ID: 934909917

View in Genome Browser
Species Human (GRCh38)
Location 2:98242286-98242308
Sequence TGCTCAATACCTCATTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934909917_934909921 20 Left 934909917 2:98242286-98242308 CCTTGGAAATGAGGTATTGAGCA 0: 1
1: 0
2: 0
3: 6
4: 180
Right 934909921 2:98242329-98242351 CTTCATTACAAGATGCAAAATGG 0: 1
1: 0
2: 1
3: 22
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934909917 Original CRISPR TGCTCAATACCTCATTTCCA AGG (reversed) Intronic
902335716 1:15753524-15753546 TGCTCATGGCCTCACTTCCATGG - Intergenic
905831154 1:41069098-41069120 TGCTCAACATTTCATTTTCAGGG - Intronic
906001670 1:42431699-42431721 TGGACAAAACCTCATTTCTACGG - Intronic
907637482 1:56150735-56150757 TACTCACTCCTTCATTTCCAAGG + Intergenic
908032362 1:60015132-60015154 TGCTGAAATCCTCACTTCCATGG + Intronic
914245647 1:145884063-145884085 TGGGCAGTACCTCCTTTCCAAGG - Intronic
917270268 1:173264973-173264995 GGCAAAATACCTCATTTCTATGG + Intergenic
917465388 1:175271504-175271526 GGGCCAATACCTCATTTGCATGG - Intergenic
919988951 1:202695626-202695648 TGGTCAAAAATTCATTTCCAAGG + Intronic
920149100 1:203889700-203889722 TACAGAATACCTCATTTCCGTGG - Intergenic
921840868 1:219827056-219827078 TGCTCACTACCTCTTTACTATGG - Intronic
923548459 1:234942169-234942191 TGCTAAAAACCACATTTCCCAGG + Intergenic
923704250 1:236331183-236331205 TGTGCAATACCTCAAATCCAGGG - Intergenic
924001636 1:239559849-239559871 TGCACAATTGATCATTTCCAAGG + Intronic
1063346646 10:5318206-5318228 TGCTTAAAACCTGAGTTCCAGGG + Intergenic
1064638171 10:17389546-17389568 TGCTCCATGCCTCATCTACATGG - Intronic
1065802598 10:29366294-29366316 TGCTAAGTCCCTCATTTCCCGGG - Intergenic
1068557334 10:58473758-58473780 AGCTAATTACCTCATTTCAATGG + Intergenic
1070808015 10:79282106-79282128 GGATAAATCCCTCATTTCCAGGG + Intronic
1072480679 10:95808090-95808112 CCCTCAATACCTAATTTACAGGG + Intronic
1072735257 10:97874781-97874803 TGCTCAATGCCTCTTTCTCAGGG + Intronic
1072776063 10:98195301-98195323 TGAACAATTCCTCATTTCCTTGG - Intronic
1074194050 10:111164675-111164697 TTCTCATTACCTCATATCAAGGG + Intergenic
1074478942 10:113800832-113800854 TGCTCAAGATCACATTTTCATGG - Intergenic
1076443849 10:130498493-130498515 TGCTCAATGCCTTGTTTCCGTGG + Intergenic
1079375433 11:19887783-19887805 TACTAAATCTCTCATTTCCATGG - Intronic
1079537266 11:21529184-21529206 TTTTCAATACGTGATTTCCAAGG + Intronic
1079625594 11:22612985-22613007 TGCTCAAGAAGTCTTTTCCAAGG + Intergenic
1080534422 11:33207713-33207735 TCCTCCCTGCCTCATTTCCATGG + Intergenic
1085433051 11:76473044-76473066 TGCACAATACCTAATTACCTGGG + Intronic
1087669528 11:101089070-101089092 TGCTCAGTACCTCAGTACCTAGG + Intronic
1088454935 11:110023845-110023867 TGCTCAATATTTGAATTCCAAGG + Intergenic
