ID: 934913198

View in Genome Browser
Species Human (GRCh38)
Location 2:98277506-98277528
Sequence CTTGACTGCTTTGGAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934913193_934913198 11 Left 934913193 2:98277472-98277494 CCAGAAAGATCAAAAAGGCTCTC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG 0: 1
1: 0
2: 0
3: 16
4: 218
934913190_934913198 19 Left 934913190 2:98277464-98277486 CCTTTGGCCCAGAAAGATCAAAA 0: 1
1: 0
2: 1
3: 15
4: 274
Right 934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG 0: 1
1: 0
2: 0
3: 16
4: 218
934913189_934913198 30 Left 934913189 2:98277453-98277475 CCAGGGCAAATCCTTTGGCCCAG 0: 1
1: 0
2: 2
3: 14
4: 116
Right 934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG 0: 1
1: 0
2: 0
3: 16
4: 218
934913192_934913198 12 Left 934913192 2:98277471-98277493 CCCAGAAAGATCAAAAAGGCTCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG 0: 1
1: 0
2: 0
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934913198 Original CRISPR CTTGACTGCTTTGGAAAATC TGG Intronic
901683555 1:10930360-10930382 CTTGGCTGGTATGGAAATTCAGG + Intergenic
902561574 1:17280811-17280833 CATGACTCCTTTGCCAAATCAGG + Intronic
904158183 1:28502329-28502351 CTTGGCTGCTTTGCAACATTTGG + Intergenic
905609325 1:39335968-39335990 CTTGTCTGTTTTGGAAATTTGGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907698091 1:56754423-56754445 TATGACTGCTTGGGAGAATCAGG - Intronic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909499143 1:76313895-76313917 CTAAACTGCTTTGGACAACCTGG + Exonic
909709451 1:78629824-78629846 CTTGACTGAATTGAAAAAACTGG - Exonic
910517579 1:88079627-88079649 CTTGAGTGATTTGGAAGATAGGG + Intergenic
914335675 1:146713219-146713241 CTTGACTCCTTTGGCCAATGAGG - Intergenic
914382601 1:147131095-147131117 CATGACTGAATTGGAAAATGTGG - Intergenic
924423402 1:243930280-243930302 CTTGTCTGTTTTGCAAAACCTGG - Intergenic
924480371 1:244426164-244426186 CATGACTGATTTGCAAAATCAGG - Intronic
1063431342 10:5991533-5991555 TTTGTCTGCTTCAGAAAATCTGG - Intergenic
1064844898 10:19640626-19640648 CTAGACTATTTTGGAAAATGTGG + Intronic
1065023500 10:21519507-21519529 CTTGGCTGCTTTGCAAAATTCGG + Exonic
1065417804 10:25508039-25508061 CTTGACTGATATGGGAATTCAGG - Intronic
1065986848 10:30962862-30962884 CTTTACTGTTTTGGAAAAACTGG + Intronic
1066235108 10:33478230-33478252 CTTGAATGTTTTGGAAGATGAGG - Intergenic
1066523656 10:36251643-36251665 CTTAACTGATTTGGGGAATCTGG - Intergenic
1066600460 10:37100442-37100464 TTTGAGTTCTTTGTAAAATCTGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1068478643 10:57561922-57561944 CTCAACTCCTTTAGAAAATCTGG - Intergenic
1069950818 10:72016980-72017002 CTTGGCTCCTCTTGAAAATCAGG + Intergenic
1070023791 10:72611869-72611891 CTCGGCTGCTTGGGAAAATGAGG + Intronic
1072728259 10:97828071-97828093 CTGGACTGCTTTGGGAACTGGGG - Intergenic
1073699712 10:105912889-105912911 ACTGACTGCTTTGGATAATATGG - Intergenic
1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077973551 11:7222031-7222053 CTTAACTGCTGTGGATGATCAGG + Intergenic
1078691016 11:13580364-13580386 CTCAACTCCTTTGGAATATCTGG + Intergenic
1079172912 11:18113083-18113105 CTTGACTGCCTTGGACAGTCAGG - Intronic
1079186864 11:18245846-18245868 CTTGCCTGCCTTGGACAGTCAGG - Intronic
1079189982 11:18269375-18269397 CTTGCCTGCCTTGGACAGTCAGG + Intronic
1079469062 11:20760879-20760901 CTTGGCCCCTTTGGAAAATCGGG + Intronic
1080704948 11:34681727-34681749 ATTGACTATTTAGGAAAATCTGG + Intergenic
