAATTTTTGAGGG - Intronic
1125211547 15:37221750-37221772 AAATTCAACTGATTTGTGGCTGG + Intergenic
1125438499 15:39674348-39674370 GAATTGTACTTAATTTTGGCCGG - Intronic
1126589829 15:50327434-50327456 GAATACAATTGTATTTTAGGGGG - Intronic
1129899644 15:79136661-79136683 GAATTCTGCTGAAATTTAACTGG + Intergenic
1131542571 15:93287496-93287518 GAATTAATCAGAATTTCAGCAGG + Intergenic
1134378231 16:13699557-13699579 GAATTCAAGAGCATCTTAGCTGG - Intergenic
1136543810 16:30944115-30944137 GAACTGAACTGAATTCCAGCAGG - Intronic
1136967269 16:34929113-34929135 GAATTAAAATGAATTTTATGTGG - Intergenic
1137018581 16:35399761-35399783 TAATTCCAGTGAATTTTAACTGG - Intergenic
1139161858 16:64519778-64519800 GAATTTGAGTGAATTTTAGTGGG + Intergenic
1142511719 17:400050-400072 GAATACAAATGAATTTTGTCTGG - Intergenic
1145831267 17:27918226-27918248 GAAGTCAACTGACTTGTAGATGG + Intergenic
1147930640 17:43978357-43978379 GAAGTGAACTGTATTTTGGCTGG + Intronic
1151128784 17:71874075-71874097 GACAACAACTGAATTTTAGAGGG + Intergenic
1203182879 17_KI270729v1_random:80903-80925 GAATTAAAATGAATTTTATGTGG - Intergenic
1152971711 18:168220-168242 AAAATCAACTGTATTTTGGCCGG - Intronic
1153931415 18:9882892-9882914 GAATTCATCTGAATTGCAGAAGG + Intergenic
1155011995 18:21788085-21788107 GAAATCAAATGAATTTTAATAGG - Intronic
1157785183 18:50475204-50475226 GAATCAAACTGAATTTGATCAGG + Intergenic
1157897553 18:51483391-51483413 GAACTGAACTGATTTTGAGCAGG + Intergenic
1164267979 19:23639478-23639500 TAATTTAATTTAATTTTAGCTGG - Intronic
1166265397 19:41680114-41680136 GAATACAACTGTTTTTTGGCTGG - Intronic
1167029672 19:46949461-46949483 TATTTCACCTGAATTTTATCAGG + Intronic
926647586 2:15305954-15305976 GAACTCAACTGACCTTTAGGGGG + Intronic
928404635 2:31005212-31005234 GTTTTCAACCCAATTTTAGCTGG + Intronic
932552827 2:72789075-72789097 GAATTCAGCTGTATTTGAGCTGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933015669 2:77123462-77123484 GTATTCAACTGTATTTTTGTGGG + Intronic
933386137 2:81612844-81612866 GAATTCAACTAAAGTTTATCTGG - Intergenic
933436733 2:82258867-82258889 GAATTCAACTTAATTAAAGCTGG - Intergenic
934900166 2:98153714-98153736 GAATTCAACTGAATTTTAGCTGG - Intronic
935676847 2:105601780-105601802 AAATTCAAATGAGTTTTAGGGGG - Intergenic
935837143 2:107067189-107067211 GAAATCAACTTAAGTTGAGCAGG + Intergenic
937071992 2:119071423-119071445 AAATTTAACTGTATTTTAACTGG - Intergenic
940106122 2:150102452-150102474 TAATCCAAATGAATTTTTGCTGG - Intergenic
940664123 2:156586390-156586412 GAATTCAACTGAGTTGTAATAGG - Exonic
941281121 2:163552385-163552407 TATTTCAACTGCATTTTAACAGG - Intergenic
943619463 2:190131751-190131773 GAATTAAACTGAATTAGAGCTGG + Intronic
945625566 2:212201049-212201071 GTATTCATCTGAATTTTTGTTGG - Intronic
946073180 2:217051914-217051936 GAATTCAAGTGCCTCTTAGCTGG + Intergenic
947316997 2:228870833-228870855 CAATTCCACTGAAGTTTAGTTGG - Intronic
1169602943 20:7282946-7282968 GATTTAAACTGAATTTTAGTTGG - Intergenic
1170302244 20:14897273-14897295 TAATGTAACTGAATTTTAGGGGG + Intronic
1171766914 20:29294439-29294461 GAATTCAACTGAAGTTCATGTGG + Intergenic
1171909053 20:30924324-30924346 GAATTCAACTGAAGTTCATATGG - Intergenic
1174803307 20:53583382-53583404 GATTTAAACTGGATTTTAACTGG - Intronic
1180561362 22:16617250-16617272 GATTTAAACTGGATTTTAACTGG + Intergenic
1181684166 22:24517018-24517040 AAATTCAACTGAAATTTGGCCGG - Intronic
