ID: 934900268

View in Genome Browser
Species Human (GRCh38)
Location 2:98154420-98154442
Sequence ATGTGTGCGCTAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934900268_934900273 17 Left 934900268 2:98154420-98154442 CCCTCTTCCCTTAGCGCACACAT 0: 1
1: 0
2: 0
3: 12
4: 143
Right 934900273 2:98154460-98154482 AGATCTCGTTTTCCCAACTAAGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934900268 Original CRISPR ATGTGTGCGCTAAGGGAAGA GGG (reversed) Intronic
902856632 1:19210789-19210811 ATTTGAGTGCTAAGGGAATACGG - Intergenic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
907442360 1:54487048-54487070 ATTTGTGCGCTAAGGAGGGATGG - Intergenic
909332131 1:74426123-74426145 CTGTGTTCGCTAAGGGGAGATGG + Intronic
910359437 1:86400417-86400439 GTGTGTGGGCTAGGGGAGGATGG - Intergenic
914665857 1:149832146-149832168 ATCTGTGCGCCAAGGGAGGACGG - Intergenic
914669908 1:149861648-149861670 ATCTGTGCGCCAAGGGAGGACGG + Intronic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
916383002 1:164234036-164234058 ATGTGAAAGCTAAGGAAAGAAGG - Intergenic
919652842 1:200167304-200167326 AGGTGTCTGTTAAGGGAAGAAGG - Intronic
919927961 1:202202265-202202287 ATGTGTGCCCTGAGGGAAAAAGG - Intronic
922656498 1:227389031-227389053 ATTTGGGTGCTAAAGGAAGAAGG + Intergenic
1064528587 10:16283907-16283929 AGGTGAGAGATAAGGGAAGAGGG + Intergenic
1065244500 10:23743525-23743547 ATATTTGCTCTAAGGGATGAAGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1070717519 10:78733341-78733363 AGGGGTGGGCTAAGTGAAGAAGG + Intergenic
1075988003 10:126804808-126804830 ACGTGTGGGCTGAGGGAAGGAGG - Intergenic
1077285927 11:1765947-1765969 AAGTCTGGGCTAAGGGAGGAGGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1079474000 11:20808814-20808836 ATCTGTGCACTAAGGAGAGAGGG - Intronic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1083261553 11:61525837-61525859 AGGTGTCCGCTAAGGTCAGAGGG + Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083723003 11:64612629-64612651 TTCTGTGCCCTAAGGGCAGAAGG - Intronic
1089137607 11:116262339-116262361 ATGTGTGTGCCAAGGGCTGAAGG + Intergenic
1089498184 11:118918319-118918341 ATGTGTACGCTAGGGGACCAGGG + Intronic
1090803388 11:130188323-130188345 GTCTGTCCGCTGAGGGAAGAGGG - Intronic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091482936 12:853733-853755 ATGTATGTGCTTATGGAAGAAGG + Intronic
1093298200 12:17417342-17417364 ATATGTGGTCTAAGTGAAGAAGG + Intergenic
1096488015 12:51996646-51996668 GTGTGTGGGGTAAGGGCAGAAGG - Intronic
1098466512 12:70793128-70793150 ATTTGTGCCCTAATTGAAGAGGG + Intronic
1101727070 12:107396536-107396558 ATCTGTGCCCTCAGGGAAGGTGG + Intronic
1106471024 13:30054210-30054232 ATGTGAGGGCAAGGGGAAGAAGG + Intergenic
1106840162 13:33678274-33678296 GGGTGGGCGCTAAGGGGAGATGG + Intergenic
1109292346 13:60491903-60491925 ATGTGTGTGCTAGGGAAATATGG + Intronic
1111488007 13:88929136-88929158 ATGTGTTGGCTAAAGAAAGAAGG - Intergenic
1113253826 13:108485628-108485650 ATCTGTGCACTTAGGGGAGAGGG + Intergenic
1113881191 13:113627592-113627614 AAGTGTGCACTTAGGGCAGAAGG + Intronic
1114426441 14:22627808-22627830 ATGTGTAAGGAAAGGGAAGAGGG - Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1115625127 14:35183780-35183802 ATGAGTCCGCTAAGTGAAAAGGG + Intronic
1116021750 14:39469643-39469665 ATCTGTGCACTCAAGGAAGAAGG - Intergenic
1117498510 14:56329447-56329469 AGGTGTGCGTAAAAGGAAGAAGG + Intergenic
1118973708 14:70659260-70659282 ATATTAGCGCTAAGGGAAAATGG + Intronic
1121113952 14:91330853-91330875 GTGTGTGGGCTAAGGGAAGGCGG + Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122573991 14:102729813-102729835 TTATGTGAGCTAAGGAAAGATGG + Exonic
1131421061 15:92305788-92305810 ATGTGAGTACTAAGGGAAGCTGG - Intergenic
1132316703 15:100895545-100895567 GTGTATGCGTTAAGGGGAGAGGG - Intronic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1136388259 16:29944136-29944158 ATGCGTGGGATAAGGGCAGAGGG + Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1141027394 16:80561114-80561136 ATGTGAGTGCCAAGGGAAGAGGG - Intergenic
1141825066 16:86472973-86472995 GTGTGTTGGCCAAGGGAAGACGG + Intergenic
1142959775 17:3545263-3545285 AAGTGTGCACTGAGGGAACACGG + Exonic
1144247166 17:13378443-13378465 ATGTTTGTGCTAGGAGAAGATGG - Intergenic
1144816558 17:18039465-18039487 ATGTGTGCGCGAGGGCAAGTCGG + Exonic
1149302427 17:55317683-55317705 AGGTCTGAGCTAAGGGTAGATGG + Intronic
1151815365 17:76469022-76469044 ATGTGTGCGCTCAAGAAAGTGGG + Intronic
1153704384 18:7730442-7730464 ATGTGTGCTTTAAGGTAATATGG - Intronic
1155382544 18:25239977-25239999 ATGTGTGTGATAAGATAAGATGG - Intronic
1156353416 18:36321309-36321331 ATGTGTGGGCTATAGGAAGGTGG + Intronic
1156553599 18:38043438-38043460 ATGTCTGCTCAAAGGGGAGAGGG + Intergenic
1157927994 18:51787529-51787551 ATGAGAGCCCTCAGGGAAGATGG + Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1164498343 19:28791177-28791199 ATGTTTGCACTAGGAGAAGATGG - Intergenic
1165984661 19:39757561-39757583 ATGTGGGCCCTAAGGGGTGAGGG + Intergenic
1166283172 19:41808716-41808738 AGGTGTGCAGTCAGGGAAGAAGG - Intronic
1166438695 19:42791579-42791601 ATGGTTGTGCTATGGGAAGAGGG + Intronic
1166487654 19:43227433-43227455 ATGGTTGTGCTATGGGAAGAGGG + Intronic
1166494489 19:43289305-43289327 ATGGTTGTGCTATGGGAAGAGGG + Intergenic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
926226679 2:10971784-10971806 ATGGGGGAGCTCAGGGAAGAGGG + Intergenic
932197309 2:69795912-69795934 ATGGTTGTGCTATGGGAAGAGGG + Intronic
932409093 2:71534745-71534767 AGGTGTGAGTTAAGGGTAGAAGG + Intronic
932680291 2:73818609-73818631 ATGGGTGGGGGAAGGGAAGATGG + Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
937150696 2:119683722-119683744 ATGTGTGCGCCAAGGTTGGAGGG - Intronic
940989842 2:160086046-160086068 ATGGTTGTGCTATGGGAAGAGGG + Intergenic
941167096 2:162094285-162094307 ATGAATGCCCTTAGGGAAGAGGG + Intergenic
945549349 2:211200248-211200270 GTGTGTGTGTTAAGGGAATAGGG - Intergenic
1169477153 20:5941932-5941954 ATGGGTGCGTTGATGGAAGAAGG - Exonic
1170771320 20:19335324-19335346 ATCTGTGGGCTAAGAGAAGCTGG - Intronic
1170819446 20:19743989-19744011 GTAGGTGGGCTAAGGGAAGAAGG - Intergenic
1175461790 20:59157344-59157366 ATCCGTGTGCTAAGGGAAGAGGG + Intergenic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1175886162 20:62292043-62292065 AAGTGTGCGCTAAGCTAGGATGG - Intronic
1175925518 20:62469444-62469466 CTGTGTGTGCTAAGGGGTGATGG - Intronic
1178256842 21:31061120-31061142 ATGTATGCTCTAAAGGAAAATGG - Intergenic
1183093536 22:35539583-35539605 ATGTGTGCCCTCAGTGAAAAAGG - Intergenic
952593208 3:34982687-34982709 GTGTGTGGGGTAAGGGAAGAGGG - Intergenic
