ID: 934911003

View in Genome Browser
Species Human (GRCh38)
Location 2:98254362-98254384
Sequence ACATTTAAGGGGATTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 239}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934910992_934911003 28 Left 934910992 2:98254311-98254333 CCTTACCACACTCCCAGCCTCCA 0: 1
1: 0
2: 7
3: 67
4: 683
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910993_934911003 23 Left 934910993 2:98254316-98254338 CCACACTCCCAGCCTCCACACTA 0: 1
1: 0
2: 3
3: 77
4: 867
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910991_934911003 29 Left 934910991 2:98254310-98254332 CCCTTACCACACTCCCAGCCTCC 0: 1
1: 0
2: 6
3: 74
4: 717
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910997_934911003 8 Left 934910997 2:98254331-98254353 CCACACTACACTGCCTCCACTCT 0: 1
1: 0
2: 3
3: 27
4: 362
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910996_934911003 11 Left 934910996 2:98254328-98254350 CCTCCACACTACACTGCCTCCAC 0: 1
1: 1
2: 8
3: 48
4: 446
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910995_934911003 15 Left 934910995 2:98254324-98254346 CCAGCCTCCACACTACACTGCCT 0: 1
1: 0
2: 0
3: 35
4: 352
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910994_934911003 16 Left 934910994 2:98254323-98254345 CCCAGCCTCCACACTACACTGCC 0: 1
1: 0
2: 2
3: 39
4: 295
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910999_934911003 -8 Left 934910999 2:98254347-98254369 CCACTCTCTACATTTACATTTAA 0: 1
1: 0
2: 1
3: 43
4: 594
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239
934910998_934911003 -5 Left 934910998 2:98254344-98254366 CCTCCACTCTCTACATTTACATT 0: 1
1: 0
2: 0
3: 17
4: 288
Right 934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG 0: 1
1: 0
2: 3
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934911003 Original CRISPR ACATTTAAGGGGATTGTGAA TGG Intronic
900851120 1:5143796-5143818 CGATTTAAGGGGCTTGGGAAGGG + Intergenic
904847756 1:33433037-33433059 ACATTTAAAGGGATCATCAAAGG + Intergenic
905780699 1:40706588-40706610 AGATCTAAGGAGATTGTTAAAGG + Intronic
906478954 1:46187986-46188008 ACATTTAAGGGATCTGTGAAGGG - Intergenic
906799575 1:48724405-48724427 ACAGATCAGGGGTTTGTGAAGGG - Intronic
909559430 1:76993066-76993088 ACATTTTAGGGGACTGTAAGAGG - Intronic
909837138 1:80270444-80270466 ACCTTTAAGGGTAATGGGAAAGG - Intergenic
911662480 1:100517572-100517594 ACATATAAAAGGATTGTGATTGG - Intronic
912530977 1:110321808-110321830 GCATGGAAGGGGATGGTGAAGGG - Intergenic
912669790 1:111615130-111615152 ACATGTAAGGGTATAGTGAAAGG + Intronic
913205070 1:116531254-116531276 ATATTTTAGGGGATTTTTAAAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913670370 1:121092667-121092689 ACACTCAAGGGGATTATGCAAGG + Intronic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914022137 1:143880108-143880130 ACACTCAAGGGGATTATGCAAGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914660622 1:149788037-149788059 ACACTCAAGGGGATTATGCAAGG + Intronic
914702541 1:150148362-150148384 ACATATAAGAGCATTTTGAAAGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917156874 1:172011931-172011953 ACATTTAAGGTGGATTTGAAAGG - Intronic
917271023 1:173274539-173274561 ACAGTTTTGGGGATTGTGCAGGG - Intergenic