1090097356 11:123755908-123755930 AGCTCAATATAACATTTCCAAGG + Intergenic
1090883299 11:130853613-130853635 TGATAAATACCTCAATTACAAGG - Intergenic
1091351660 11:134902725-134902747 AGCACAATAACACATTTCCATGG - Intergenic
1091478918 12:806648-806670 TTCCCCATATCTCATTTCCATGG - Intronic
1092366550 12:7881398-7881420 TGCTAAATCCCTCATTGCCCGGG - Intronic
1092954385 12:13536416-13536438 ACCTCAGTACCTCATTACCATGG - Intergenic
1095479882 12:42623921-42623943 TGCCCCATCCCTCACTTCCAGGG + Intergenic
1098347599 12:69522876-69522898 TGCTCAAAACCTTAGTTACATGG - Intronic
1100254914 12:92873357-92873379 TTCTCATTACTTCATTTCCTTGG - Intronic
1102800657 12:115730418-115730440 TCCCCAAAACATCATTTCCAGGG + Intergenic
1106290007 13:28352111-28352133 TGCTCTATACCTCAACTCTAAGG - Intronic
1106328395 13:28716684-28716706 TACTCATTTCCTCATTCCCATGG - Intronic
1106652570 13:31707553-31707575 TGCTCAATAACTCATATTCATGG - Intergenic
1109415688 13:62036564-62036586 TGCCCAATGCCTCATTTTCTAGG - Intergenic
1110136551 13:72074356-72074378 ATCTCATTACCTCATTTACATGG - Intergenic
1110486518 13:76051175-76051197 TGCTCAATTCTTCATTTCCCAGG + Intergenic
1111722745 13:91967622-91967644 TTTTAAATACATCATTTCCATGG + Intronic
1113239421 13:108319882-108319904 TGCTAAACACCTCATTTAAAAGG - Intergenic
1114359231 14:21951972-21951994 TACTGAATCCCTTATTTCCATGG + Intergenic
1117561874 14:56948831-56948853 TTATTAATACCTCATTTACAGGG - Intergenic
1117877927 14:60275239-60275261 TTTTCATTACCTCATTTGCAAGG + Intronic
1118635523 14:67745516-67745538 TGCTCATTATCTCCTTTCCCCGG - Intronic
1120330977 14:83092500-83092522 TGCTAAATCCCTCATTGCCCGGG - Intergenic
1123117713 14:105902163-105902185 GGCTCACAGCCTCATTTCCAGGG + Intergenic
1125523362 15:40360238-40360260 TTCTCACTCCCTCAGTTCCATGG - Intronic
1126316109 15:47371621-47371643 TGCTCAGTACCACATATGCAGGG - Intronic
1127007985 15:54592420-54592442 TGCTGTCTACCTCATTTCCTAGG + Intronic
1131605646 15:93900383-93900405 TCCGCAATACCTCATCTCCCTGG - Intergenic
1131972234 15:97904257-97904279 TGCTCAGTGCCTCATCTCCTGGG - Intergenic
1135684307 16:24486025-24486047 TGCTCACTTCCTCCTTTCCCAGG + Intergenic
1138163552 16:54778453-54778475 TGATGAATATCTCATTTCCCAGG + Intergenic
1138341441 16:56291954-56291976 TGCTCAAAACCTAATCCCCAAGG - Intronic
1149233788 17:54567547-54567569 TGCTAAATACTTCACTCCCATGG - Intergenic
1150691519 17:67371179-67371201 TGCCCTAAACCTCATTTCCTAGG - Intergenic
1158825782 18:61217372-61217394 AGCTCATTACCTCATCTCCCTGG + Intergenic
1159251743 18:65888046-65888068 TGCTTCATGTCTCATTTCCAAGG - Exonic
1162834564 19:13307912-13307934 GGCTCAGTATCTCATCTCCAAGG + Intronic
1166016487 19:39984037-39984059 TTCTGAATCCCTCATTTGCAGGG - Intergenic
