ID: 934906227

View in Genome Browser
Species Human (GRCh38)
Location 2:98206722-98206744
Sequence CCTCACTCCCTAGCCAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934906227 Original CRISPR CCTCACTCCCTAGCCAAGAG TGG Intronic
900303504 1:1989952-1989974 CCTCACTCTCTTCCCATGAGAGG + Intronic
900908341 1:5576423-5576445 CCTCACTCCCCAGCCTAGCAGGG - Intergenic
902101715 1:13996121-13996143 CCTCAACCCCCAGCCAAGGGAGG + Intergenic
902799284 1:18819412-18819434 CCTCCCTCCCTGGCCACAAGCGG + Intergenic
904369451 1:30039262-30039284 CCACAGACCCTGGCCAAGAGAGG + Intergenic
904530655 1:31166663-31166685 CCTGACTCCCCACCCAGGAGAGG + Intergenic
905355615 1:37381955-37381977 CATCACTGCCTAGCCCAGGGAGG + Intergenic
905595832 1:39205758-39205780 CCTGATTCCCTAGGGAAGAGAGG - Intronic
913706066 1:121424110-121424132 CCTCACTTCCTAGTCACAAGGGG - Intergenic
916070769 1:161168348-161168370 CCTCATTCCCTACCAAATAGGGG + Intronic
917078985 1:171237282-171237304 CCCCTCTGCCTAGCCAAGGGGGG + Intergenic
917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG + Intronic
918156153 1:181849037-181849059 CCTCTCCCCCAAGCCAAGAGAGG + Intergenic
918478398 1:184951078-184951100 ACTCACTACATAGCCATGAGAGG - Intronic
918931174 1:190858786-190858808 CCTCACTCCAGAGCCCAGAATGG + Intergenic
920116846 1:203627579-203627601 TCTCATTCCCAAGCCAAGGGGGG - Intronic
921221394 1:212976540-212976562 CCTCACTCCTTCGCCCAGACTGG - Intronic
921736493 1:218633994-218634016 CCCCTCCCCCTAGCCAAGGGAGG - Intergenic
921945941 1:220886187-220886209 CCTCAGTCCCTTGGCCAGAGTGG + Intergenic
922305040 1:224336925-224336947 CCTCAGTCCCTGGTCAAGGGAGG + Intergenic
922527500 1:226316829-226316851 CCTCACTCTGTAGCCCAGACTGG - Intergenic
922947798 1:229531546-229531568 CCTCACTCCCTTGCAGACAGGGG + Intronic
924422461 1:243922424-243922446 CCTCACTCCATAACTATGAGGGG + Intergenic
1063879060 10:10512196-10512218 CCTCACTCTGAAGCCTAGAGTGG + Intergenic
1067103266 10:43348691-43348713 CCTCTGCCTCTAGCCAAGAGAGG - Intergenic
1068723592 10:60274940-60274962 CATCACTCCCTAGCTCAAAGAGG + Intronic
1069594729 10:69663221-69663243 CCCCACCCTCCAGCCAAGAGAGG - Intergenic
1071680552 10:87701449-87701471 TCTCACTCCATTGCCAAGACTGG + Intronic
1074073576 10:110098947-110098969 CCTCACTCCATCGCCCAGACTGG + Intronic
1075312682 10:121428049-121428071 CACCACTCCCTAGCAAAGGGAGG - Intergenic
1076630550 10:131849557-131849579 CCTCACTCCCACCTCAAGAGCGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078286055 11:9957323-9957345 CCTCACTCCTTACTCAAAAGGGG + Intronic
1084207684 11:67605451-67605473 CCTCTTTCCCTGACCAAGAGAGG + Intronic
1084688327 11:70710369-70710391 CCCCATTCCATAGCCGAGAGGGG - Intronic
1085942619 11:81222910-81222932 CCCCACCCCCCAGCCAAGGGAGG - Intergenic
1086968364 11:93053808-93053830 CCTCAGTCCCTAGGATAGAGAGG + Intergenic
1090117154 11:123985127-123985149 CCCCAACCCCTAGCCAAGGGAGG - Intergenic