955574578 3:60346434-60346456 ATATGTGCACTGAGGGAAGTGGG + Intronic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
971498413 4:27292414-27292436 ATGTCTCCTCTGAGGGAAGATGG + Intergenic
973738833 4:53900275-53900297 ATAAGTGCCCTAAAGGAAGAGGG - Intronic
973763759 4:54144990-54145012 TTGTATGTGCTAAAGGAAGATGG + Intronic
974789416 4:66667950-66667972 ATGTGTGCCCTATTGGAAAAGGG - Intergenic
977645122 4:99403146-99403168 ATGTCTGAGCTAGGAGAAGAAGG + Intergenic
977727421 4:100312430-100312452 ATATATGTGCTAAGGGAAAAGGG + Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978715075 4:111832222-111832244 TTGTCTGGGCTAAAGGAAGATGG + Intergenic
981749217 4:148077231-148077253 ATGAGTCGGCTAAGGGAAGCAGG - Intergenic
982266697 4:153544499-153544521 GTGTGAGGGGTAAGGGAAGAGGG - Intronic
982516151 4:156352486-156352508 ATGTTTTCCCTTAGGGAAGAAGG + Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982888732 4:160819627-160819649 ATGTTTCTGCCAAGGGAAGAAGG + Intergenic
983062469 4:163174897-163174919 ATGATTGTGCTATGGGAAGAGGG - Intergenic
984926041 4:184807906-184807928 ATGTGTGTTCTCAGGGGAGAGGG - Intronic
993476593 5:88373925-88373947 ATGTGTGGGAGAAGGTAAGAGGG - Intergenic
994625939 5:102219099-102219121 ATGTTTGAGCTTAGTGAAGAAGG - Intergenic
995870610 5:116739917-116739939 GTGTGTGTGCCAGGGGAAGAGGG + Intergenic
996761656 5:126992133-126992155 ATGTGAGCGCAAAGAGAAGCTGG - Intronic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
998586077 5:143428896-143428918 ATGTGTGCCCTAAAGTAATAAGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002448197 5:179302872-179302894 ATGTTTGAGGAAAGGGAAGAAGG + Intronic
1006414272 6:33894079-33894101 ATCTGTCAGCAAAGGGAAGAGGG + Intergenic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1007426186 6:41747673-41747695 ATGTGTGCATTTAGGGACGAGGG + Intronic
1007446688 6:41911990-41912012 GTGTGTGCGCTTAATGAAGAAGG + Intronic
1009785495 6:68333110-68333132 ATGAGTGAGCTAAGGAAAGAAGG - Intergenic
1015552416 6:134426017-134426039 ATGTGGGAGCTAAGGTAGGAAGG - Intergenic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1021228457 7:18056653-18056675 ATGTGTGCTCTAAGGCATTAAGG + Intergenic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1027978169 7:85185353-85185375 ATGTGTGCGCTAGCGGGGGATGG - Intronic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1033137557 7:138797828-138797850 ATATTTGCGCTCAGGGGAGAAGG + Intronic
1033247036 7:139726386-139726408 ATGTGAGAGCAAAGGAAAGAGGG + Intronic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1040016284 8:42702897-42702919 ATTTTTGCAATAAGGGAAGATGG + Intronic
1040045450 8:42958881-42958903 ATGTATGTGCTAGGGGAATAGGG - Intronic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043006971 8:74831794-74831816 AGGTGTGAGTTAAGGAAAGAGGG + Intronic
1048020574 8:130535275-130535297 ATGTTTGCCCAAAGGGAAGCTGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG + Intergenic
1052532525 9:29706120-29706142 ATGTGTGTGCTCAGGGCAGGCGG + Intergenic
1053307434 9:36994476-36994498 ATGTGTGTGGTCAGGGAAGTGGG - Intronic
1056832865 9:89930890-89930912 ATGTGTGGACTGAGAGAAGAAGG + Intergenic
1060027073 9:120182333-120182355 ATGTGTGCTCTTGGGCAAGAAGG + Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201235448 Y:11905908-11905930 ATGTGTGAGACAAGGGAAAAGGG - Intergenic