925248388 2:2406315-2406337 TCCTGAATACTTCCTTTCCAGGG - Intergenic
929220081 2:39454768-39454790 TGATCAATACAACAATTCCATGG - Intergenic
933516314 2:83307955-83307977 TGTGAAATACCTTATTTCCAAGG + Intergenic
934909917 2:98242286-98242308 TGCTCAATACCTCATTTCCAAGG - Intronic
940133916 2:150414553-150414575 ACCTCAAGACCTGATTTCCAGGG - Intergenic
940338160 2:152550388-152550410 TGTTCTATAGCCCATTTCCAGGG - Intronic
940836869 2:158531814-158531836 TTCTCAATCTCTCATTTTCATGG - Intronic
940895361 2:159076740-159076762 TGCTCAATGCCTCTTTTTCCAGG - Intronic
941941472 2:171043058-171043080 TGCTCCATTCTTCATTTTCACGG - Intronic
943878274 2:193102314-193102336 TGTTCCATAACTTATTTCCATGG + Intergenic
944381653 2:199117430-199117452 TGGTTCATACCTCCTTTCCAAGG - Intergenic
944586991 2:201181186-201181208 TACTCACTACCCCAGTTCCAGGG - Intergenic
946787235 2:223260419-223260441 TGCTGAATTCCTCATTTCAGTGG + Intergenic
947165357 2:227256058-227256080 AACTCTATACCTCACTTCCAGGG - Exonic
1168894938 20:1317905-1317927 GGCTCAATTCCTGCTTTCCATGG - Intronic
1169838686 20:9909801-9909823 TCCTCAATTCCTCAATTCCTTGG + Intergenic
1170738621 20:19033022-19033044 TGCTCAATGCATCCTTTACAGGG + Intergenic
1170777206 20:19386586-19386608 TGCTCTATACCTAATTTTCTGGG + Intronic
1171102583 20:22399447-22399469 GCCTAGATACCTCATTTCCAAGG - Intergenic
1173104663 20:40122578-40122600 TGCTCATTACCTGTTTTTCAGGG + Intergenic
1173892646 20:46525117-46525139 TTCTCAATACATCATATCAAGGG - Intergenic
1175615483 20:60394582-60394604 ACCTCAATACCTCTTTGCCATGG + Intergenic
1176658061 21:9605858-9605880 TTCTCATTGCATCATTTCCAGGG - Intergenic
1177195306 21:17898428-17898450 TGCTTTATATCTCATTTCCTAGG + Intergenic
1178262875 21:31116275-31116297 TGCTCAACACCTCCCTTCTAAGG + Intergenic
1178547809 21:33507915-33507937 TGATGAATACCCCATTTACAGGG + Intronic
1184169928 22:42752691-42752713 TCCCCAATACCTCTTTCCCATGG - Intergenic
951022843 3:17799310-17799332 TGCTCACTTCCCCATATCCATGG + Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
958123096 3:89318950-89318972 TGCTCAAATCCACATTTCCTTGG + Intronic
959900468 3:111655272-111655294 TCCTGAATACCTCTTTTCGATGG + Intronic
961172977 3:124812101-124812123 TGCTCACTATTTTATTTCCAAGG + Intronic
962752123 3:138441238-138441260 TGCTCACTGCTTCATTTACAAGG + Intronic
962775314 3:138653640-138653662 CCCTGAATTCCTCATTTCCAGGG - Exonic
963834876 3:150048150-150048172 TGCTCCTTACCTCCTTCCCAGGG - Intronic
964403448 3:156323651-156323673 TGCACAATAAGTCATTACCATGG - Intronic
967257073 3:187604211-187604233 TTCTCAATAGCTCATAACCAGGG + Intergenic
968651468 4:1761836-1761858 TGCTCATTCCCTCATGTTCAGGG + Intergenic
969267495 4:6074087-6074109 TGCTGATTATCTCATTTCCCAGG - Intronic
972684117 4:41335271-41335293 GGCTCCATCCCTCTTTTCCAGGG + Intergenic
