ID: 934912818

View in Genome Browser
Species Human (GRCh38)
Location 2:98274920-98274942
Sequence TCTGCTCCTACAGTTGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934912818_934912827 24 Left 934912818 2:98274920-98274942 CCTTGGACAACTGTAGGAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 934912827 2:98274967-98274989 CCTCTGCTCCTCAGGGAGACAGG 0: 1
1: 1
2: 0
3: 51
4: 279
934912818_934912823 16 Left 934912818 2:98274920-98274942 CCTTGGACAACTGTAGGAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 934912823 2:98274959-98274981 CCATCCTTCCTCTGCTCCTCAGG 0: 1
1: 0
2: 11
3: 73
4: 428
934912818_934912824 17 Left 934912818 2:98274920-98274942 CCTTGGACAACTGTAGGAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 934912824 2:98274960-98274982 CATCCTTCCTCTGCTCCTCAGGG 0: 1
1: 0
2: 3
3: 35
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934912818 Original CRISPR TCTGCTCCTACAGTTGTCCA AGG (reversed) Intronic
900823069 1:4905002-4905024 TCTGCTCCTTCTGTGGTCCCTGG + Intergenic
900984632 1:6066202-6066224 TCTGCACCGACAGCTGTCCCAGG - Intronic
902807927 1:18872419-18872441 CCTGCCCCTCCAGGTGTCCAGGG - Exonic
904766683 1:32854177-32854199 TCTGCATATACAGTTGTCCTTGG + Intronic
907977276 1:59444161-59444183 TCTACTCCTACAGTTTTTAATGG - Intronic
909320331 1:74277697-74277719 ACTGCTCAAACAGTTGTCAACGG - Intronic
910105122 1:83623981-83624003 CCTGATCCTACAGTAATCCAGGG + Intergenic
912732869 1:112125150-112125172 ACTGCCCCCACAGATGTCCAGGG - Intergenic
915737045 1:158091606-158091628 TCTGCTCCTTCTTTTCTCCAGGG + Intronic
916288073 1:163132637-163132659 TCTGCTCCTTTAGTTTTGCAGGG - Intronic
917201190 1:172517265-172517287 GCTGCTCTTTCACTTGTCCAAGG - Intergenic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
919577973 1:199336340-199336362 TCTGCTCCTTCATCAGTCCAAGG + Intergenic
920848965 1:209615659-209615681 TGGGCTCTCACAGTTGTCCAAGG + Intronic
921051153 1:211512826-211512848 CCTGAACCTACAGCTGTCCAGGG - Intergenic
921421551 1:214954701-214954723 ACTGCTCCTACACTTGTGCTTGG + Intergenic
922335153 1:224613402-224613424 TCAACTTCTACAGCTGTCCAGGG + Intronic
924089501 1:240487709-240487731 TCTCTTCCTACAGTTATCCCTGG - Intergenic
924322629 1:242865109-242865131 GAAGCTGCTACAGTTGTCCAAGG - Intergenic
924546444 1:245032038-245032060 TCTATTGCTACAGTTGGCCATGG - Intronic
1063172938 10:3526092-3526114 TCTGCTCCCACAGGTTTCCCTGG - Intergenic
1064898242 10:20262996-20263018 TTTGCTCCTTCATTAGTCCAAGG - Intronic
1067821705 10:49536742-49536764 TCTCCTCCTTCAGTAGTCCTGGG + Intronic
1068586920 10:58810169-58810191 TCTGCTCCAGCACTTGCCCAAGG + Intronic
1069276249 10:66594591-66594613 TCTTCTCCTAGAATTGTACACGG + Intronic
1071849972 10:89558725-89558747 TCGTCTCCTACAGCTGCCCAAGG + Intergenic
1072239572 10:93483031-93483053 TCTGGACCTACAGCTGCCCATGG + Intergenic
1076694597 10:132241022-132241044 TCTGCCCCTACAGAAGTCAACGG + Intronic
1077575682 11:3381419-3381441 ACTGCTCATACAGCTTTCCAAGG + Intergenic
1079522867 11:21349213-21349235 TCAACTCCTACAGCTGTCTAAGG - Intronic
1083046090 11:59736243-59736265 TCTTTTCCTACAGTTTTCAAAGG + Intronic