1083870814 11:65487404-65487426 CTTGACTACTCTGGAAAATGAGG + Intergenic
1084348707 11:68577278-68577300 CTTGAGTGTTCTGGATAATCAGG + Intronic
1084489898 11:69472540-69472562 CTTGACAACTCTGGAAAATCGGG + Intergenic
1085698152 11:78722993-78723015 CTTGCATGCCTTGCAAAATCAGG - Intronic
1086853188 11:91835844-91835866 CTTAACTGGTTTGCAAAAGCTGG - Intergenic
1087439777 11:98168604-98168626 CTAGACTGCTTTGGGAAGTATGG - Intergenic
1087455345 11:98378251-98378273 CTTGGCTCCTGTGGAAAATGAGG - Intergenic
1088141748 11:106625249-106625271 CTTGACTTGTTTGGAAAATGTGG - Intergenic
1088605071 11:111521660-111521682 CTTGAATGCTTTGACAAATTAGG - Intronic
1089000830 11:115050809-115050831 CTTCACTGCCTTGGACAGTCTGG - Intergenic
1089426814 11:118384189-118384211 CTTGATTACTCTGAAAAATCAGG - Intronic
1090677590 11:129015292-129015314 TATGACTGCCCTGGAAAATCAGG + Intronic
1092374694 12:7945635-7945657 CAGGATTGCCTTGGAAAATCTGG + Intergenic
1092583295 12:9871989-9872011 CCTTACTGCTTTGGTAAATAAGG - Intergenic
1092740548 12:11624933-11624955 CCTGACTGCTTTGGCTATTCAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097766651 12:63534102-63534124 CTTGAATTCTTTGGAAATACTGG + Intergenic
1097782988 12:63729029-63729051 CTTGAATTCTTTGGAAATACTGG + Intergenic
1098897404 12:76079901-76079923 CTAGACTGGTCTGGAAATTCTGG + Intronic
1100342607 12:93694992-93695014 CAAGACTGCTTTGGCAATTCAGG - Intronic
1102655218 12:114477211-114477233 CTGGACTGCCTTGCAAAATGTGG + Intergenic
1102771030 12:115476343-115476365 GTAGACTGATTTTGAAAATCAGG - Intergenic
1106938324 13:34748344-34748366 CTGGACTGCCTTGTAAAATATGG - Intergenic
1107236992 13:38183359-38183381 CTTGATTGTTTTGGAAATACAGG - Intergenic
1107288476 13:38823968-38823990 CTTGAGTGTTTTGGAGAATGAGG + Intronic
1110091961 13:71462433-71462455 TTTAAATGCTCTGGAAAATCTGG + Intronic
1111596616 13:90420043-90420065 CTCGACTGCTTTGATAAGTCTGG + Intergenic
1112116031 13:96355145-96355167 CATGATTGCTTTGAAGAATCTGG + Intronic
1112228921 13:97568488-97568510 CTTTACTGATATGGAAAATGAGG - Intergenic
1112676827 13:101711337-101711359 CTGGACTTCTTTGGAAGATGTGG - Exonic
1116192974 14:41683977-41683999 CATGACAGCTTTGGATATTCTGG - Intronic
1118242131 14:64070139-64070161 CTTCACTGGTTTGGTAATTCTGG + Intronic
1119162170 14:72461717-72461739 CTAAACTGCTTTGGAAACCCTGG - Intronic
1122100623 14:99406713-99406735 TCTGAATGCTTTGGAAAATGGGG + Intronic
1124874944 15:33583134-33583156 CTTTACTGATTTAGAAACTCTGG - Intronic
1125099126 15:35890155-35890177 CTTGACATCTCTGCAAAATCAGG + Intergenic
1125175551 15:36818067-36818089 ATAAACTGCTTTGGAAGATCTGG - Intergenic
1126729376 15:51666534-51666556 CTTGGCTGCTTACCAAAATCAGG + Intergenic
1127617287 15:60699644-60699666 CCTGACTTCTTTGTAAAATGGGG + Intronic
1130090281 15:80815074-80815096 ATTCACTTCTTTGGAAAAACCGG + Intronic
1131824728 15:96309806-96309828 CTTGAGTGCTTACGATAATCAGG - Intergenic
1133186850 16:4106166-4106188 CTTGTCTGCTCTTGGAAATCAGG - Intronic
1135042513 16:19128878-19128900 TTAGACTGCTTTTGAAAACCAGG - Intronic
1135152561 16:20021808-20021830 CTTGACTGATTTGTAGAATCGGG + Intergenic
1135590795 16:23704096-23704118 GTAGACAGCTTGGGAAAATCAGG - Intronic
1137365822 16:47858688-47858710 CTTGAGTGGTTTGGTAAAACAGG - Intergenic
1139997949 16:70998009-70998031 CTTGACTCCTTTGGCCAATGAGG + Intronic
1141318122 16:82980783-82980805 CTTGACTGTGTTGAAAAATGAGG - Intronic