975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG + Intronic
976214548 4:82703994-82704016 TGCTTAATAGCTTATTTCCTAGG + Intronic
981436841 4:144733788-144733810 TGCTCATTACCTAATCTTCAGGG - Intronic
983431961 4:167661654-167661676 TTTTTAATACCTAATTTCCATGG - Intergenic
985083465 4:186289979-186290001 TGCTCAATAAATATTTTCCATGG - Intergenic
985132518 4:186753178-186753200 TGATCCCTACCTGATTTCCAAGG + Intergenic
986042411 5:4006207-4006229 TGCTCACGATCCCATTTCCAGGG + Intergenic
986115301 5:4768073-4768095 TGGTCACAACCACATTTCCAAGG + Intergenic
986616101 5:9618946-9618968 TACTCAATCCCTCCTTTCCTAGG + Intergenic
987168284 5:15224137-15224159 TCCTCAGTTCCTCATTTCCAAGG + Intergenic
987743328 5:21937873-21937895 TGCCCAAGACCTCCTTTTCATGG + Intronic
988062985 5:26197751-26197773 TGGCCAATACCCCATTTTCAAGG - Intergenic
988331505 5:29847240-29847262 TTCTCAAAACATCATTTCAAAGG - Intergenic
991749583 5:69786634-69786656 TGCCCAAGACCTCCTTTTCATGG - Intergenic
991763527 5:69948006-69948028 TGCCCAAGACCTCCTTTTCATGG + Intergenic
991783799 5:70170123-70170145 TGCCCAAGACCTCCTTTTCATGG - Intergenic
991801162 5:70366448-70366470 TGCCCAAGACCTCCTTTTCATGG - Intergenic
991827437 5:70643594-70643616 TGCCCAAGACCTCCTTTTCATGG + Intergenic
991842756 5:70823066-70823088 TGCCCAAGACCTCCTTTTCATGG + Intergenic
991876245 5:71170498-71170520 TGCCCAAGACCTCCTTTTCATGG - Intergenic
994995472 5:107057096-107057118 TGCTTAAAACCTCATTTTGAAGG - Intergenic
996627556 5:125587907-125587929 TGCTCAATACTTCATTAATAAGG + Intergenic
997323275 5:132997171-132997193 TTCTCAAAACATCATTTCAAAGG - Exonic
998303484 5:141050091-141050113 TGCTCAATACTTTATGTCCCAGG - Intergenic
999027995 5:148257772-148257794 TGCTAAATACTTCATTTAAAAGG - Intergenic
1000401377 5:160831712-160831734 TGCTGAATACCTCCTTACCAGGG + Intronic
1001309659 5:170601894-170601916 TGCTCCATTCCCCATTGCCAGGG - Intronic
1001804576 5:174572296-174572318 TTCTCTATACCTCTTTACCATGG - Intergenic
1003167560 6:3694359-3694381 TGCTCAGTCCATCATATCCAAGG - Intergenic
1003463586 6:6355183-6355205 TGTGCACCACCTCATTTCCACGG - Intergenic
1003920800 6:10831061-10831083 TGGTAAATGCCTCATTTACATGG + Intronic
1004294297 6:14395992-14396014 TGCTACATTTCTCATTTCCAAGG - Intergenic
1004528597 6:16432363-16432385 TGTTCCATAGCTCATTTGCATGG + Intronic
1004914339 6:20318530-20318552 TGCACCATACCTCAGTGCCAGGG - Intergenic
1005027993 6:21482432-21482454 TTCTCCATCCCCCATTTCCAAGG - Intergenic
1006033632 6:31195578-31195600 TGCTAAGTCCCTCATTGCCAGGG - Intergenic
1007336815 6:41160386-41160408 TACTCCTGACCTCATTTCCATGG + Intronic
1008860572 6:56144455-56144477 TGATCAATAGCCAATTTCCATGG - Intronic
1008887481 6:56446760-56446782 TCCTCAATACCACATCTCCATGG + Intergenic