919479504 1:198070316-198070338 ACATTTATGTGAACTGTGAATGG + Intergenic
919580191 1:199362581-199362603 ACATTAAAGAGGATCATGAAAGG + Intergenic
920629944 1:207642385-207642407 TCCTTTAAGGGGCTTATGAAGGG - Intergenic
920929752 1:210376345-210376367 GAATGTAAGGGGATTGTGAATGG - Intronic
1063829771 10:9939451-9939473 AGATTTAAGAAGTTTGTGAAAGG - Intergenic
1063880660 10:10528391-10528413 ACATTTAATGCTATTGTGGAAGG + Intergenic
1064286573 10:13996586-13996608 AAATTAAAGGGGCTGGTGAAGGG + Intronic
1064631543 10:17318555-17318577 ACATCTAAGGGCATTGAGAATGG - Intronic
1070396845 10:76018521-76018543 ACATTTAAGGGAATTGTACAAGG + Intronic
1071701567 10:87944266-87944288 ACATTCAAGGGAATTGTGAGAGG + Intronic
1072265978 10:93728346-93728368 ACATTTGAGGAGTTTGGGAAGGG + Intergenic
1072349960 10:94546819-94546841 ACATTTAAGGTAATTTTTAAAGG - Intronic
1074204741 10:111272952-111272974 ACATTTGAGGGGTGAGTGAATGG + Intergenic
1074263567 10:111878223-111878245 ACATTTTAGGGGATGTTTAAAGG + Intergenic
1074609248 10:115005095-115005117 ACAATTAAGGGGAGATTGAAAGG + Intergenic
1074895823 10:117776850-117776872 ACATTTAAAGGGTCTGTGTAAGG - Intergenic
1075235530 10:120724460-120724482 ACAATTAAGGGGTATGTCAAAGG - Intergenic
1076477218 10:130761274-130761296 ACATTTCAGTGGATTGGGAGGGG + Intergenic
1078179566 11:8999793-8999815 ACATTTGAGGAGATACTGAAGGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080574978 11:33590134-33590156 ACTTTTAAGGGGATGCTGTAAGG - Intronic
1082017074 11:47497814-47497836 AGATTTAATGGGATATTGAATGG + Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082634984 11:55584218-55584240 ATCTTTAAGGGTAATGTGAATGG - Intergenic
1082950215 11:58806812-58806834 AAATTTTTGTGGATTGTGAATGG - Intergenic
1085158921 11:74323110-74323132 AAATTTTAGGGTATTGTTAATGG - Intergenic
1086215689 11:84377879-84377901 ACTGTTTAGGTGATTGTGAATGG - Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086867539 11:91998347-91998369 CCATATAAGGGTATAGTGAAAGG + Intergenic
1087450258 11:98311745-98311767 AGATTTAAAGAGATTGAGAAGGG - Intergenic
1087798191 11:102476506-102476528 GCATGTAAGGAGATGGTGAAAGG + Intronic
1089166876 11:116484155-116484177 AGATCCAAGGGGATTGTGTAGGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1093235982 12:16608832-16608854 ACATTTTAGGGGAAAATGAATGG - Intronic
1094702240 12:32881082-32881104 ACATTCAAGGGGAGGGAGAATGG + Intronic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1095691330 12:45092757-45092779 TCATGTAAGGGGAATGTAAAGGG + Intergenic
1096875607 12:54627976-54627998 ACATTTAAGGGCTTTGTGGAAGG + Intergenic
1099305440 12:80949129-80949151 GCATTTAAGAGGATTGAGAATGG - Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1101381396 12:104216399-104216421 AAATTCAAGGGGATGGAGAAAGG - Intronic
1103376892 12:120463619-120463641 CCATTTAAGCTGGTTGTGAATGG + Exonic
1105597001 13:21848241-21848263 ATATACAAGGTGATTGTGAACGG - Intergenic
1108397137 13:50000365-50000387 ACATTTAAAGGAATTGTCTAAGG + Intronic
1109576524 13:64266069-64266091 ACATTTTAGGGGAACTTGAAGGG - Intergenic
1109935148 13:69272710-69272732 ACATATAATGGGATTTTCAATGG + Intergenic
1112288574 13:98125368-98125390 TCATTTAAGGGTCTTGTGATAGG + Intergenic
1112675528 13:101696830-101696852 ACAATTAAGGAGAATGAGAAAGG + Intronic