1086256454 11:84882422-84882444 CCTTCTCCTACAGGTGTTCAGGG + Intronic
1088730004 11:112671863-112671885 TTTGCTCCTTCATTAGTCCAAGG - Intergenic
1093957021 12:25232013-25232035 TCTAGTCCTACAGTTGGCCCAGG + Intronic
1098845176 12:75525886-75525908 CCTGCTCTTAGAGTTGCCCAGGG + Intergenic
1100786714 12:98086493-98086515 CCTCTTCCTACAGTTGTTCAAGG + Intergenic
1102718966 12:115000227-115000249 TCTGCACCTGCCTTTGTCCAAGG + Intergenic
1102963784 12:117111332-117111354 TCTGTTCCTGCAGGTATCCAGGG - Intergenic
1104669508 12:130670685-130670707 CTTGCAGCTACAGTTGTCCATGG + Intronic
1110867010 13:80407502-80407524 TTTGCTCCTTCATTAGTCCAAGG + Intergenic
1114757674 14:25278544-25278566 TCTGCCCCTCCAGTGATCCAGGG - Intergenic
1118854859 14:69612558-69612580 CCTGCTCCTAAATTCGTCCAGGG - Intronic
1121714686 14:96065202-96065224 TCTGCTCATACAGGTGCCCCTGG + Intronic
1121940406 14:98064784-98064806 TCTGCTCCTGTAGTTTCCCATGG + Intergenic
1122751865 14:103940939-103940961 TCTGCTCCTTCTGTGATCCAAGG - Exonic
1124087741 15:26567580-26567602 TCTGCTGCTAGAGTTGCCCTCGG - Exonic
1125022726 15:35000955-35000977 TCAGCTCCCACAGTTTTCTAAGG + Intergenic
1125819096 15:42612634-42612656 GCTACTCGGACAGTTGTCCATGG + Intronic
1128233533 15:66051710-66051732 TCTGCTCTCACAGCTGACCAGGG + Intronic
1128819110 15:70636165-70636187 TCTGTGCCTTCTGTTGTCCATGG - Intergenic
1130975731 15:88772739-88772761 TCTGCCCCTACATATGTGCATGG - Intergenic
1132729733 16:1355536-1355558 TCTGCTCCTCCTGCTGTCAAGGG - Intronic
1136570645 16:31094547-31094569 TCTTCTCCTCCAGGTGTGCACGG - Exonic
1141678254 16:85529098-85529120 GCGGCGCCTGCAGTTGTCCAGGG + Intergenic
1143139259 17:4731780-4731802 TGTGATCCTAGAATTGTCCAAGG + Exonic
1144737810 17:17564693-17564715 TCTGCTCCCACAGCTGCCCAAGG + Intronic
1145233782 17:21194295-21194317 GTTGCTCCTACAGTTGTCTTGGG + Intergenic
1149010755 17:51854077-51854099 TCTGGTCCTACACTTGGCCACGG + Intronic
1150572400 17:66398559-66398581 TCTAATCCTACAGTTACCCAGGG - Intronic
1151434876 17:74089070-74089092 ACAGCTCCTGCAGTGGTCCAGGG - Intergenic
1154181354 18:12142446-12142468 TTTGCTCCTTCACTAGTCCAAGG + Intergenic
1154182550 18:12149138-12149160 TTTGCTCCTTCACTAGTCCAAGG - Intergenic
1156696597 18:39775031-39775053 TCTGCTTTTCCAGTTTTCCATGG - Intergenic
1164156846 19:22602350-22602372 TTTGCTCCTTCAGCTGCCCACGG - Intergenic
1166877884 19:45908961-45908983 TCTGGTCCAAGAGCTGTCCAAGG + Intergenic
1167652567 19:50740943-50740965 GCGGCTCCTACTGTTGTCCCAGG - Intergenic
925146491 2:1586401-1586423 CCTGCACCTCCAGGTGTCCAGGG - Intergenic
925929195 2:8693917-8693939 TCGGCTGCTCCTGTTGTCCACGG - Intergenic
926160361 2:10483792-10483814 TTTGTTCCCACAGTTTTCCAGGG + Intergenic
926885455 2:17594356-17594378 TCTCCTTCTAGAGTTGTCCAAGG + Intronic
930715192 2:54587580-54587602 TCTTCTCCTCCAGTCCTCCATGG - Intronic
931206476 2:60150268-60150290 GCTCATCCAACAGTTGTCCAGGG - Intergenic
932936572 2:76110064-76110086 TCTGCCCCTACAGTAGTGCTAGG + Intergenic
933544924 2:83697716-83697738 TCTGCCCCTACAGCTGTGCTGGG - Intergenic
934912818 2:98274920-98274942 TCTGCTCCTACAGTTGTCCAAGG - Intronic
936391766 2:112081322-112081344 TCTCTTCCTACAGTTTTACATGG + Exonic
