ID: 934902097

View in Genome Browser
Species Human (GRCh38)
Location 2:98167576-98167598
Sequence CTGAGGGTCTGGAGGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 461}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934902087_934902097 9 Left 934902087 2:98167544-98167566 CCCAGAAAACATCCTGAGTTTGG 0: 1
1: 0
2: 0
3: 21
4: 222
Right 934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG 0: 1
1: 0
2: 3
3: 56
4: 461
934902089_934902097 8 Left 934902089 2:98167545-98167567 CCAGAAAACATCCTGAGTTTGGG 0: 1
1: 1
2: 2
3: 13
4: 159
Right 934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG 0: 1
1: 0
2: 3
3: 56
4: 461
934902091_934902097 -3 Left 934902091 2:98167556-98167578 CCTGAGTTTGGGAGACTGAGCTG 0: 1
1: 1
2: 7
3: 94
4: 818
Right 934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG 0: 1
1: 0
2: 3
3: 56
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934902097 Original CRISPR CTGAGGGTCTGGAGGGACCA AGG Intronic
900365930 1:2311988-2312010 CTGGGCCTCTGCAGGGACCACGG + Intergenic
900437448 1:2638143-2638165 CTGAGGTTCTAGAGGCAACAGGG - Intronic
900489258 1:2938756-2938778 CTGAGGGTCTGTGGGGGTCATGG - Intergenic
900489427 1:2939552-2939574 CTTAGGGTCTGTAGGAACCATGG + Intergenic
900489593 1:2940560-2940582 CTGAGGGTCTGTGGGGATCACGG - Intergenic
900797822 1:4719910-4719932 CTGGGGGCCTGGTGGGACCATGG + Intronic
900951082 1:5858607-5858629 CTGAGGGTCTGAGGGGAGCAGGG - Intergenic
901230983 1:7641615-7641637 ATGAGGGTCAGGAGGGACAGAGG + Intronic
901771724 1:11533978-11534000 CTGAGGGTTTGGAGACACTAAGG + Intronic
901883421 1:12207089-12207111 GTGGGGGCCTGGAAGGACCAGGG - Exonic
901903392 1:12386930-12386952 CTGAGAGTCTAGAGAGACCAAGG + Intronic
901925724 1:12565002-12565024 CTGATGTCCGGGAGGGACCAGGG - Intergenic
902090202 1:13896978-13897000 ATGAAGGTCTGGTGGGGCCATGG + Intergenic
902622698 1:17659622-17659644 CTGGTGGTGTGGAGGGTCCAGGG + Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903668788 1:25023313-25023335 CTGAGGTTTTGGAGGAATCAGGG - Intergenic
903697572 1:25219486-25219508 CTGAAAGTCTAGAGGGACCAAGG - Intergenic
903772768 1:25774378-25774400 CTGAGGGTCAGAAAGGCCCAAGG + Intronic
904289342 1:29474058-29474080 CTGCAGGTCTAGAGGGTCCAGGG + Intergenic
904615112 1:31745434-31745456 CTGAGAGCCTGGTGGGGCCAGGG - Intronic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905090773 1:35429736-35429758 TTGAGGCTTTGGAGGGAACAAGG + Intergenic
905445937 1:38028585-38028607 CTCAGGGTGGCGAGGGACCAGGG + Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905946152 1:41902778-41902800 CTGAGGGCCTGGACGGTGCAGGG + Intronic
906299264 1:44670333-44670355 GTGAGTGGCTGGAGGGAACAGGG - Intronic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
907845799 1:58205491-58205513 CTCAGGGCCTTGAGGGGCCATGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
908868270 1:68576737-68576759 CTGAGGGTGTGGAAGTACCAGGG - Intergenic
909210965 1:72822750-72822772 CTGAGAGTCTGGGGACACCAAGG + Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913219385 1:116647149-116647171 CTGAAGGTCAGGAGAGACCCAGG + Intronic
913255174 1:116946315-116946337 CTGAGGTTCTTGAGTGACTATGG + Intronic
913293288 1:117294996-117295018 TAGAGTGTCTGGAGGGAGCACGG + Intergenic
914249804 1:145912410-145912432 CTGGGGGACTTGGGGGACCAGGG - Exonic
914928614 1:151909771-151909793 CTGAGGGGCTGAGGGGCCCAAGG - Exonic
915072327 1:153280657-153280679 CTTAGGCTCTGGAAGGGCCAGGG - Intergenic
915287501 1:154862303-154862325 GTGAGGGTCATGAGGGACCCAGG + Intronic
915980339 1:160416232-160416254 CTGAGGGGCTGGAGGCTCCACGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916450883 1:164919344-164919366 CTGAGGGTGTGTGGTGACCAAGG - Intergenic
916991352 1:170249036-170249058 TAGAGGCTTTGGAGGGACCATGG + Intergenic
918180704 1:182084280-182084302 CTGGGGCTCTGCGGGGACCAGGG + Intergenic
919983207 1:202655458-202655480 CTGAGAGTCTTCAGGGACAAGGG + Intronic
920185101 1:204154589-204154611 CTGAGGGACTAGAGGGAGCTTGG + Intergenic
920341317 1:205276725-205276747 CTTGGGGTATGGGGGGACCAAGG - Intergenic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
921196059 1:212759500-212759522 CTTAGGGCCTGCAGGGGCCAAGG - Intronic
922340083 1:224648009-224648031 TTGAGGTTCTGGAGGAACCTGGG + Intronic
922471790 1:225881697-225881719 CTGAGGCCCTGGAGGGGCCTTGG - Intronic