1112942154 13:104876775-104876797 ACATTTTCTGGGATTGTTAAAGG - Intergenic
1113125799 13:106977786-106977808 ACATTCAAAGGGATTATAAATGG - Intergenic
1114729378 14:24975271-24975293 ACATTAAAGGAGATTTTGAAGGG - Intronic
1115915284 14:38305544-38305566 ACTTTTATGGCTATTGTGAATGG - Intergenic
1116805846 14:49493471-49493493 AGATTTAAGAGTTTTGTGAAGGG + Intergenic
1120140412 14:80924488-80924510 ACATTTAAGTGTATTATAAACGG + Intronic
1124381251 15:29168676-29168698 ACATTTTTAGGGATTGTAAATGG - Intronic
1124838127 15:33215529-33215551 ACCTTTAAGGGCTGTGTGAATGG - Intergenic
1125915585 15:43484488-43484510 ACATTTAAGGGTTTTGAGCAGGG - Intronic
1126037243 15:44558135-44558157 ACATTTCAGGGCAGGGTGAATGG + Intronic
1126686452 15:51252554-51252576 ACGTTTAAGGGGAAAGTGAGGGG + Intronic
1126727547 15:51647541-51647563 CCATTTAAGGGGTTTGAAAAAGG + Intergenic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1129646113 15:77435139-77435161 ACTTTTACAGGGATAGTGAATGG + Intronic
1131390276 15:92042489-92042511 ACACTTAAGAGCATTGTGACAGG + Intronic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135392167 16:22103003-22103025 AGGTATAAGGAGATTGTGAAAGG - Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136926950 16:34383101-34383123 ACACATAAGGGGATAGTAAAAGG - Intergenic
1136977624 16:35028706-35028728 ACACATAAGGGGATAGTAAAAGG + Intergenic
1138159358 16:54738827-54738849 ATCTTTCAGGGGATTCTGAAAGG - Intergenic
1139630252 16:68227240-68227262 ACATTTAAGGTGACTCTGAATGG + Exonic
1140590838 16:76350773-76350795 GCATTTAAGAGTCTTGTGAATGG + Intronic
1141311752 16:82920245-82920267 ACATGTAAGAGGTTTGGGAAGGG - Intronic
1146122354 17:30207000-30207022 ACATTTAAGGAGATTGAGGCTGG - Intronic
1146683614 17:34825861-34825883 ATATTTAAGGGGGATGTGAGTGG - Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149904164 17:60509861-60509883 ACATGAAAGGGGAAAGTGAATGG + Intronic
1150875379 17:68964128-68964150 ACACTTAAAGAGATTGTGCAAGG + Intergenic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1153156606 18:2157184-2157206 AAATTTAAGCACATTGTGAATGG + Intergenic
1154312085 18:13274633-13274655 AGATTTCAGGGGAGTGTGACAGG + Intronic
1155541082 18:26869019-26869041 AGATTTATGGTGTTTGTGAAAGG - Intergenic
1155853341 18:30800232-30800254 ACATTTAAGTGTCTTGAGAAGGG - Intergenic
1156552882 18:38036797-38036819 ACATTTAAGAGGATGGAGAGGGG - Intergenic
1156688280 18:39675899-39675921 ACATCTAAGGGGATGGTTAGAGG + Intergenic
1156870867 18:41943525-41943547 ACAAATAATGGGAATGTGAAGGG + Intergenic
1158335553 18:56412273-56412295 ACATTTTAGGTGATTCTTAATGG - Intergenic
1158341844 18:56474372-56474394 ACAGTTTAGGGAATTGGGAATGG + Intergenic
1163427618 19:17247829-17247851 AATCTTGAGGGGATTGTGAAGGG + Intronic
1165263683 19:34642402-34642424 ACATTTAATGGGATTGTTTTTGG - Intronic
926318770 2:11733074-11733096 ACATTTCTGGGGAGTGGGAATGG - Intronic
926390648 2:12388176-12388198 AAATCTAAGCAGATTGTGAAAGG - Intergenic
927390517 2:22589618-22589640 ACATTTAAGGTGAATCTAAAGGG + Intergenic
928679624 2:33687773-33687795 ATATTTAAAGTAATTGTGAAAGG + Intergenic
928861441 2:35861996-35862018 AAATTTAAGTGGATTTTAAAGGG + Intergenic
929644478 2:43613067-43613089 AGATTTATGGGGATTGACAAAGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
931195942 2:60052428-60052450 ACATATGAGGGGATTATGATGGG + Intergenic