937584497 2:123530121-123530143 TCTGCTCCTACAATTACCAATGG + Intergenic
938590071 2:132727826-132727848 TCTGCTCCCCTACTTGTCCATGG + Intronic
940133090 2:150406405-150406427 GCTGCTCTTACAGTTTTCCAGGG - Intergenic
940867155 2:158828658-158828680 TCAACTCCTACAATTGTCAAAGG + Intronic
943104669 2:183529513-183529535 TATGCTCCTTGAGTGGTCCATGG + Intergenic
943804227 2:192102530-192102552 TCTGCTCCTAGATATCTCCATGG + Intronic
945528300 2:210917558-210917580 TCTGCTCTTACAGTTTTTCCTGG + Intergenic
947362833 2:229363828-229363850 TCTGCCCCTACAGGCATCCATGG - Intronic
948018798 2:234713056-234713078 GCTGTTCCCACAGGTGTCCATGG - Intergenic
948369589 2:237480216-237480238 TTTTCTCCTACAGTTATCCAAGG - Intergenic
948737691 2:240020108-240020130 TATGCTCCTTCAGGTCTCCACGG - Intronic
1173371245 20:42438232-42438254 TATGCATCTACAGTTGTCCTAGG - Intronic
1175216186 20:57392641-57392663 TCTGCTCCACCAGGTGACCATGG + Exonic
1179173767 21:38992427-38992449 TCTGCCCCTAAGGATGTCCACGG + Intergenic
1179189176 21:39108570-39108592 TCTGTTCCCACAGGTGTGCAAGG + Intergenic
1179530883 21:42018932-42018954 TCTGATCCTCCAGTTGGGCAAGG + Intergenic
1181184323 22:21091552-21091574 TCTGATACTACAGTATTCCAAGG + Intergenic
1183041727 22:35184942-35184964 TTTGCTCCTTCATTAGTCCAAGG - Intergenic
1184011412 22:41751368-41751390 TCTGCTTTTACAGTGGCCCAGGG + Intronic
950408701 3:12820484-12820506 TCTTCTCCCTCAGTTGCCCATGG - Intronic
952929571 3:38348489-38348511 TCAGCTTCTACACTGGTCCAGGG - Intronic
952977776 3:38710533-38710555 TTTGCTCCCACCCTTGTCCAGGG + Intronic
953925520 3:46980529-46980551 TCTGCTCCTAGAGAGGTCCTGGG - Intronic
955507566 3:59647386-59647408 TCTGACCCTCCATTTGTCCATGG - Intergenic
960342939 3:116497342-116497364 TTTGCTCCTTCATTAGTCCAAGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963077024 3:141356294-141356316 ACTGCTCATACAGTGGCCCAGGG + Intronic
963782609 3:149501986-149502008 CCTACTCCTACGGTTGTCAATGG + Intronic
965542467 3:169883699-169883721 TCCTCTTCTACAGGTGTCCAAGG - Intergenic
967591016 3:191273735-191273757 TCTTCTCCTCCAGTTATCCTTGG + Intronic
970790658 4:19854279-19854301 TCTGCCCCTATAGCTTTCCAGGG + Intergenic
972488025 4:39560774-39560796 TCTGTTCATCCAGTTGCCCAGGG + Intronic
973574555 4:52273736-52273758 TTTGCTCCTTCATTAGTCCAAGG - Intergenic
974269560 4:59633135-59633157 TCTGCTCCTATGGTTTTGCAGGG + Intergenic
976075856 4:81298363-81298385 TCTGCTCCTGCAGCTTTGCAGGG - Intergenic
977649522 4:99453993-99454015 TTTGCTCCTTCACTGGTCCAAGG + Intergenic
978378422 4:108100380-108100402 TTTGCTACTACAGTTTTCCATGG - Intronic
980310670 4:131125772-131125794 TCTGCTCCTGCAGCTTTGCAGGG + Intergenic
986138485 5:5006125-5006147 TCTGCTCCTGCAGCTATGCAGGG - Intergenic
987887595 5:23831506-23831528 TCGGCTCCTTCATTAGTCCAAGG - Intergenic
988691532 5:33577298-33577320 TGTGCTCTTTCAGTTTTCCATGG + Intronic
989410426 5:41113668-41113690 CCTGCCACTACAGTTGACCATGG - Intergenic
990339027 5:54804078-54804100 TCTTCAGCAACAGTTGTCCATGG + Intergenic
994370578 5:98962861-98962883 TCTCCTCCCATAGTTGTCCAAGG + Intergenic
995559391 5:113364420-113364442 TCTGCCCCTACAGCTTTGCAGGG + Intronic
995916540 5:117252929-117252951 TCAGCTTCTATAATTGTCCAAGG + Intergenic
996434289 5:123417248-123417270 TCTGTTGCTAGAGTAGTCCATGG - Intronic
1003171461 6:3724699-3724721 TGAGTTCCCACAGTTGTCCACGG - Intronic
1003976565 6:11350557-11350579 TCTGCTCCCACAGTTAGTCACGG - Intronic
1004534158 6:16483388-16483410 TCTACTGCAACAGTTCTCCATGG + Intronic
1005848032 6:29797603-29797625 TCATCTCCCACAGTTATCCATGG - Intergenic
1006448590 6:34093045-34093067 TCTGCCCGCTCAGTTGTCCAGGG + Intronic
1009376139 6:62972013-62972035 TCTGCTACTACAACTGTTCAGGG - Intergenic
1011091355 6:83604911-83604933 GTTGCTCCTATAGTTGTACAAGG + Intronic
1011730871 6:90261931-90261953 TCTGCTCCTACAGAAGTTCATGG - Intronic
1013386238 6:109634571-109634593 TCTGATGCTGCAGTGGTCCATGG - Intronic
1013766408 6:113579089-113579111 TCTCTTCCTGCAGTTTTCCAGGG - Intergenic
1014665403 6:124231041-124231063 TCTGCCCCTGCAGTTTTGCAGGG - Intronic
1016425748 6:143934276-143934298 TATGCTCCTGCAGTTGTTCCTGG + Intronic
1018720612 6:166569255-166569277 TCTGCTCCTCCCGTCTTCCATGG + Intronic
1019480665 7:1265276-1265298 TCTGCACCTACAGTTCTCTGAGG - Intergenic
1019631192 7:2050685-2050707 TCTGCCCCTTCAGTTGTCCTTGG - Intronic
1019876021 7:3811618-3811640 TCTGCTGCTGCTGTTGGCCATGG + Intronic
1019918712 7:4149678-4149700 TCTGCTCTTCCAGGTGTGCAGGG + Intronic
1026190500 7:68121980-68122002 TCTGCTGCTACAATTTTCCCCGG - Intergenic
1030905702 7:115179438-115179460 TGTGCTCCTGCAGTTGTATATGG - Intergenic
1031273427 7:119685545-119685567 TCTTCACCTACAGTTGTTGAAGG - Intergenic
1032638696 7:133740284-133740306 TATGGTCCTACAGTTTTCAAAGG - Intronic
1038983070 8:32780255-32780277 TCTGCTCCTGCAGTTGCCATAGG - Intergenic
1039049383 8:33479113-33479135 TCTGCTCCTCCAGTTGGGCACGG + Intronic
1039898011 8:41729966-41729988 TCTGCTCCTTAAGTAGTGCAGGG - Intronic
1041191572 8:55360907-55360929 TATGCTCCAACAGTTCTCCCTGG - Intronic
1043438903 8:80259873-80259895 CCTGCTCCTGCAGGTGCCCAAGG - Intergenic
1044446544 8:92283899-92283921 TCAGCTCCTGCAGTTGAACAAGG + Intergenic
1045767400 8:105690615-105690637 GCTACTCCCACAGGTGTCCAAGG - Intronic
1049986110 9:953471-953493 TCTTCTCTTGCAGTTGTCAAAGG + Intronic
1051152974 9:14105001-14105023 TGTGGTCCTACAGTTGTCTGTGG - Intronic
1052378187 9:27741510-27741532 TTTGGTCCTTCATTTGTCCAAGG + Intergenic
1058066468 9:100554135-100554157 TCTCCTCCTGCAGCTGGCCAGGG + Intronic
1060546652 9:124465927-124465949 TCTGCTCCTTCAAGAGTCCAAGG - Intronic
1060915866 9:127390152-127390174 TCCCCTCCTGCAGTTGTTCAGGG - Intronic
1062035957 9:134382647-134382669 TCAGCCCCTCCAGTTATCCAGGG + Intronic
1062267497 9:135693984-135694006 TCTGGTCCAACAGGTGTCCTGGG - Intronic
1188962326 X:36507723-36507745 TCTGCTCCTATGGCTTTCCAGGG + Intergenic
1189199166 X:39176939-39176961 TCTGCTGGTCCAGTTGTGCATGG - Intergenic
1189560004 X:42182832-42182854 TCTTCTCCAAGTGTTGTCCAGGG + Intergenic
1190133197 X:47769433-47769455 TCCGCTCCTTCATTAGTCCAAGG - Intergenic
1192254324 X:69442977-69442999 TTTGCTCCTTCATTAGTCCAAGG + Intergenic
1195603394 X:106774014-106774036 TCTGATACTTCAGTTGTGCAAGG - Intronic
1201942412 Y:19474091-19474113 GCTGCTCCTACTGTTCTCTAAGG + Intergenic