922816415 1:228452725-228452747 TGGAGGGTCAGGAGGGATCAGGG - Intergenic
923040833 1:230318805-230318827 CTCAGGGTCTGGTGTGGCCAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923536652 1:234857769-234857791 GTCAGGGTCTGGAGGGAGTAGGG + Intergenic
924624622 1:245688324-245688346 CTGAGGGACTGCGTGGACCAGGG - Exonic
1063187752 10:3665985-3666007 CTCAGGGTCTGGTGGCCCCAGGG - Intergenic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1064003231 10:11680817-11680839 CAGAGGGTCTTGAGGAACCCTGG - Intergenic
1064940416 10:20728114-20728136 CTGAGAGTCTGGAGAGACAAAGG + Intergenic
1065001691 10:21343144-21343166 TAGAGGTTCTGGAGGGAGCACGG - Intergenic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1066232617 10:33451537-33451559 CTGAGAGTCCGGGGAGACCAAGG + Intergenic
1069258625 10:66365381-66365403 CTCAGGGGCTGGGGGGACTAGGG + Intronic
1069358795 10:67618302-67618324 ATGCGGGGCTGGACGGACCAAGG - Intronic
1069959765 10:72072821-72072843 ATGAGGGTGTGGAGGGACACAGG + Intronic
1070402625 10:76066803-76066825 CTGAGGGTGAGGAGGAACCTTGG + Intronic
1070447810 10:76524728-76524750 CCGTGAGTCTGGAAGGACCAGGG + Intronic
1071492346 10:86144422-86144444 CTGAGGGTCAGTGGGCACCAGGG + Intronic
1072799185 10:98380984-98381006 CTGGGGGCTTGGAGGAACCAAGG + Intergenic
1072809024 10:98445505-98445527 CTCAGGGCCTGGAGAGACCAGGG - Intronic
1073595090 10:104791627-104791649 CTCAGGCTCTGCAGGGACTAAGG + Intronic
1074116380 10:110460169-110460191 TCGAGGGCCTGGAGGGAACATGG - Intergenic
1075065470 10:119286489-119286511 GTGGGGGTCTGGAGGGCCCCAGG + Intronic
1075798284 10:125136172-125136194 CGAAGGGGCTGGAGGGACCCAGG + Intronic
1075926203 10:126253745-126253767 CAGAGGGCTTGTAGGGACCAGGG + Intronic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076202183 10:128567631-128567653 CTCAGGGCCTGGAGGCAGCATGG - Intergenic
1076331702 10:129675158-129675180 CTGAGGGCCAGGCGGGAGCAAGG + Intronic
1076492946 10:130875945-130875967 CAGAGGGTCTGGACTGAACAGGG + Intergenic
1076505594 10:130970852-130970874 CTGGGGGACTGGAGGGGCCTCGG + Intergenic
1076721409 10:132395014-132395036 CAGAGGGGCAGGAGGTACCATGG + Intergenic
1076859051 10:133131549-133131571 ATGAGGGGCTGCAGGGGCCAGGG - Exonic
1076886665 10:133266213-133266235 CTGAGTGCCTGGGGGGACCATGG + Intronic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1077478126 11:2800516-2800538 CTGAGGCTGTGTAGGGCCCAGGG + Intronic
1078015750 11:7612858-7612880 GTGAGTGTCTGGAGCAACCAGGG + Intronic
1078515534 11:12018876-12018898 CTGAGGGTTTTGAGGGGTCAGGG - Intergenic
1079184061 11:18220786-18220808 CAGTGGGTCTGGAGGGTCCTGGG + Intronic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080774290 11:35371323-35371345 CTGAGGGTCCAGCTGGACCATGG - Intronic
1081246236 11:40770485-40770507 ATGAGGTTTGGGAGGGACCAGGG - Intronic
1082822803 11:57555975-57555997 CTCAGGGGCTGGAGTGACCTAGG + Intronic
1083301162 11:61740236-61740258 CGAAGGCTGTGGAGGGACCATGG + Intronic
1083593249 11:63907314-63907336 CAGGGGGTCTGGAGAGAGCAGGG + Intronic
1084036703 11:66515709-66515731 CTGAGTGACTGGATGGACAAAGG - Exonic
1084122357 11:67077207-67077229 ATGAGGGTCTGAATGGAGCACGG - Intergenic
1084796286 11:71506717-71506739 CTGAGGGTCTGGTGATACCTGGG - Intronic
1084889529 11:72229909-72229931 TTCAGGGCCTGGAGGGAACAAGG - Exonic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1085692718 11:78676971-78676993 CTGAGGGGCAGGAGGGAACGTGG + Intronic
1086401788 11:86466711-86466733 CTAAGGTTCTGGAAGGACCACGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088148338 11:106713021-106713043 CTGAGAGTCTTGGGAGACCAAGG - Intronic
1088194327 11:107258457-107258479 CTGAGGGTCATGATGGGCCATGG - Intergenic
1089183815 11:116601278-116601300 CTGAGGGTTGGGATGGATCAGGG + Intergenic
1089582342 11:119489294-119489316 CTGGGGGTCCTGATGGACCAGGG + Intergenic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1089756323 11:120690155-120690177 TTTAGGGTCTGGAGTGACGAGGG - Intronic
1089843113 11:121435984-121436006 CTGAGGCTGTGGGGGGCCCAGGG - Intergenic
1090854960 11:130603076-130603098 CAGAGGAACTGGAGGGACCCTGG + Intergenic
1091445965 12:544233-544255 CTGAGGGTCTGGGGCGGGCATGG + Intronic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093986023 12:25534501-25534523 CTGAGAGTCTGGGGAGACCAAGG + Intronic
1094523426 12:31216315-31216337 CTGATGTGCTGGAGGGACCAAGG - Intergenic