931645258 2:64416488-64416510 ACATGTTTGGGGATTCTGAAAGG + Intergenic
931878986 2:66546437-66546459 ACATGAATGGGGATTATGAAAGG + Intronic
933483466 2:82887257-82887279 ACACTTGAGGGGAATTTGAAGGG + Intergenic
934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG + Intronic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935262310 2:101365829-101365851 ACTTTTCAGGGTATTGTGAAAGG + Intronic
936844534 2:116814858-116814880 ACAGTTAAGGGTACAGTGAATGG + Intergenic
937001763 2:118474172-118474194 ACATTTGAGGGGAGACTGAAAGG + Intergenic
938231203 2:129660726-129660748 AAATATAAGGAGGTTGTGAAAGG - Intergenic
940963381 2:159810726-159810748 ACATTGAAGTAGATTTTGAAAGG - Intronic
941717641 2:168780380-168780402 ACATTTCAGGGATTTGAGAAGGG + Intergenic
943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG + Intergenic
944258482 2:197649950-197649972 ACATTTAATTGGGTAGTGAAGGG - Intronic
946960746 2:224983333-224983355 ACATCTAATGGTATAGTGAAAGG + Intronic
948035326 2:234853641-234853663 ACCCCTCAGGGGATTGTGAAAGG - Intergenic
1168911832 20:1454327-1454349 ACATTTAAGGGGTTGGTCCATGG + Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1171330440 20:24332689-24332711 AAATTTATGAGGATTGAGAATGG - Intergenic
1175575269 20:60056203-60056225 ACCTTTAAGGGAATTGGAAATGG + Intronic
1177320823 21:19518073-19518095 ACTTTTAAGGTGAATGTGACTGG + Intergenic
1179032297 21:37731252-37731274 AGATTTAAGGGGCTTGTGTTTGG + Intronic
1179296396 21:40066671-40066693 ACATTTTAAGAGATTTTGAAAGG - Intronic
1179663326 21:42892505-42892527 TCATTTAAATGGATTGTGTAGGG - Intronic
1182855863 22:33517118-33517140 ACAGTTAAGGGGAATTTGTAGGG - Intronic
1183112181 22:35658486-35658508 ACTTTTCAGGGGATTTTGTAGGG + Intronic
949453200 3:4210523-4210545 CCATTTATGGGGACTGGGAAAGG - Intronic
949602067 3:5610836-5610858 ACATTCAAGGGCACTGTGAGAGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952603263 3:35110569-35110591 AACTTTAAGTAGATTGTGAAAGG - Intergenic
953406327 3:42661710-42661732 ACATCCAAGGGCAATGTGAAGGG + Intronic
959115693 3:102175428-102175450 ACATTTAGAGGGATGGTGACTGG - Intronic
959614935 3:108336652-108336674 AGATCTAAGAGGAATGTGAAAGG + Intronic
962830024 3:139131633-139131655 ACATTGTAGGAGATAGTGAAGGG + Intronic
965033619 3:163405862-163405884 ACTTTTTAGGGGAAAGTGAATGG + Intergenic
966810210 3:183837190-183837212 AAATGTAAGAGGACTGTGAAAGG + Intronic
967417639 3:189236596-189236618 ACAGTTAGTGGTATTGTGAAAGG - Intronic
967446771 3:189576454-189576476 ACATTCAAGGGCATTGTTGAAGG - Intergenic
968691988 4:1995555-1995577 TCATTTAACTGGATTGTGAAAGG - Intronic
969549906 4:7858571-7858593 ACAATTAATGGAATTGTAAAAGG + Intronic
970704052 4:18778505-18778527 ACATTCGACGGGATTTTGAATGG - Intergenic
970754741 4:19412046-19412068 ACATTTAAGTGTATTTTGATTGG - Intergenic
971912538 4:32812702-32812724 CCCTTTAAGAGGATTATGAAAGG + Intergenic
972675809 4:41257937-41257959 AAATTTAAGGCAATTGTGGACGG - Intronic
973192602 4:47402654-47402676 TAATTTAAGGGGAATGTGTAGGG - Intronic
973620779 4:52723182-52723204 ACATTTGAGAGGCTTGAGAAGGG - Intronic
973993309 4:56433530-56433552 ACATTTAAAGGGAAGGAGAAAGG + Intronic
974286115 4:59869508-59869530 TCATTTAAGGGGAGAGTAAAAGG - Intergenic