1183534293 22:38387754-38387776 GATTTAAACTGGATTTTAACTGG - Intronic
1184638768 22:45857477-45857499 GAAGTCCCCTGAATTTTAGTTGG + Intergenic
949384776 3:3489246-3489268 GAATTCAACAGAGTAGTAGCAGG + Intergenic
950864770 3:16180336-16180358 GAATTTGACTGCATTTTAACAGG - Intronic
951099327 3:18668460-18668482 GAATTTAACTGAAACTTAACAGG - Intergenic
951404162 3:22273785-22273807 GAATTCAACTGAACTTCTACTGG + Intronic
953173519 3:40528957-40528979 GAATTAAACTGTATTTTAAAAGG - Intronic
953230932 3:41064368-41064390 GAAATGAACTGCATTTAAGCAGG - Intergenic
953995718 3:47518007-47518029 GAAATCAATTGTATTTTGGCCGG - Intergenic
955134459 3:56202228-56202250 GAATTGCAGTGCATTTTAGCAGG + Intronic
955451546 3:59073307-59073329 CAATTTAAATGATTTTTAGCAGG - Intergenic
957932147 3:86894182-86894204 GAATTCACTTGACTTTTAACAGG + Intergenic
958179915 3:90046940-90046962 GAATTCCCCTGAATTTTTGTTGG + Intergenic
959186105 3:103049892-103049914 GAATTAAACTGAACCTGAGCAGG - Intergenic
959304667 3:104646152-104646174 GAATTCAACAGATTTTTAAAGGG + Intergenic
959405387 3:105956611-105956633 AAATTCTACAGAATTTGAGCTGG - Intergenic
961320020 3:126066339-126066361 GAATCCAGGTGAAGTTTAGCTGG - Intronic
961473086 3:127130055-127130077 CAATTCAACTAAAAATTAGCAGG - Intergenic
963431999 3:145219283-145219305 GATTGCTACTGAAATTTAGCAGG - Intergenic
964861580 3:161208452-161208474 GAATTCAAGTAAATTTTCACTGG + Intronic
965200998 3:165657196-165657218 ATATTCAACTGAATATTAGAGGG + Intergenic
966130338 3:176630433-176630455 GAAGTCAACTGAATTTCCACTGG - Intergenic
968310853 3:197682012-197682034 GAATTCACCTACATTTTAGTTGG + Intronic
970086738 4:12356200-12356222 GAATACAATAGAATTTTTGCTGG - Intergenic
971118849 4:23681227-23681249 GAATTCATCTGACTTTTATAAGG + Intergenic
971180083 4:24322084-24322106 GAATTCTACAGCATTATAGCTGG - Intergenic
972041005 4:34599074-34599096 GTGTTCAACTAGATTTTAGCTGG - Intergenic
975920890 4:79385941-79385963 TAACTAAACTGAAATTTAGCTGG + Intergenic
978038631 4:104029477-104029499 GCATTCAAATGCATTTTAGCAGG + Intergenic
978396795 4:108289319-108289341 AAATTCAACTGATTTTAAACTGG + Intergenic
982142120 4:152334136-152334158 GTATTAAACTGAATATTGGCTGG - Intronic
983770513 4:171543268-171543290 GAATTCAAGAGAAAATTAGCAGG - Intergenic
984251943 4:177346155-177346177 TAATTCAACTGAATTAGAGAGGG - Intronic
986079249 5:4372489-4372511 GAATTCACCTGCATTTTGGCAGG - Intergenic
988873433 5:35416606-35416628 GACATCAACTGAATGTTTGCGGG - Intergenic
989126242 5:38054886-38054908 GAATTGAATTGAATTGAAGCTGG + Intergenic
989408251 5:41086573-41086595 GTACTCAACTGAATTCTAGAGGG + Intergenic
990291840 5:54360018-54360040 GAATTCAAGTGAAATTTGGAAGG - Intergenic
991016539 5:61939176-61939198 GACTCCCCCTGAATTTTAGCAGG - Intergenic
992547214 5:77824921-77824943 TAATTCAACTGAAATTGTGCTGG + Intronic
993069419 5:83140778-83140800 GGATTCATCTCAATTCTAGCTGG + Intronic
994379994 5:99059211-99059233 GAATTCAGGAGAATCTTAGCTGG - Intergenic
998752422 5:145337388-145337410 GAATTGAACTGAATTATTACAGG - Intergenic
999445719 5:151637646-151637668 CAGTTGAACTGAATTCTAGCTGG + Intergenic
1000949253 5:167460758-167460780 AAAATCAACTGAATTTCAGTTGG + Intronic
1007138221 6:39543424-39543446 AGATTCAAGTGAGTTTTAGCTGG - Intronic
1007445291 6:41900812-41900834 GAATTCAACTGAATCTTCTTCGG - Intergenic
1008837170 6:55848225-55848247 GGAGTCAGCTGAATTTTTGCAGG - Intronic
1009636830 6:66277452-66277474 GAATTCATCTGAATTTTCTTAGG + Intergenic
1014444738 6:121514222-121514244 AACTTCAACTGAATTTTATTTGG - Intergenic
1015173595 6:130281620-130281642 GAATTAAAATGTATTTCAGCTGG + Intronic
1016543882 6:145198537-145198559 GAATTCACCTAAATTTTAGAGGG + Intergenic
1018480035 6:164181002-164181024 CAGTTCAACTGAATTTTTACAGG - Intergenic
1020590527 7:10130981-10131003 AAATTCAAAGGAAATTTAGCTGG - Intergenic
1023332067 7:39128874-39128896 GAATTCAACTGAAATTCAGTGGG + Intronic
1023443261 7:40205934-40205956 GAAATCAACTGATTCTTAGTGGG - Intronic
1023494827 7:40783919-40783941 GAATTCAACTGGCTTTTTGGTGG - Intronic
1025218554 7:57082964-57082986 GAAATAAACTGTATTTTATCAGG - Intergenic
1025629478 7:63256577-63256599 GAAATAAACTGCATTTTATCAGG - Intergenic
1025652793 7:63487475-63487497 GAAATAAACTGTATTTTATCAGG + Intergenic
1027377300 7:77564489-77564511 GAATTCATCTGAATTTTAAACGG - Intronic
1028367018 7:90044276-90044298 GAATTCAACAGCATTTTAAAAGG - Intergenic
1032369170 7:131328534-131328556 GAATCCATCTGAATCCTAGCAGG + Intronic
1034591169 7:152140678-152140700 GAAATCAACTGCATTCTAGTCGG + Intronic
1035735643 8:1885450-1885472 AAATTCAACTTAATAATAGCTGG + Intronic
1038007161 8:23441846-23441868 TAATTCAACTTGATTTTAGTTGG - Intronic
1038602714 8:28962981-28963003 TATTTTAACTGAATTTGAGCAGG + Intronic
1039014106 8:33127131-33127153 GAAGTTAACTGAATTTTATATGG + Intergenic
1039094423 8:33868160-33868182 AAATTAAACTGAATTTTTGGGGG + Intergenic
1041465042 8:58150018-58150040 GGATTCGACTGAATTATAGTGGG - Intronic
1042650727 8:71038203-71038225 TAAATCAACTGAATTGTAGCAGG - Intergenic
1042947508 8:74170003-74170025 GAATTCACCTGAGTTTCAACAGG + Intergenic
1045793069 8:106009113-106009135 GAAGGCAACTGAATTTTTGAGGG - Intergenic
1046408065 8:113800771-113800793 GAAAGCAACTTAATTTTTGCGGG - Intergenic
1050796287 9:9548050-9548072 TATTTCAACTTCATTTTAGCTGG - Intronic
1052418680 9:28211997-28212019 GACTTTAACTGGAGTTTAGCTGG + Intronic
1056177363 9:84048635-84048657 GAACTCAGCTGAATTATAGAAGG - Intergenic
1186074746 X:5865952-5865974 GAATTCTACTGGCTTTTATCTGG + Intronic
1189132114 X:38510534-38510556 GAATACAACTGAGTTTTCTCGGG + Intronic
1191113316 X:56825402-56825424 GAAGTCTCCTGAATTTTAGTTGG + Intergenic
1191766256 X:64701804-64701826 GAATTCAGCTGAAATTCATCTGG + Intergenic
1193755025 X:85398350-85398372 AAATGCAACTGAATTTTGCCAGG + Intergenic
1193800671 X:85932029-85932051 GAATTAAACTCAATTTAATCTGG + Intronic
1194150485 X:90319179-90319201 GAGTTCAACTGAGCTTTAACTGG - Intergenic
1194686092 X:96918677-96918699 GACATCAACTCCATTTTAGCTGG + Intronic
1194754192 X:97718098-97718120 GAAAACAACTGAATTTTAGATGG - Intergenic
1194889382 X:99358670-99358692 AAATTCAACTGAATTTTCTTTGG + Intergenic
1195022974 X:100848005-100848027 CAATTCAAATGCATTTTTGCGGG - Intronic
1196103157 X:111868611-111868633 GAAATCAGCTGACTTTGAGCTGG + Intronic
1196706108 X:118718643-118718665 GAATTCAACTGTATCCTAGTTGG + Intergenic
1197357707 X:125456955-125456977 GCATTCAACTGAATTGTATGAGG + Intergenic
1197823189 X:130562328-130562350 GAATTCAACTGAGGTTTAACTGG + Intergenic
1200496847 Y:3895938-3895960 GAGTTCAACTGAGCTTTAACTGG - Intergenic
1201078201 Y:10202912-10202934 GAATTCAACTGAAGTTCATGTGG - Intergenic
1201441003 Y:14008408-14008430 GAATGCAAGTTAAGTTTAGCAGG - Intergenic
1201443568 Y:14034300-14034322 GAATGCAAGTTAAGTTTAGCAGG + Intergenic