1093383445 12:18521970-18521992 CCCCACCCCCCAGCCAAGGGAGG - Intronic
1094275252 12:28668337-28668359 CCTCACCCCCCAGCCAAGGGAGG + Intergenic
1094329255 12:29273868-29273890 CCCCTCTCCCCAGCCAAGGGAGG - Intronic
1095320471 12:40819889-40819911 CCCCTCCCCCGAGCCAAGAGAGG - Intronic
1096295688 12:50382001-50382023 CCCCACTCCCTACTCAAAAGGGG - Intronic
1101039358 12:100738188-100738210 CCTGCCTCCCTCCCCAAGAGGGG + Intronic
1101066453 12:101027141-101027163 CCCCACTCCCCAGCCAAGGGAGG + Intronic
1103370952 12:120419041-120419063 TCTCACTCCGTTGCCAAGGGTGG + Intergenic
1104461098 12:128956744-128956766 CCTGATTCCCTAGTCATGAGAGG - Intronic
1104809566 12:131612148-131612170 CCTCAGGCCCCAGGCAAGAGAGG - Intergenic
1106180035 13:27362454-27362476 CCTCGCTCCCGCGCCCAGAGCGG + Intergenic
1109228529 13:59726634-59726656 CCTCAATGCCTGGCCAAGAGGGG + Intronic
1109600219 13:64616263-64616285 CCTCACTCTGTTGCCCAGAGTGG - Intergenic
1110567232 13:76968504-76968526 CCCCACACCCCAGCCAAGGGAGG - Intergenic
1111348294 13:86993841-86993863 CCCCCATCCCTAGCCAAGAGAGG + Intergenic
1111519585 13:89383199-89383221 CTGCACTCTCTAGCCAAGTGTGG - Intergenic
1112354158 13:98660475-98660497 TCTCTCTTCCTAGGCAAGAGAGG + Intergenic
1113266290 13:108621667-108621689 CCTAACACCGCAGCCAAGAGAGG - Intronic
1114596185 14:23914120-23914142 CCTCTCTCCCTGGCCTGGAGTGG + Intergenic
1115993191 14:39170455-39170477 CCTCTCTCCCAAGCCCGGAGAGG + Intronic
1117707596 14:58487574-58487596 TCTCACTCCCTTGCCCAGGGTGG - Intronic
1118317277 14:64732936-64732958 CCTCACACCCTTGCCCAGACTGG + Intronic
1120121148 14:80681176-80681198 CCACACTCCCTAGCGAGGAAGGG + Intronic
1120251491 14:82065209-82065231 CCTCAGTCCCAACCCAAGCGTGG - Intergenic
1121438453 14:93933985-93934007 CTTCACTCCCCAGGCAAGACCGG - Intergenic
1121638600 14:95470433-95470455 CCTCACTGTCTTGCCCAGAGTGG - Intronic
1122741330 14:103873050-103873072 TCTCACTCTGTAGCCAAGACTGG + Intergenic
1122862366 14:104588366-104588388 CCTCACTCCCTCCCCGAGGGAGG + Intronic
1124037186 15:26065141-26065163 CCTCACTCCATTGCCCAGACTGG - Intergenic
1124551042 15:30681753-30681775 CCCCACACCCTCGCCAAGACTGG - Intronic
1124680212 15:31723915-31723937 CCCCACACCCTCGCCAAGACTGG + Intronic
1125511316 15:40293949-40293971 CCTCCCTCCCTAGCCAAAGAGGG + Intronic
1128228423 15:66018504-66018526 CCCCACTCCCTGCCCTAGAGTGG - Intronic
1129606482 15:77027735-77027757 CCTCTCTCCAGAGCCAGGAGAGG + Intronic
1130375615 15:83326276-83326298 CCTCACTCACTCACCATGAGTGG + Intergenic
1131446802 15:92504975-92504997 CCTCATACCCTAGCCAACACTGG - Intergenic
1133390266 16:5404373-5404395 CCTCCCTCCCTAGCCTTCAGGGG - Intergenic
1137491827 16:48939325-48939347 CCTCATTCCATAGCCACCAGAGG + Intergenic
1137691400 16:50430501-50430523 CCTCACTCCTCAACCAGGAGGGG - Intergenic
1139108335 16:63856511-63856533 CCGGGCTCCATAGCCAAGAGAGG - Intergenic
1141231497 16:82171204-82171226 CCTCACTCTGTAGCCCAGACTGG - Intergenic
1142911492 17:3097456-3097478 CCCCACCCCCAAGCCAAGGGAGG + Intergenic
1142976913 17:3650625-3650647 CCTCACACCCTGGGCAAGAGGGG - Intronic
1143438542 17:6949609-6949631 TCTCACTCCCTTGCCCAGATAGG - Intronic
1145068670 17:19783745-19783767 CTTCACCCCCCAGCCTAGAGGGG - Exonic
1146922980 17:36726187-36726209 CCGCACTCCCCAGCCTTGAGAGG + Intergenic
1147170861 17:38617934-38617956 CCTCTCTCCCCAGTCAGGAGAGG - Intergenic
1149008254 17:51828168-51828190 CCTAACTCCCTAGTCACAAGAGG - Intronic
1150618298 17:66789241-66789263 CCTCACTCCCTAGTCGTGCGGGG - Intronic
1151304164 17:73252317-73252339 CCTCACGCCCTGGCTAAGGGAGG - Intronic
1151979516 17:77500212-77500234 ACTCCCTCCCCACCCAAGAGAGG + Exonic
1152038380 17:77887489-77887511 CCGCCCTCCCCCGCCAAGAGTGG - Intergenic
1152855615 17:82663465-82663487 CCCCCATCCCAAGCCAAGAGCGG + Intronic
1157709996 18:49843713-49843735 CCTCAGTCCGCAGCCAACAGGGG + Intronic
1159022576 18:63155596-63155618 CTTCCCTCCCAAGCCAACAGGGG - Intronic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1160803202 19:979880-979902 CCTCCCTCCCCAGCCAAGGAGGG + Intergenic
1160803227 19:979935-979957 CCTCCCTCCCCAGCCAAGGAGGG + Intergenic
1160803252 19:979990-980012 CCTCCCTCCCCAGCCAAGGAGGG + Intergenic
1161182743 19:2895753-2895775 TCTCACTCCCTAGCCCAGGCTGG - Intergenic
1161415527 19:4144693-4144715 CCCCACTCCCCACCCACGAGAGG - Intergenic
1161631046 19:5355659-5355681 CCTCACTCCCTGTACAGGAGAGG + Intergenic
1162050687 19:8030750-8030772 TCTCACTCTATAGCCAAGGGTGG - Intronic
1162576780 19:11504073-11504095 TCTCACTCTCTCGCCCAGAGTGG - Intronic
1162624605 19:11874589-11874611 CCTCACACACTACCTAAGAGTGG + Intronic
1163872027 19:19830159-19830181 CCCCACCCCCCAGCCAAGGGAGG + Intergenic
1164087872 19:21920320-21920342 GCTCACTCCCTATCCAAAGGTGG + Intergenic
1164163949 19:22651131-22651153 CCCCACCCCCCAGCCAAGGGAGG - Intronic
1164557031 19:29261189-29261211 CCTCACTGCTTAGCAAAGAGTGG + Intergenic
1165228233 19:34369076-34369098 TCTCACTCTCTCGCCCAGAGTGG + Intronic
1165487870 19:36106210-36106232 CACCACACCCCAGCCAAGAGTGG - Intergenic
1166581440 19:43903574-43903596 CCTAACTCTCCAGGCAAGAGTGG - Intergenic
1166838738 19:45683357-45683379 CCTCACTCCGCAGCCAGCAGTGG - Exonic
1168347755 19:55659192-55659214 CCTCTCACCCTTGCCCAGAGCGG + Exonic
925288171 2:2729446-2729468 CCTCCCTCCCTAGCTGGGAGGGG - Intergenic
927498457 2:23565886-23565908 GCGCACTGCCTAGCCAAGAGGGG - Intronic
930152917 2:48076798-48076820 GCTCAGTCACTGGCCAAGAGTGG + Intergenic
931688046 2:64811497-64811519 TCTCACTCTGTCGCCAAGAGTGG - Intergenic
931899285 2:66769952-66769974 CCTCCCCCCATTGCCAAGAGGGG + Intergenic
933129404 2:78654744-78654766 CCCCATCCCCCAGCCAAGAGAGG + Intergenic
933883454 2:86695370-86695392 CGTCCCACCCTAGCCAATAGGGG + Intronic
934906227 2:98206722-98206744 CCTCACTCCCTAGCCAAGAGTGG + Intronic
936964681 2:118116210-118116232 CCTCACTCGCTTGCCAAGGCAGG + Intergenic
937234775 2:120424119-120424141 CCACACACCCTGGCCAAGAAGGG + Intergenic
938233504 2:129681574-129681596 CCAAACTCCCTGACCAAGAGAGG + Intergenic
942376184 2:175340015-175340037 CCCCACCCCCTAGCCAAGGGAGG - Intergenic
942547025 2:177075869-177075891 CCTCACTTCCTGGCCATGTGCGG - Intergenic
944885758 2:204061123-204061145 CCTCAGTCACTATGCAAGAGAGG - Intergenic
945062440 2:205921012-205921034 CCTAACTCACTACCCACGAGTGG + Intergenic
945936909 2:215911821-215911843 CCTCACACCCCAGGCAAGAAGGG + Intergenic
947535409 2:230937373-230937395 CCTCACTCTCTTGCCCAGACTGG - Intronic
947791127 2:232870090-232870112 CCTCTTTCCCTCTCCAAGAGCGG + Intronic
1168933611 20:1644778-1644800 CCCCACCCCCCAGCCAAGGGAGG - Intronic
1169266313 20:4169403-4169425 CATCACTCCCTCTCCAAGAGTGG - Intronic
1169695858 20:8385738-8385760 CCTCACCCCCCAGCCAAGGGAGG - Intronic
1171295796 20:24015833-24015855 GCCCACTCCCTATACAAGAGTGG + Intergenic
1171986607 20:31665416-31665438 CCTGAATCCCTAGTCAAAAGTGG + Exonic
1173163641 20:40671013-40671035 CCTCACTCCCCAGCCACATGGGG + Intergenic
1176178551 20:63739573-63739595 CCTCCCTCCCTAGGCCAGCGCGG + Intronic
1178883244 21:36465022-36465044 CCTCAGTCCCTAGCAAAGCAGGG - Intronic
1179120743 21:38543553-38543575 CCTCACTTCCCAGCCCATAGTGG - Intronic
1180126971 21:45799555-45799577 CCTCCCCCCTTATCCAAGAGGGG - Intronic
1180581991 22:16846265-16846287 CCTCAGTGCCTAGACATGAGCGG - Intergenic
1180695383 22:17748667-17748689 CCTCACTCCGAAGGCAAGAAAGG + Intronic
1180699303 22:17773125-17773147 CTTCCCTCCCTGGGCAAGAGGGG + Intronic
1181884002 22:26004581-26004603 CCTCACTCGCCATCCCAGAGAGG - Intronic
1182663846 22:31943761-31943783 CCTCACTACCCAGCCCACAGTGG - Intronic
1183230763 22:36580499-36580521 CCACACTCCATAGCCAGAAGTGG - Intronic
1184043151 22:41956477-41956499 CTGCACGCCCTAGCCAAGTGTGG - Intergenic
1184550453 22:45201636-45201658 CCTCATTCCAAAGACAAGAGAGG + Intronic
951886591 3:27530807-27530829 CCTCACTCTGTTGCCAAGATTGG - Intergenic
952289844 3:32004413-32004435 CCTGACTCCCTTGCCCAGATGGG + Intronic
954904950 3:54053415-54053437 TCTCACTCCTTTTCCAAGAGAGG + Intergenic
957630161 3:82707610-82707632 CCCCACTCCTCAGCCAAGGGAGG - Intergenic
958503822 3:94947072-94947094 CCCCTCTCCCTAGCTAAGGGAGG - Intergenic
960016999 3:112902588-112902610 CCTCACCCCCGAGCCAAGGGAGG - Intergenic
961831944 3:129627408-129627430 CCTCAGTGCCTGGCCCAGAGCGG - Intergenic
966357403 3:179095609-179095631 CCTCACTCCCTGTCTAGGAGAGG - Intergenic
967192784 3:186999439-186999461 TCTCACTCCGTAGCCCAGACTGG + Intronic
968435791 4:588290-588312 CCTCGCCACCTAGCTAAGAGGGG - Intergenic
969228014 4:5811741-5811763 CCTCATACCACAGCCAAGAGGGG + Exonic
969228088 4:5812086-5812108 CCTCACACCACAGCCAGGAGAGG + Exonic
969228103 4:5812144-5812166 CCTCATACCACAGCCAAGAGGGG + Exonic
969228131 4:5812260-5812282 CCTCACACCACAGCCAGGAGAGG + Exonic
969228159 4:5812375-5812397 CCTCACACCACAGCCAGGAGAGG + Exonic
970110737 4:12635329-12635351 CCTGTCTCCCTACCCAAGAAGGG - Intergenic
970952825 4:21776162-21776184 CCCCTCTCCCCAGCCAAGGGAGG - Intronic
973232002 4:47850792-47850814 TCTCACTCCCCAGCCAAAGGAGG + Intronic
974155936 4:58072623-58072645 CCCCACTCTCATGCCAAGAGAGG + Intergenic
976144271 4:82026011-82026033 TCTCACTACCTTGCCCAGAGTGG + Intronic
977343407 4:95788925-95788947 CCTCACTCACTCACCCAGAGTGG - Intergenic
978354062 4:107851654-107851676 CCTCTCTCCCTAAGCAAGAAGGG + Intronic
979507683 4:121516202-121516224 ACTCATACACTAGCCAAGAGAGG - Intergenic
980864761 4:138542125-138542147 CCCCACCCCTTAGCCAAGGGAGG + Intergenic
981535465 4:145795175-145795197 TCTCACTCCCTCGCCCAGGGTGG + Intronic
983873858 4:172853277-172853299 CCACACTTCCTTGCCATGAGGGG + Intronic
985085521 4:186308822-186308844 CCTCCTTCCCTTGCCAGGAGTGG - Intergenic
987766376 5:22236714-22236736 TCTCACTCCATAGCCCAGAGTGG - Intronic
988186503 5:27870988-27871010 CCTCCACCCCCAGCCAAGAGAGG + Intergenic
988701266 5:33677518-33677540 CCTAACCCCCGACCCAAGAGGGG + Intronic
988928668 5:36014393-36014415 CCTCCCTCCCTCGACAAGTGGGG - Intergenic
995594298 5:113731427-113731449 CCCCAATCCCCAGCCAAGTGAGG - Intergenic
996144271 5:119954311-119954333 CCTAACTACCTTGCCAAGGGTGG + Intergenic
996415587 5:123206855-123206877 GCCCACTCCCTAGCAAGGAGGGG - Intergenic
996482334 5:123988904-123988926 CCCCAACCCCCAGCCAAGAGAGG - Intergenic
996527325 5:124492593-124492615 CCCCACTCCCCAGTCAAGGGAGG - Intergenic
996660342 5:125995448-125995470 CCTCCCTCCCTCGACAAGTGGGG - Intergenic
996965998 5:129307234-129307256 CCCCAACCCCTAGCCAAGGGAGG - Intergenic
998788730 5:145743599-145743621 CCCCACCCCCCAGCCAAGGGAGG + Intronic
999300177 5:150486066-150486088 CCTCGCCCCCTAGCCCAGAGGGG - Intronic
999624458 5:153505684-153505706 CCTCAGTGCCTAGCAAAGTGTGG - Intronic
1004690507 6:17988278-17988300 CATCCCTCCCGAGACAAGAGAGG - Intergenic
1005170530 6:22980230-22980252 CCCCACCCCCTAGCCAAGAGAGG + Intergenic
1005832574 6:29682272-29682294 CCTCACTCCATTGCCAAGGCTGG - Intergenic
1007617944 6:43193116-43193138 CCACCCTCCCTGGCAAAGAGCGG - Exonic
1007665447 6:43510484-43510506 CCCCACTCCCAAGGGAAGAGCGG - Exonic
1012903930 6:105042098-105042120 CCTGACTCCCCAGCACAGAGTGG - Intronic
1015136938 6:129882886-129882908 CCCCACACCCCAGCCAAGGGAGG - Intergenic
1017809982 6:157977560-157977582 GCTCACTCCCCAGCACAGAGAGG - Intergenic
1018092446 6:160356609-160356631 CCCCACTCCATAGCCATGAAGGG - Intronic
1018372636 6:163182013-163182035 CCTTACACCCTACCTAAGAGAGG - Intronic
1019345233 7:526518-526540 CCTCACTCCCTAGCCCCGCTCGG - Intergenic
1022634547 7:32119698-32119720 CCCCACCCCCTAGCCAAGGCCGG + Intronic
1027258214 7:76444803-76444825 CCTCAGTGCCTAGTAAAGAGTGG + Intergenic
1029041376 7:97580015-97580037 CCCCACACCCCAGCCAAGGGAGG + Intergenic
1029515168 7:101019200-101019222 GCTCACTCCCTGGCCAACTGGGG - Intergenic
1030944038 7:115694063-115694085 ACTCACTCACTATCCAAGAACGG + Intergenic
1036496823 8:9277415-9277437 ACTCACTCGCTGGCCAAGTGTGG - Intergenic
1038258476 8:25972279-25972301 CCTCAATCCCTAGTCATGGGTGG - Intronic
1040951320 8:52940926-52940948 CCTCCCTCGCTGGCCAGGAGTGG - Exonic
1041742984 8:61176742-61176764 CCTCACCCCTCAGCCAAGGGAGG + Intronic
1043425344 8:80142670-80142692 CCTCACTCCGTTGCCCAGGGTGG - Intronic
1046338976 8:112826550-112826572 CCCCATTCCATAGCCAAGGGAGG - Intronic
1048541668 8:135347681-135347703 CCTCACTCCTTAGAAAAGGGTGG - Intergenic
1049234564 8:141506051-141506073 CCTCACTCCCACTCCCAGAGTGG - Intergenic
1050630012 9:7549174-7549196 CCCCACTCCCCAGCCAAGGGAGG + Intergenic
1050660656 9:7879801-7879823 CCCCACCCCCCAGCCAAGGGAGG + Intronic
1054813262 9:69451527-69451549 CCTCATTCCCTAGACAAATGTGG + Intronic
1055939376 9:81635061-81635083 ACTCTATCCCTAGGCAAGAGGGG + Intronic
1057803684 9:98205685-98205707 CCTAACAACCTAGCCAAGTGTGG - Intronic
1058510246 9:105710624-105710646 CCACACTCACCATCCAAGAGAGG - Intronic
1058590955 9:106565135-106565157 CCCTACTCCCTAGCCAAGGGAGG + Intergenic
1059170163 9:112117207-112117229 CCTCATCCCCTAGCCAAGAAGGG + Intronic
1061376079 9:130225648-130225670 CCTCACGGCCAAGCCAAGAAGGG - Intronic
1062614355 9:137389277-137389299 CCTCACTCCCCAGACACGGGCGG - Intronic
1062688488 9:137828441-137828463 CCTCACTGCCCAGACCAGAGGGG - Intronic
1186096711 X:6110319-6110341 CCTCACTCCTTATCCACAAGAGG + Intronic
1186185811 X:7018710-7018732 CCTCCCTCCCTTTCCAAGAAGGG + Intergenic
1188037816 X:25338268-25338290 CCCCTCTCCCCAGCCAAGGGAGG - Intergenic
1189186853 X:39062235-39062257 CCTCACTCCCAGCCCAAGACTGG + Intergenic
1189252088 X:39608935-39608957 CCTCACTCCCCAGCAAACACAGG - Intergenic
1191792074 X:64981687-64981709 CCTAACTCCCTAACCTAGGGAGG - Intronic
1192951858 X:76026052-76026074 CCCCACACCCAAGCCAAGAGTGG + Intergenic
1193091005 X:77494091-77494113 CCCCACCCCCCAGCCAAGGGAGG + Intergenic
1193216803 X:78874419-78874441 TCTCTCTCCCCAGCCAAGGGAGG + Intergenic
1193318474 X:80092631-80092653 CCACACTGCTTAGCCAAGAGTGG + Intergenic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1193606132 X:83569296-83569318 CCCCATCCCCTAGCCAAGGGAGG - Intergenic
1194286704 X:92019978-92020000 CCCCAATCCCAAGCCAAGGGAGG + Intronic
1194851881 X:98880745-98880767 CCCCACCCCCCAGCCAAGGGAGG + Intergenic
1200604250 Y:5244538-5244560 CCCCAGTCCCAAGCCAAGGGAGG + Intronic
1200936396 Y:8742126-8742148 TCTCACTCCCTTTCCAAAAGAGG + Intergenic
1201502440 Y:14659807-14659829 CCTCACTCCCTATGCACAAGAGG - Intronic
1201738987 Y:17303635-17303657 CCTCACCCCTCAGCCAAGGGAGG + Intergenic