976128392 4:81857602-81857624 AGATCTAAGAGGATTGTGTATGG - Intronic
977659677 4:99568739-99568761 ACATTTATGGGGTATGTCAAAGG + Intronic
978350421 4:107815628-107815650 ACAATGAAGGAGATTGGGAATGG + Intergenic
979025080 4:115560331-115560353 AAATTTAAAGGGAATTTGAAGGG + Intergenic
979199229 4:117957047-117957069 ACATTAAATGGGACTGGGAATGG + Intergenic
980379473 4:131993125-131993147 AGTTTTCAGAGGATTGTGAAGGG - Intergenic
980959121 4:139457147-139457169 ACATTTTAACGGATTCTGAAAGG - Intronic
983572758 4:169227777-169227799 ACTTTTAAGAGGAATGTCAAAGG + Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
987440755 5:17952769-17952791 ACATGTGAGTGGAATGTGAAAGG - Intergenic
987641428 5:20616780-20616802 TTATTTAAGGGTATTGTGAAAGG - Intergenic
987945266 5:24599699-24599721 GCATTTAAGTAGATTGTTAATGG - Intronic
988181070 5:27794841-27794863 AAATTAAAGGGGATTTAGAAGGG + Intergenic
988320526 5:29689226-29689248 ACATTTAAGGAGATAATTAAGGG + Intergenic
988748611 5:34171877-34171899 ACATTTATGGGTAGTTTGAAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989973075 5:50547881-50547903 AAATTTCAGGGGATGGTGATGGG - Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
994541407 5:101102872-101102894 ACATTTAAGGGCATTATATAAGG - Intergenic
995232101 5:109778094-109778116 AAATTGAAGGGGATTTTGAGTGG + Intronic
996088988 5:119331817-119331839 ACATTTTAGGGAAATGTGAGAGG + Intronic
996217057 5:120881916-120881938 AAATTGAAGGGGAATTTGAAGGG - Intergenic
996229980 5:121050990-121051012 AGATTTAAGGTAAATGTGAAAGG - Intergenic
996339029 5:122415792-122415814 ACATTTCAAGGGACAGTGAAAGG - Intronic
996621474 5:125509360-125509382 GCATTTGAGAGGATTTTGAATGG + Intergenic
997027531 5:130082902-130082924 ATATTTAAAGGAATTGTGATGGG + Intronic
999350158 5:150862365-150862387 ACATTCAAGGAGATTGTACAAGG + Intronic
999664364 5:153897314-153897336 ACATTTCAGGGTAATGTGAGTGG - Intergenic
1000477407 5:161728055-161728077 ACATTAAAGGGGCTTATGCAGGG + Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1005253924 6:23979439-23979461 ACTTTTAAGTGGATTTTGTAAGG - Intergenic
1007405686 6:41634878-41634900 ACTTTGAAGGGTATTGTGAGGGG + Intergenic
1007962668 6:45974647-45974669 GCATTCAAGGGGTGTGTGAAAGG + Intronic
1009432160 6:63576460-63576482 ACATTTATGGAGTTTCTGAAGGG + Exonic
1009831209 6:68938242-68938264 ATGTTTAAGGAGTTTGTGAAAGG + Intronic
1010116625 6:72319235-72319257 ACATAGAAGGAGATGGTGAAGGG + Intronic
1010188034 6:73165443-73165465 AAATTCAAGGGGGTTGTGTAAGG - Intronic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012950852 6:105516188-105516210 ACATGTAATGGGATGGAGAATGG - Intergenic
1013915704 6:115334769-115334791 ACATTTTAAGGGAATGAGAAAGG - Intergenic
1014083022 6:117310015-117310037 ACATTAGAGGGGATTTTAAAAGG - Intronic
1015148145 6:130010370-130010392 ACATTTCAAGGGATAGTGAGGGG + Intergenic
1015305302 6:131700535-131700557 ACAGATAAGGGGATTGAGCATGG + Exonic
1016509687 6:144827611-144827633 ACAGTTGAGGAGATTGTGAGGGG - Exonic
1016879613 6:148897924-148897946 AAATGGCAGGGGATTGTGAAAGG - Intronic
1018328792 6:162705253-162705275 ACAGTAAAGGGGATTTTCAAGGG - Intronic
1021516082 7:21488941-21488963 ACTTCTAAGTGGATTATGAATGG - Intronic
1024208618 7:47184876-47184898 ATATTTAAGGGTATTGTGTGGGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026780879 7:73266425-73266447 GCATTTAAGTGGAGTGTAAAGGG - Intergenic