1095145613 12:38722477-38722499 TTGAGGGAGTGGGGGGACCAAGG - Intronic
1096554778 12:52396576-52396598 CTTTGGGTCTGAAGGGACCGTGG + Intronic
1098583185 12:72125914-72125936 CTGAGAATCTGGGGAGACCAAGG + Intronic
1098583349 12:72127951-72127973 CTGAGAATCTGGGGGGACTAAGG + Intronic
1099668562 12:85660826-85660848 CTGAGTTTTTGGAGGGGCCAGGG + Intergenic
1100394931 12:94177263-94177285 ATGAGGGGCTGCAGGGTCCAAGG + Intronic
1101330799 12:103756427-103756449 CTGAGGGTTTGGGGAGACAATGG - Intronic
1101614609 12:106324299-106324321 CTGAGGGACTGCAGGTACAAAGG + Intronic
1102218838 12:111180647-111180669 CTGAGGATCTGGTGGGACTGAGG + Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103975909 12:124702411-124702433 CTGAGGGTGTGCAGGTCCCATGG - Intergenic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104404852 12:128508776-128508798 CTGAGCAGCTGGAGGGAGCACGG - Intronic
1108277791 13:48828620-48828642 CTGATGCTCTGAAGGGTCCACGG + Intergenic
1111307624 13:86435289-86435311 ATGAGATTTTGGAGGGACCAGGG + Intergenic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1114031525 14:18584229-18584251 GGGAGGGACTGGAGGGACCGCGG - Intergenic
1116683648 14:48010353-48010375 CTAAGAGTCTGGAGAGACCTAGG + Intergenic
1118346436 14:64944525-64944547 CTGGGAGTCTGAAGGGTCCAAGG - Intronic
1118639103 14:67775876-67775898 CTGAGGGTATGGAAAGTCCAGGG + Exonic
1118973127 14:70654124-70654146 CTTAGGGTCATGAGGGACCCTGG - Intronic
1118982491 14:70728070-70728092 CTGAGGTTATGGAGGGCCCGGGG + Intronic
1119882444 14:78111537-78111559 CTGAGAGTCTGGGGAGACTAAGG - Intergenic
1120407219 14:84104455-84104477 GTGAGATTTTGGAGGGACCAGGG + Intergenic
1120563029 14:86019701-86019723 CTGAGGGTCTGGCTAGAACAGGG - Intergenic
1120620058 14:86752246-86752268 ATGAGGTTTTGGAGGGGCCAAGG - Intergenic
1121546513 14:94767594-94767616 CTGGGCATCTGGAGTGACCAGGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122269157 14:100560627-100560649 CTGGGGGTCTGGCCGGACCGGGG - Intronic
1122308999 14:100783034-100783056 CAGAGGGGCTGCAGGCACCAGGG + Intergenic
1122347159 14:101067656-101067678 CTGAGGGCCTGGGGGGTCCTCGG - Intergenic
1122411778 14:101529313-101529335 CAGAGGGCATGGAGGGCCCAGGG + Intergenic
1122628100 14:103094484-103094506 CTCAGGGTCTCGAGGCAGCAGGG - Intergenic
1122657093 14:103269430-103269452 CCGAGGGCCTGGATGGACCTGGG + Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1124234916 15:27981830-27981852 CTGAAAGTCTGGGGAGACCAGGG - Intronic
1125676784 15:41506251-41506273 CAGGGCGTCTGCAGGGACCAGGG - Intronic
1127274091 15:57427026-57427048 CTGAGGGGCTGGTGAGAGCAAGG + Intronic
1129388558 15:75208975-75208997 CTGATTGTCTGGAGGGTCAAGGG - Intronic
1129525692 15:76212677-76212699 CTCAGGCTCTGGAGGCAGCAGGG + Intronic
1129756691 15:78103160-78103182 CTGTGGGTCAGGGGAGACCAGGG + Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130154404 15:81337266-81337288 CTTGGGGTCTGGAGGACCCAGGG + Intronic
1130580608 15:85134304-85134326 CTTAGGGTCTAGCGTGACCAAGG + Intronic
1130700040 15:86169165-86169187 CTGAAGGCCTGGAGAAACCAAGG + Intronic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131065658 15:89433569-89433591 TTCAGAGTCTGGAGGGAGCAGGG + Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132666365 16:1082990-1083012 GTGAGTGTCTGGAAGGAGCATGG + Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133317492 16:4893497-4893519 CTGAGGCTCTGGGGGTACCGGGG - Intronic
1134026271 16:10956412-10956434 CTGGGGGTCTGGTGAGAGCAAGG - Intronic
1135738290 16:24951286-24951308 CTGAGGCTTGGGAGGGAACAGGG - Intronic
1135904445 16:26498293-26498315 GTGAGGGTGTAGAGGAACCAGGG - Intergenic
1136014464 16:27386566-27386588 CTGAGTGTGTGGTTGGACCAAGG - Intergenic
1136349048 16:29695217-29695239 CTGAGGGTGGGGTTGGACCAGGG - Intronic
1136778050 16:32882045-32882067 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1136892571 16:33979469-33979491 CTGGGGGACTGGAGGTGCCAGGG + Intergenic
1137675353 16:50301250-50301272 CGGAGGGACTGGAGGGGCCCTGG + Intronic
1138194985 16:55045377-55045399 CAGAGGGCCTGGAGGTACCTGGG - Intergenic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138651300 16:58463180-58463202 CTTAGGGTCGGGAAGAACCAGGG - Intronic
1139435204 16:66932878-66932900 CTGAGGGTCTGGGGGCTGCAGGG - Intronic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1140472856 16:75224885-75224907 CTGAGGCTCTGTGGGGAGCAGGG - Exonic
1140961125 16:79914165-79914187 CTAAGGGTATGGGGGGTCCAAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142263742 16:89054248-89054270 CTGAGGTTCTGGGGTGTCCAGGG - Intergenic
1142264782 16:89058649-89058671 CTGTGGGCCAGGAGGGACCCAGG - Intergenic
1203080469 16_KI270728v1_random:1144154-1144176 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1142867272 17:2798539-2798561 TTCACTGTCTGGAGGGACCAGGG - Intronic
1142985076 17:3690582-3690604 GTGAGGGCCTGGAGCGGCCACGG - Intronic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1144216298 17:13058468-13058490 CTGTGGGCTTGGAGGCACCATGG + Intergenic
1145978313 17:28996939-28996961 CTTAGGGTAGGGAAGGACCAAGG + Intronic
1146406098 17:32539506-32539528 TAGAGGCTCTGGAGGGAACATGG - Intronic
1146947686 17:36884946-36884968 CTGAGGGTGAGGAGGGGCCCGGG - Intergenic
1147308281 17:39578562-39578584 CTGGGTCTCTGCAGGGACCATGG - Intergenic
1147472676 17:40677598-40677620 CTAAGGGGCTGGTGGGACGACGG - Intergenic
1148047277 17:44751852-44751874 CTGAGGGGCTGCTGCGACCAAGG - Exonic
1148888483 17:50790606-50790628 CTGAGGGACTGGGAGGGCCATGG + Intergenic
1149100860 17:52904630-52904652 ATGAGGGTCTGCAGAGATCAGGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150220675 17:63494126-63494148 CTGGGTGTCTGGATGGGCCAGGG + Intronic
1150692251 17:67377021-67377043 CAGAGGGGCTGGATGGAGCACGG + Intergenic
1151355545 17:73555894-73555916 CAGAGAGTCAGGGGGGACCAGGG + Intronic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1151817394 17:76478033-76478055 CAGAGGGGCAGCAGGGACCAAGG - Intronic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1152126404 17:78449999-78450021 GTGAGTGCCTGGAGGCACCAGGG + Intronic
1152608168 17:81303320-81303342 AAGAGGGCCTGGAGGAACCATGG + Intergenic
1152631413 17:81412193-81412215 CTGCTGGCCTGGAGTGACCAGGG - Intronic
1154335438 18:13461284-13461306 TTGAGAGTCTGGGGGAACCAGGG + Intronic
1154338048 18:13481722-13481744 CTGAGGCTCTGAAGGGATCCAGG + Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1155780966 18:29835467-29835489 CTGAGAATCTGGAGTCACCAAGG - Intergenic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1156468868 18:37364938-37364960 CGGAAGGTCAGCAGGGACCAGGG + Intronic
1156737464 18:40277896-40277918 CAGAGGCTTTGGAGGGAGCATGG + Intergenic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1160096555 18:75878571-75878593 ATGAGATTTTGGAGGGACCAGGG + Intergenic
1160739396 19:679086-679108 AGGGGGGTCTGGAGGGAGCAGGG - Intronic
1160917879 19:1506397-1506419 CTGAGGGTCAGGTGGGACCTCGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161186917 19:2927205-2927227 CAGAGATTCTGGAGGGACCAGGG + Intergenic
1161424993 19:4198415-4198437 CAGAGGGTCTGGAGGGACCGCGG - Intronic
1161498530 19:4600416-4600438 CTGAGGGCCTGGAAGGGCCTGGG - Intergenic
1161586716 19:5109666-5109688 CTGAGGGTCTGGGAGGCTCAGGG - Intronic
1162553173 19:11369727-11369749 CTGTGTGTCAGGAGAGACCACGG - Intergenic
1162791854 19:13067108-13067130 CTGAGATTCTGGAGCGTCCAGGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1163827394 19:19531272-19531294 CTGTGGCTCTGGAGACACCAAGG + Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1165421264 19:35723086-35723108 CACAGGTTCTGGAGGGACCCTGG + Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165963331 19:39553425-39553447 CCGAGGGACTGGTGGGGCCAGGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166794333 19:45417311-45417333 CTGATGATCTGGAGTGGCCAGGG + Intronic
1167464493 19:49642887-49642909 CTGAGGGTCTGGGGTCTCCAAGG + Intronic
924976743 2:184280-184302 CTGAGGGACTTGATGGACCTGGG + Intergenic
925075271 2:1011210-1011232 CTGAGGGCCAGGTGGGAGCAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
926893580 2:17660044-17660066 CAGAGGGTCTGGAGCAACCGAGG + Intergenic
927089331 2:19698677-19698699 CGGAGGGTGTAGAGGGGCCATGG - Intergenic
927651714 2:24917505-24917527 CTCAGGGGCTGCAGAGACCAGGG - Intronic
928603639 2:32924603-32924625 ATGAGGGTGTGGGGGGATCAGGG + Intergenic
929422481 2:41807251-41807273 CTGTTGGTCAGCAGGGACCAGGG - Intergenic
931401720 2:61937437-61937459 CTGAAGGACAGGATGGACCAGGG - Intronic
932330684 2:70896818-70896840 GTGCGGGTCTGGAGGGTCCCGGG + Intergenic
932779961 2:74553809-74553831 GAGAGGATGTGGAGGGACCAGGG - Intronic
933715736 2:85358820-85358842 CTGAGTGGCTGGGGGGACAAGGG - Intronic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
933919514 2:87030594-87030616 CTGAGGCTCTGGAGGGGCCCTGG - Intergenic
934003480 2:87739308-87739330 CTGAGGCTCTGGAGGGGCCCTGG + Intergenic
934219016 2:90064587-90064609 CTGATGCACTGGAGGGGCCAAGG + Intergenic
934650120 2:96085836-96085858 CAGAGAGGCAGGAGGGACCAAGG + Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
934917696 2:98313501-98313523 ATGAGGGTCTGAAGGAAGCAAGG + Intergenic
936125674 2:109787562-109787584 CTGAGCCTCTGCAGGGACCAAGG - Intergenic
936219019 2:110583906-110583928 CTGAGCCTCTGCAGGGACCAAGG + Intergenic
937040208 2:118814884-118814906 CAGAGGGTCTGGGGGGTCTAGGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
938124622 2:128663047-128663069 CTGAGGGCCTGGAGGCTCCTTGG - Intergenic
938398405 2:130967354-130967376 CTGATGGGCTGGAGGCTCCAGGG - Intronic
938496671 2:131801564-131801586 GGGAGGGACTGGAGGGACCGCGG + Exonic
938809636 2:134841277-134841299 GGGAGGCTCTTGAGGGACCACGG - Intronic
939038814 2:137163911-137163933 CTTAGGGTTTGGAGGGACACTGG - Intronic
941673933 2:168324100-168324122 CAGCAGGTCTGAAGGGACCAGGG + Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946321193 2:218955489-218955511 CTGAGATGCTGGAGGGCCCAGGG - Intergenic
947792985 2:232878300-232878322 CTGAAGGTGTGAAGGGCCCAGGG + Intronic
947841100 2:233208491-233208513 CTGAGTGCCTGCTGGGACCATGG + Intergenic
948206580 2:236165895-236165917 CTGAGGGTCCAGAAGGGCCAGGG - Exonic
948268456 2:236656316-236656338 CAGAGGGTCTGAGGGGCCCAGGG - Intergenic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948840383 2:240645813-240645835 CCGAGGGTCTGGAGGGTCCCAGG + Intergenic
948860728 2:240751479-240751501 ATTAGGGTGTGGAGGGAGCAAGG - Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1168764247 20:371209-371231 CTGAGGGGCTGGACTGAACATGG - Intronic
1168821347 20:775590-775612 CTTTTGGTCTGGAGGCACCAGGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169305652 20:4488151-4488173 CTCAGGCTCTGGAGGTGCCAGGG - Intergenic
1169867046 20:10213324-10213346 CTGAGTCTCTTGAGGTACCATGG + Intergenic
1169889069 20:10433723-10433745 CTGACTGTCTGGAGGGTGCACGG - Intronic
1169905385 20:10598143-10598165 CTGAGGGACTTCAGGGACTAGGG + Intronic
1170050948 20:12144814-12144836 CTGGTGGGCTGGAGGGGCCAAGG + Intergenic
1170882768 20:20311626-20311648 CTGAGGGTCCGGGGAGACCAAGG + Intronic
1172098675 20:32473155-32473177 CAGTGGGGCTGAAGGGACCATGG - Intronic
1172232724 20:33347995-33348017 GTGAGGGGCTGAAAGGACCAAGG - Intergenic
1172477886 20:35252641-35252663 TTGACTGTCTGGAGGAACCAAGG + Intronic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1172869172 20:38125288-38125310 CTGAGGGGCTGCAGGGGCCTGGG - Intronic
1173433974 20:43016222-43016244 CCCAGGGTCTGGAGGAAACATGG - Intronic
1173465120 20:43274506-43274528 CCGAGGATCTTGAGGGGCCATGG + Intergenic
1174509737 20:51042065-51042087 CTGATGGACTGGATGGAACAGGG - Intergenic
1175327606 20:58140624-58140646 TGGAGGCTCTGGAGGGAGCACGG - Intergenic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1175886449 20:62293884-62293906 CTGAGGGCCTGGAGGGGCCTGGG + Exonic
1175914653 20:62419977-62419999 GGGAGGGGCTGGAGGGGCCAGGG + Intronic
1176064201 20:63186458-63186480 CTGGGAGTCCGGAGGGCCCAGGG - Intergenic
1176131259 20:63497776-63497798 GTGAGGGGCTGGCGGGACCCGGG + Exonic
1176163642 20:63661557-63661579 CTGAGGGTGGGGTGGGCCCATGG + Intronic
1176411159 21:6450298-6450320 CTGAGGGCCTGGAGTGAGCACGG + Intergenic
1177515774 21:22148971-22148993 ATGAGATTCAGGAGGGACCAGGG + Intergenic
1179448609 21:41452146-41452168 CTCAAGGCCTGGAGGGTCCAGGG + Intronic
1179686652 21:43058620-43058642 CTGAGGGCCTGGAGTGAGCACGG + Intronic
1179995155 21:44970851-44970873 CTGAGGGTTGGGAGGGGCCGTGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180455637 22:15511286-15511308 GGGAGGGACTGGAGGGACCGCGG - Intergenic
1180968184 22:19801307-19801329 CTCAGGGGCTGCAGAGACCATGG - Intronic
1180968787 22:19804114-19804136 CTAGGGGGCTGCAGGGACCAGGG - Intronic
1181059560 22:20275654-20275676 CTGCGGGTCTGGTGGGGCCGGGG + Intronic
1181426864 22:22849288-22849310 CTGTCTGGCTGGAGGGACCAGGG + Intronic
1181666715 22:24403603-24403625 CGGAGGGGCTGGAGGGCCAAGGG - Intronic
1181680982 22:24495584-24495606 CTCAGGGTCTGAAGGGCTCAGGG + Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182457446 22:30460949-30460971 CTGAGGCTCGGGTGGGACCCTGG + Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1183498595 22:38164638-38164660 CTGAGCTTCTGGATGGACCTGGG - Intronic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183750758 22:39719116-39719138 CTGAGGGCCTGCAGCCACCAAGG + Intergenic
1184721891 22:46319478-46319500 CTGAGGTTCTGGCGGAACCTGGG + Intronic
1184797938 22:46742548-46742570 CAGAGAGGCTGGAGGAACCAGGG + Intergenic
1185065086 22:48628113-48628135 CTGAGGCTCTGGTGGGTCCTTGG + Intronic
1185318649 22:50190212-50190234 CTGAGAGGCTGCAGGGGCCAGGG + Intronic
949119892 3:373215-373237 CTGCTGGTCTGCAGAGACCATGG + Intronic
949805602 3:7952482-7952504 AGGTGGGTCTGGAGAGACCAGGG - Intergenic
950113843 3:10438027-10438049 CTGAGGCTCTGCAGGGAGCCAGG + Intronic
950185742 3:10944519-10944541 CTGAGGGTCTTCAGGGGCCTTGG + Intergenic
950553641 3:13682423-13682445 GTGAGGGTGTAGAGGGAGCAGGG + Intergenic
950833173 3:15895210-15895232 CTGAGGTAGTGAAGGGACCAGGG + Intergenic
952111119 3:30124789-30124811 ATGAGATTTTGGAGGGACCAGGG - Intergenic
952963293 3:38606141-38606163 CTGAGGGTCTGGGGGAGCAAGGG + Exonic
953753595 3:45628210-45628232 CTGAGAGTCTATGGGGACCAAGG + Intronic
954075606 3:48177152-48177174 GTGTGGGTTAGGAGGGACCATGG - Intronic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954640638 3:52095762-52095784 CTGTGGCTCTGGAGAGGCCATGG - Intronic
954651748 3:52168885-52168907 CTGAGGGACAGGATGGACCCAGG + Intergenic
954671665 3:52294357-52294379 CTGAGGGTGTGGAGGGGCCCTGG + Intergenic
957954073 3:87161247-87161269 CAGAGGGTCTGGAGCCAGCATGG - Intergenic
958176843 3:90006481-90006503 CTGAGCATCTGGAGGTAGCAGGG + Intergenic
958729194 3:97942776-97942798 CTGAGGGTTTTTAAGGACCATGG - Exonic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
960147400 3:114217963-114217985 CTGAGAGTGTGGAAGGCCCAGGG + Intergenic
961325716 3:126108239-126108261 CTCAGGGTCTAGAGGGGACAGGG - Intronic
961734004 3:128989259-128989281 CTTAGGGCCAGGAGGGACCAGGG - Intronic
962895081 3:139706775-139706797 CTGAGGTCCTGGAGGGTCCATGG + Intergenic
963391072 3:144664926-144664948 ATGAGGTTTAGGAGGGACCAGGG - Intergenic
965549738 3:169952313-169952335 GAGAGGATCTGGAGGGGCCATGG - Intergenic
965716582 3:171611284-171611306 ATGAGTGTCTGCAGGGAGCAAGG + Intronic
967724014 3:192844680-192844702 CTGATGGGCTGGAGGCTCCAGGG + Intronic
967872977 3:194247738-194247760 AAGAGAGTCTGGAGGGACAAAGG - Intergenic
968478032 4:821530-821552 ATGAGGGTCTGCAGTGACCACGG + Intronic
968703702 4:2068775-2068797 CTGAGGGGCAAGAGGGGCCAGGG - Exonic
968810068 4:2795784-2795806 GTGAGGGTATGGAGGGGCCTGGG + Intronic
969162068 4:5269059-5269081 TTGAGAGTCTGGAAAGACCAAGG + Intronic
969304373 4:6317429-6317451 CTCTGGGCCTGGAGGCACCAGGG - Intergenic
969681473 4:8645632-8645654 ATGAGGGGCAGGAAGGACCAGGG - Intergenic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
970167218 4:13251499-13251521 CTGAGAGTTTGGAGAGACCAAGG + Intergenic
971878730 4:32340292-32340314 CTGAGGGACAGGATGGACCTGGG + Intergenic
973047570 4:45553549-45553571 CTGAGGGACTAGATGGACCCAGG + Intergenic
973990041 4:56396100-56396122 CAGATGGTGTGGAGGTACCAAGG + Intronic
974624177 4:64400488-64400510 ATGAGATTTTGGAGGGACCAAGG + Intronic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975514355 4:75229521-75229543 CAGAGAGTCTGGGGAGACCAAGG - Intergenic
975661654 4:76694926-76694948 CTGAGGGCATGGAGGTGCCAGGG + Intronic
979090641 4:116478278-116478300 CTCAAAGTCTGGAGGGGCCAAGG + Intergenic
979426295 4:120571873-120571895 ATGAGATTCTGGAGGGGCCAGGG - Intergenic
981170825 4:141621311-141621333 CTGAGGGTCAGGATGGACCGGGG - Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
982288846 4:153760113-153760135 CTGAGGTTCTGAAGGAACCGGGG - Exonic
982657833 4:158171088-158171110 CTGGGACTCTGGAGGGGCCAGGG + Exonic
984731705 4:183074690-183074712 CTGAGGGTCTGGAAGCCCCCAGG + Intergenic
985659217 5:1147527-1147549 CTGAGGGGCTGTGGAGACCAAGG - Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
985845729 5:2345706-2345728 TGGAGAGTCTGCAGGGACCAGGG - Intergenic
985885617 5:2675437-2675459 CTGATACTCTGGAGGGAACATGG - Intergenic
986012552 5:3729193-3729215 CTGAGGGTGTGGGGGCCCCAGGG + Intergenic
986284188 5:6347850-6347872 GTGAGGGCCTGGGGGGCCCAGGG + Intergenic
986630406 5:9767047-9767069 CTGAAGCTCTGGAGAGGCCATGG - Intergenic
987286835 5:16465716-16465738 CTGAGGGTCTTGTGGGGCCACGG - Exonic
988996739 5:36722234-36722256 CTGAGAGAATGGTGGGACCAGGG - Intergenic
989476595 5:41881262-41881284 CTGAGGGGCAGGATGGACCTGGG - Intergenic
990487130 5:56270242-56270264 CTGAGTCTCTGGAGGGAGCCTGG - Intergenic
992759959 5:79942851-79942873 TAGAGGTTCTGGAGGGAGCATGG - Intergenic
993821863 5:92629658-92629680 CTGAGAGTCTGGAGAGATTAAGG - Intergenic
994184464 5:96802970-96802992 CCCAGAGTCTGGAGGGAGCACGG + Intronic
996038061 5:118780882-118780904 CTGAGGGACAGGATGGACCCAGG + Intergenic
998190437 5:140019298-140019320 CTGGGGTTATGGAGTGACCAAGG - Intronic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
999823197 5:155249026-155249048 CTCAGTGTCTGGGGAGACCAAGG - Intergenic
1000287847 5:159843080-159843102 CTGAGGATATTGAGGGACAACGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002086181 5:176777087-176777109 GTCAGGGTCAGGAGGGACCGAGG - Intergenic
1002403499 5:179009220-179009242 CTGAGAATCTGGAGAGCCCATGG + Intergenic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1004440229 6:15642590-15642612 CTGAGGGTGTGGAGATCCCAGGG - Intronic
1005227314 6:23657627-23657649 CTCCGGGCTTGGAGGGACCAAGG - Intergenic
1006589997 6:35147979-35148001 ACCAGGGTCTGGAGGGAGCAAGG - Intronic
1006690174 6:35876898-35876920 CTGAGAGTCTGGAGAGACCAAGG + Intronic
1007303907 6:40889909-40889931 TTGAGGGTCTGGATGGGCCAAGG - Intergenic
1007746183 6:44044155-44044177 CTGGAGGCCTGGAGGGGCCATGG - Intergenic
1007766205 6:44161775-44161797 CTGGGGGCCTGGAAGGACCAGGG - Intronic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008244974 6:49160865-49160887 ATGAGATTTTGGAGGGACCAGGG - Intergenic
1008388689 6:50923487-50923509 CTGAGAGTCTGAAGAGATCAAGG - Intergenic
1010370595 6:75102630-75102652 CTGAGGGCCTGGAGGACCCTGGG + Exonic
1012986741 6:105883994-105884016 CAGAGGGGCTGGATGGACCCAGG + Intergenic
1013459338 6:110359574-110359596 CTGAGGATCTGGTGTGGCCAGGG - Intergenic
1014192380 6:118512235-118512257 CTGAGAATCTGGAGAAACCAAGG + Intronic
1014796548 6:125731628-125731650 CTGAGGGTCTGCAAGGCCAAGGG + Intergenic
1016409337 6:143765564-143765586 CACAGGGGGTGGAGGGACCATGG - Exonic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1018127268 6:160693467-160693489 CTGAGGCTCTGGAGGGGCCCTGG + Intergenic
1018149280 6:160923583-160923605 CTGAGGCTCTGGAAGGGCCCTGG - Intergenic
1019187723 6:170230589-170230611 TTGAGGGGCTGGAGGGACCCAGG + Intergenic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020034778 7:4958394-4958416 CGGAGGTTCTGAGGGGACCACGG + Intronic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1020550495 7:9597492-9597514 ATGAGATTTTGGAGGGACCAGGG + Intergenic
1021355600 7:19650691-19650713 CTGAGGCTCTGGAGTGAGCATGG + Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1023542616 7:41282615-41282637 CTGAGTATCTCGAGGGAACAAGG + Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1028062348 7:86338678-86338700 CTAAGAGTCTAGAGGGACAATGG - Intergenic
1029991210 7:104964144-104964166 CTGAAGGTCTGTAAGGAACATGG - Intergenic
1031478650 7:122252140-122252162 CTTGGGGTCAGGAGGGACCTGGG + Intergenic
1031479453 7:122260548-122260570 CTGATGGTTTGGAGAGACAATGG + Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033189662 7:139265823-139265845 TAGAGCCTCTGGAGGGACCATGG + Intronic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1034323577 7:150208226-150208248 CTGAGAGTCTGGGGAGAACAAGG + Intergenic
1034769617 7:153760961-153760983 CTGAGAGTCTGGGGAGAACAAGG - Intergenic
1035345681 7:158196289-158196311 CTGAAGGTCTGGGGAAACCAAGG - Intronic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036677022 8:10842637-10842659 CTGAGGCTCTGGAGAGGCCCTGG + Intergenic
1038218545 8:25585671-25585693 CTCAGGGGCTTGAGGGGCCAGGG - Intergenic
1038435366 8:27532086-27532108 GTGGGGGTCTGGAGGGTCCCAGG - Intronic
1038727993 8:30098707-30098729 CTGAGACTCTGGAGGGTCCAAGG - Intronic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1041390951 8:57347143-57347165 CTGAGGATCTGGAGGGTCCTTGG + Intergenic
1044066472 8:87705613-87705635 ATGAGAGTTGGGAGGGACCAGGG - Intergenic
1044948845 8:97416337-97416359 GTCAGGGTCTGTATGGACCAGGG - Intergenic
1045326598 8:101121982-101122004 CCCAAGGGCTGGAGGGACCATGG + Intergenic
1046255778 8:111694583-111694605 CTTAGGTTCTGGAGGGAGCAGGG - Intergenic
1046359575 8:113132299-113132321 ATGAGATTCGGGAGGGACCAGGG + Intronic
1048001145 8:130380441-130380463 CTGAGGGTTTGCAGGGTGCAGGG + Intronic
1048205792 8:132414283-132414305 CAGAGAGTCAGGAGGGAGCAGGG + Intronic
1048292740 8:133192890-133192912 CAGAGCGTGTGGAGGGACCCAGG + Intronic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048430234 8:134363497-134363519 CCAAGCATCTGGAGGGACCAAGG + Intergenic
1048528892 8:135229494-135229516 CTGAGTGTCAGGAGGGATTACGG + Intergenic
1048901176 8:139039354-139039376 CTGAGGCTCTGAGAGGACCAGGG - Intergenic
1049159977 8:141090898-141090920 CTCAGGGTCTGAGGGGCCCAAGG + Intergenic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049308451 8:141920495-141920517 CTGGGAGGCTGGTGGGACCATGG - Intergenic
1049308465 8:141920533-141920555 CTGGGAGGCTGGTGGGACCATGG - Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1051135407 9:13914606-13914628 ATGTGGTTCTTGAGGGACCAAGG - Intergenic
1052382835 9:27789912-27789934 TTGAGATTTTGGAGGGACCAGGG + Intergenic
1052591178 9:30497718-30497740 TTGCTGGGCTGGAGGGACCAAGG + Intergenic
1053013903 9:34651078-34651100 GTGAGAGTCTGGAGGAGCCAAGG - Exonic
1053489149 9:38486918-38486940 CTGTGTGTCTGGAGGAACCGGGG + Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1054450458 9:65401105-65401127 CTGTGGGCCTGGAGGGCCCCGGG - Intergenic
1056064067 9:82915539-82915561 ATGAGATTCTGGAGGGGCCAGGG - Intergenic
1056547075 9:87621840-87621862 CTGAGGGTCTAGAGTCACCCAGG - Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057669502 9:97076232-97076254 CTGTGGGTCTGGAGGAACCCGGG + Intergenic
1057759254 9:97859543-97859565 CTGAGGCACTGTAGGGACCTTGG + Intergenic
1060218289 9:121751441-121751463 CTGTCTGTCTGGAGAGACCAGGG + Intronic
1060969855 9:127731814-127731836 GTGAGGTTCTGGGGTGACCAGGG + Exonic
1061096225 9:128458127-128458149 CAGAGAGGCTGGAGCGACCAGGG - Intronic
1061159016 9:128882557-128882579 GTGAGGATCTGGGGGGACCCAGG - Exonic
1061235588 9:129341143-129341165 CTGTGGGACTGGAGAGCCCAGGG - Intergenic
1061395279 9:130340354-130340376 CTGAGGCTCTGGCTGGAGCAGGG + Intronic
1061994258 9:134175855-134175877 CTGAGGGGCTGGGGGGGCCCAGG + Intergenic
1062031627 9:134364591-134364613 CAGAGGGTCTGCAGGGGCCAAGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062377491 9:136268948-136268970 CAGAGAGTCTGGGAGGACCAAGG + Intergenic
1062382046 9:136291210-136291232 CAGAGGGCCTGGGGGGCCCAAGG - Exonic
1062527461 9:136983768-136983790 ATGAAGGTCCAGAGGGACCATGG + Intronic
1185496916 X:561568-561590 CTGAGAGTCTGGGGAGACCAAGG - Intergenic
1189291209 X:39887388-39887410 AGGGGGGTCTGGAGGTACCAGGG - Intergenic
1189952726 X:46248900-46248922 CTCAAGGTCTGAAGGGACAAGGG - Intergenic
1190301793 X:49061249-49061271 AAGAGGGGCTGGAGGGACCCTGG + Intronic
1192236133 X:69297340-69297362 CTGAGTGGCTGGAGAGACTATGG + Intergenic
1192934733 X:75848056-75848078 CTGCTGCACTGGAGGGACCATGG + Intergenic
1193009385 X:76658961-76658983 CTCAGAGTCTGGAAGAACCACGG + Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193817887 X:86125786-86125808 TGGAGAGTCTGCAGGGACCAGGG - Intergenic
1193949910 X:87784828-87784850 CTGAGAGTCTAGGGAGACCAAGG + Intergenic
1196153428 X:112400887-112400909 CTGAGAGTCTAGGGAGACCAAGG - Intergenic
1196932546 X:120695981-120696003 CAGAGGGTCTGAAGCGATCAGGG + Intergenic
1197402262 X:126006394-126006416 TGGAGCGTCTGGAGGGAGCAGGG + Intergenic
1198841891 X:140865773-140865795 CTGATGCACTGGAGGGGCCAGGG - Intergenic
1199005811 X:142694352-142694374 CCTAGGGTCTCGAGAGACCAAGG + Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1200101783 X:153691995-153692017 CTGGGGGACTGGAGGTGCCAGGG + Exonic
1200686559 Y:6264477-6264499 CTGAGGGACGGGAGGGGCCGGGG + Intergenic
1200992107 Y:9355726-9355748 CTGAGGGACGGGAGGGGCCGGGG + Intergenic
1200994759 Y:9376004-9376026 CTGAGGGACGGGAGGGACCGGGG + Intronic
1200997423 Y:9396350-9396372 CTGAGGGACGGGAGGGGCCGGGG + Intergenic
1200999935 Y:9464886-9464908 CTGAGGGACGGGAGGGACCGGGG + Intergenic
1201002596 Y:9485196-9485218 CTGAGGGACGGGAGGGGCCGGGG + Intronic
1201005251 Y:9505480-9505502 CTGAGGGACGGGAGGGACCGGGG + Intergenic
1201007912 Y:9525809-9525831 CTGAGGGACGGGAGGGACCGGGG + Intergenic
1201010529 Y:9546000-9546022 CTGAGGGACGGGAGGGGCCGGGG + Intergenic