1011157421 6:84348558-84348580 TGTTTATTTCCTCATTTCCAAGG - Intergenic
1012552986 6:100481329-100481351 TGATCATTTCCTCATTACCAAGG - Intergenic
1014294604 6:119603443-119603465 TGCTCCCTAACTCCTTTCCAGGG - Intergenic
1015488428 6:133798450-133798472 GGCTAAATACCTCATTTAAAAGG - Intergenic
1016043915 6:139461761-139461783 TGCTCAGGACCACATTTCTAAGG - Intergenic
1018653689 6:166011874-166011896 TGCTGAATGCCTCGTCTCCATGG - Intergenic
1022619891 7:31972288-31972310 TGTTCAATATCTCATTCCAAAGG + Intronic
1023459544 7:40380079-40380101 TGGAAAATACCTCATTTTCAAGG - Intronic
1027743002 7:82036485-82036507 TCTTCAAAACCTCATTTTCACGG + Intronic
1030113550 7:106046585-106046607 TGCCCAAGACCTCCTATCCAGGG - Intergenic
1030467126 7:109916580-109916602 TGGGTAATGCCTCATTTCCAAGG + Intergenic
1033720666 7:144056174-144056196 TCCTCCATACCTTATTTTCAAGG - Intergenic
1038114690 8:24540284-24540306 TGCTCAACGTTTCATTTCCATGG - Intergenic
1038150220 8:24936593-24936615 AGCCCAATACATCATCTCCAAGG - Intergenic
1038536995 8:28360609-28360631 TGCTCAAAACCTCAGTTTGAAGG - Intronic
1045873213 8:106949263-106949285 TGCTAATGACCTCATTTGCATGG + Intergenic
1047950567 8:129930784-129930806 TGCTTCATCCCTCATTTTCAGGG + Intronic
1048033008 8:130650791-130650813 TGCCCAATATTTCATTTCTAGGG - Intergenic
1049307035 8:141909458-141909480 GGCTCAACAGCTCATTCCCACGG - Intergenic
1050409362 9:5346759-5346781 TGCCCAATAAATCATTGCCAAGG - Intergenic
1053025946 9:34728401-34728423 TTCTTAATTCTTCATTTCCAGGG + Intronic
1056911328 9:90703553-90703575 TGCTCAATACCTCAATACAGTGG + Intergenic
1059125557 9:111681270-111681292 TTCTCAATACATCATATCAAAGG - Intergenic
1062694959 9:137869382-137869404 TGCTCTCTAACTCATTTACAAGG + Intronic
1203635789 Un_KI270750v1:109433-109455 TTCTCATTGCATCATTTCCAGGG - Intergenic
1189767311 X:44384885-44384907 AGCTAAACACCGCATTTCCATGG + Intergenic
1191100484 X:56721410-56721432 TGCTCTCTACCTCATTTCTTAGG - Intergenic
1192015721 X:67327954-67327976 TGCTAACTACCTCATTTCTTAGG - Intergenic
1193084837 X:77439663-77439685 TGCTGAATCCCTCATTTCCTGGG - Intergenic
1193214428 X:78846364-78846386 TGCTCAACATCTAATTTTCATGG + Intergenic
1193388252 X:80895558-80895580 TACTCCATATCTCATATCCAGGG - Intergenic
1193877984 X:86885485-86885507 TGATAAATACCCCATTTTCAAGG + Intergenic
1194741196 X:97576133-97576155 TGGTCAATAGCTCATGCCCAAGG - Intronic
1194763397 X:97820635-97820657 TTCTCAATAACTTATTTTCATGG + Intergenic
1195106522 X:101607772-101607794 TGCTCACTACCAAATTTCAATGG - Intergenic
1196622426 X:117839011-117839033 TTATAAATACCTCATTTCAAGGG - Intergenic
1197441348 X:126494754-126494776 GACTCCATACCTCATGTCCAGGG - Intergenic
1198100948 X:133421262-133421284 TGGCCATTACTTCATTTCCATGG + Intergenic