1027021733 7:74819867-74819889 GCATTTAAGTGGAGTGTAAAGGG - Intronic
1027066288 7:75126050-75126072 GCATTTAAGTGGAGTGTAAAGGG + Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027213734 7:76170339-76170361 ACATTCAAGGGGATAGGGACTGG + Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031534177 7:122913629-122913651 ACATTGAAGGGTATGGGGAACGG + Intergenic
1033531070 7:142264593-142264615 AGAGTTAAGGGGATTCTGAGTGG - Intergenic
1033739413 7:144258762-144258784 ACAGATAAGGGGATTGAGCATGG + Exonic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034822583 7:154230575-154230597 ACAGTTGAGGGGCTGGTGAAGGG + Intronic
1037604896 8:20429826-20429848 AAATTGAAAGGAATTGTGAAAGG - Intergenic
1038047156 8:23775134-23775156 TCATTTATGGGGATAGTGGAAGG + Intergenic
1038921337 8:32088155-32088177 ACATTAAAGGGGTTTGTGAAGGG - Intronic
1039744412 8:40410956-40410978 ACCTTTGAGGGGACTCTGAAAGG - Intergenic
1042547452 8:69963768-69963790 ACATTTAAGGGCGCTGTTAATGG + Intergenic
1044365439 8:91339891-91339913 ACAGTTAAGTGTACTGTGAAAGG + Intronic
1044393794 8:91684804-91684826 ACATTTAAGGTAATTTTGATTGG - Intergenic
1044637110 8:94337020-94337042 ACATTTAAAGGGCTTCTCAAAGG - Intergenic
1046216450 8:111153540-111153562 ACATTTTTGGGTATTGTTAATGG + Intergenic
1047496250 8:125411078-125411100 ACATTTAGGGGGATGGGGGAGGG - Intergenic
1047799153 8:128290865-128290887 ACATTTCAGGGCTTTCTGAAAGG + Intergenic
1049173380 8:141176022-141176044 AGATTTAAGGGGACTGTAAGAGG + Intronic
1049837029 8:144742851-144742873 TCATATAAGTGGATTCTGAAAGG - Intronic
1049997722 9:1047535-1047557 AGATTTTACCGGATTGTGAAGGG - Intergenic
1050616945 9:7411036-7411058 ACATATAAAAGGGTTGTGAATGG - Intergenic
1051311796 9:15782493-15782515 AAATTTTGGAGGATTGTGAAGGG + Intronic
1051356572 9:16244608-16244630 ACATTTAAGGCAATTTTGAGAGG + Intronic
1052051980 9:23859307-23859329 CCATTTGAGGGGACTTTGAAAGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1055371865 9:75608275-75608297 ACATTAAAGTGAATTTTGAAGGG - Intergenic
1056280245 9:85034882-85034904 ACATATAAGGGAATAGGGAATGG - Intergenic
1057840106 9:98479482-98479504 ACATTTCAGGGGATCTTGGATGG - Intronic
1058318490 9:103599379-103599401 ACATTTAAGCTGTCTGTGAAAGG + Intergenic
1060187301 9:121571528-121571550 ACATTGATGGGGATGGGGAAGGG + Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187034566 X:15524161-15524183 ACATTTTAGGGGAATGTAAATGG - Intronic
1187343014 X:18438384-18438406 GCACTTAAGGGGACTGGGAAAGG + Intronic
1189139688 X:38589293-38589315 CCATTTAATGGTATTGTTAAAGG - Intronic
1189883353 X:45514156-45514178 ACAGTGAAGGCGATTCTGAAAGG - Intergenic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1194007836 X:88518983-88519005 AAATTGTAGAGGATTGTGAAAGG - Intergenic
1195605423 X:106801200-106801222 ACCTTTAAGGGTATTGGAAAAGG + Intergenic
1196881357 X:120200846-120200868 ACAGATTAGGGAATTGTGAAGGG - Intergenic
1198334405 X:135652672-135652694 AAATTCCAGGGCATTGTGAATGG + Intergenic
1198509022 X:137330561-137330583 ACACTTAAGGGGTTTATGCAGGG + Intergenic
1198929705 X:141840857-141840879 CTATTCAAGGGGATTGAGAATGG + Intronic
1200887525 Y:8284220-8284242 ACATTTAGAGAGATTTTGAAAGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic