ID: 934912614

View in Genome Browser
Species Human (GRCh38)
Location 2:98273214-98273236
Sequence CAAGTGATACTGGTTTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934912608_934912614 25 Left 934912608 2:98273166-98273188 CCCAAAGATCTGACCTTTCAGGT 0: 1
1: 0
2: 0
3: 28
4: 579
Right 934912614 2:98273214-98273236 CAAGTGATACTGGTTTAGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
934912610_934912614 12 Left 934912610 2:98273179-98273201 CCTTTCAGGTTCATCATCTTTGG 0: 1
1: 1
2: 4
3: 13
4: 152
Right 934912614 2:98273214-98273236 CAAGTGATACTGGTTTAGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
934912609_934912614 24 Left 934912609 2:98273167-98273189 CCAAAGATCTGACCTTTCAGGTT 0: 1
1: 0
2: 0
3: 18
4: 195
Right 934912614 2:98273214-98273236 CAAGTGATACTGGTTTAGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934912614 Original CRISPR CAAGTGATACTGGTTTAGCC TGG Intronic