1141789149 16:86221726-86221748 CTTTACTCCTTTGTAAAATGGGG + Intergenic
1144371184 17:14593294-14593316 CTTGAAAGGTTTGGAAAATAAGG + Intergenic
1149093947 17:52817832-52817854 CTTAAATGCTTTGGTAATTCAGG - Intergenic
1150163242 17:62916919-62916941 CTTGACCTCTTTGCACAATCTGG - Intergenic
1154489774 18:14911586-14911608 CATGATTGCTTTGGATATTCAGG + Intergenic
1156859686 18:41821407-41821429 CTTTACTGCCTTAGAAAAACTGG + Intergenic
1158124821 18:54089708-54089730 ATTGAGAGCTATGGAAAATCTGG + Intergenic
1158302637 18:56068631-56068653 CTTTCCTGCTCTGGGAAATCAGG - Intergenic
1162242940 19:9371627-9371649 CCTGGCTGCTTTGGAAATTATGG + Intronic
1163359075 19:16834242-16834264 CCTGAATGCTGTGGAAACTCTGG + Intronic
1164009881 19:21191821-21191843 CTTGATTGCTTTGGCTATTCAGG + Exonic
1164059971 19:21662793-21662815 CTTGATTGCTTTGGCTATTCAGG + Intergenic
1164065811 19:21715981-21716003 CTTGATTGCTTTGGCTATTCAGG - Intergenic
925451446 2:3973034-3973056 CCTGCCTGCTGTGGGAAATCAGG - Intergenic
925969925 2:9099090-9099112 TCCAACTGCTTTGGAAAATCTGG - Intergenic
927282222 2:21318983-21319005 AATCACTTCTTTGGAAAATCAGG - Intergenic
928428968 2:31202217-31202239 CTTGGCTGCTTTGCAAGCTCTGG - Exonic
931057058 2:58484024-58484046 CTTGACTGCTTTGGGTAAGGAGG + Intergenic
934649872 2:96084700-96084722 CTGCACTGCTTTGGCTAATCCGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
936175535 2:110216906-110216928 CTTGACTCATTTGTAAAATAAGG + Intergenic
937093430 2:119221722-119221744 CTCGTCTGCTTTGGGAAATTTGG + Intergenic
938796674 2:134723234-134723256 TTTTACCACTTTGGAAAATCAGG + Intergenic
939932292 2:148250523-148250545 CTTTTCTGCTTTTGAAGATCAGG + Intronic
940598288 2:155822474-155822496 TTTGACTTCCTTGGAGAATCTGG - Intergenic
940652939 2:156455253-156455275 CAAGACTGCTCTGGAAAATTAGG + Intronic
942714527 2:178876318-178876340 CTTTCCTCCTTTTGAAAATCAGG - Intronic
943055878 2:182978420-182978442 TTTGACAGATTTGGAAACTCTGG - Intronic
943564749 2:189504510-189504532 ATTGACAGCTGTGGAAAATGAGG - Intergenic
943808487 2:192154059-192154081 CATGGCTGCTTTTGAAAATGGGG + Intronic
944928620 2:204492268-204492290 TTTGACTGCTTTGTCAAAGCTGG - Intergenic
945547894 2:211180641-211180663 TTTGACTACTTTTGTAAATCAGG + Intergenic
947007006 2:225523627-225523649 CTAGATTGCTTTGGACAATATGG - Intronic
947498850 2:230657975-230657997 CTTCGCTGCTTTGAAAAATGCGG + Intergenic
1168997226 20:2142474-2142496 CTTGTCTGCTTTGGTCATTCGGG + Intronic
1169574400 20:6942187-6942209 CTTGACTGATTAGGAAATTAAGG - Intergenic
1169725371 20:8723677-8723699 CTTGACTCATTTGTAAAATTAGG - Intronic
1173465559 20:43278470-43278492 CATGACTGTTTTGGACACTCTGG - Intergenic
1178124098 21:29498971-29498993 TTTGCCTCATTTGGAAAATCAGG + Intronic
1179292751 21:40032993-40033015 CCAAACTGCTTTGGAATATCTGG + Intronic
1182535361 22:30998189-30998211 CTTTTCTGTTTTGCAAAATCTGG - Intergenic
1182743412 22:32585562-32585584 CTGGCCTGGTTTGGGAAATCTGG - Intronic
1183011656 22:34951722-34951744 AATGACTACTTTGGAAAATAAGG + Intergenic
1184611122 22:45603972-45603994 CTTGAGAACTTTGGAAAAGCTGG - Intergenic
1185379440 22:50501341-50501363 CTTGAAAGCTTAGGAACATCAGG + Intergenic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949297375 3:2541399-2541421 CTTGACTTATTTGCAAAATAAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953126986 3:40100526-40100548 ATTGACTGCTTTACAAAAACAGG + Intronic
957184068 3:76919042-76919064 CTTGAGTTCTTTGTAAATTCTGG + Intronic
957479002 3:80767272-80767294 GTTGCATGCTTTGAAAAATCTGG - Intergenic
958972889 3:100632909-100632931 CTTGACTGCTTTATGAAATCTGG - Intronic
959374024 3:105565181-105565203 TTTCACTGCTTTTGAAAATTTGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966649405 3:182282649-182282671 CTTTCCTACTTGGGAAAATCTGG - Intergenic
968090263 3:195894855-195894877 CTTGTTTGCTTTTGAAAATATGG - Intronic
969269507 4:6089620-6089642 CTTGACTGCTTAGAAACAACCGG - Intronic
971121317 4:23707990-23708012 CTTGACTGCTCTCTAAATTCAGG + Intergenic
971645181 4:29190202-29190224 AATGACTGCTATGGAAAATGTGG + Intergenic
975280976 4:72561931-72561953 GTAAACTTCTTTGGAAAATCAGG + Intronic
976470273 4:85420243-85420265 CTTGACTTCTTTTTAAAATATGG - Intergenic
976878027 4:89880283-89880305 CTTGACTGCTTGTTAAAATGGGG + Intronic
976922212 4:90454708-90454730 CCTGACTACTGTGGAAAAGCAGG - Intronic
977901921 4:102432298-102432320 TTTGACAGTTTTGGAAGATCTGG - Intergenic
979123831 4:116940893-116940915 ATTGATTGCTTTGAAAAATTGGG - Intergenic
979291420 4:118982846-118982868 TTTGACCTCTTTGGACAATCTGG - Intronic
980310201 4:131118040-131118062 CTTGGCTGCTTTGTAAAATTGGG + Intergenic
981023242 4:140050543-140050565 CATGGCTGCTTTGGAGAACCTGG - Intronic
981531332 4:145756417-145756439 CTTGACTTCTCTGGAAAACATGG - Intronic
984850662 4:184149813-184149835 CTTGATTTCTTTGGATAAGCAGG - Intronic
987272035 5:16320160-16320182 CTTTACTGCTTATGAATATCTGG + Intergenic
988935202 5:36075178-36075200 CTAGACTGCTTTGGGAAGTATGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990506052 5:56446644-56446666 CTTTAGTCCTTTGGAAAATTTGG + Intergenic
991465918 5:66911976-66911998 AAAGACTGCATTGGAAAATCAGG - Intronic
993775177 5:91985496-91985518 CTTTAGTACTTTGGAAAAACGGG - Intergenic
994255110 5:97583706-97583728 GTTGCCTTCCTTGGAAAATCAGG + Intergenic
995039609 5:107572538-107572560 CTTGACTACTGGAGAAAATCTGG + Intronic
996027972 5:118670821-118670843 CATGACTGCTTTGGCCATTCAGG + Intergenic
996734012 5:126742233-126742255 TTTGAGTCCTTTGTAAAATCTGG + Intergenic
998922173 5:147081669-147081691 CTTGACTGCTTGCCAAAGTCAGG + Intronic
999214215 5:149918211-149918233 CTAGACTGCTTTAAAAAGTCTGG + Intronic
1000744165 5:165010495-165010517 CTTTACTGCTATTGAAAATGGGG + Intergenic
1003940952 6:11026030-11026052 CTTATCTGCTTAGGAAACTCAGG - Intronic
1008380925 6:50839167-50839189 CTTGATTGCTTTCCAAAATGAGG - Intronic
1008618803 6:53251759-53251781 CTTTACTGCTCTGGAAACCCAGG - Intergenic
1009983976 6:70760125-70760147 CTTGATTGCCTTTGAAAATAGGG + Intronic
1010633228 6:78225918-78225940 CTTGAGTTCTTTGTAAATTCTGG + Intergenic
1012334988 6:98044432-98044454 TTTCACTGCTTTAGAATATCAGG + Intergenic
1012503416 6:99916215-99916237 GTTGACTGCTTTGGAATTCCTGG - Intergenic
1013262099 6:108454489-108454511 CTTGATTGCTGTGGAGACTCTGG + Intronic
1014209460 6:118692527-118692549 ATTGACTACTTTGAAACATCTGG + Intronic
1015103418 6:129507625-129507647 CTTACCTGCTTTGGCAAAACCGG - Exonic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1021840330 7:24717150-24717172 CTCGACTGCTTTGGAGACTGTGG - Intronic
1024014593 7:45300678-45300700 CTTGATTGCTTTGGATATTTGGG - Intergenic
1024419416 7:49145037-49145059 TTTGAGTGCTTAGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027457462 7:78411173-78411195 CTTGACTGGCTTTGAAAATGAGG - Intronic
1027720435 7:81734862-81734884 CTTGTCTCCATTGGGAAATCTGG - Intronic
1028447114 7:90937468-90937490 CTTGACTGCTATAGGAAACCAGG - Intronic
1028570453 7:92280679-92280701 CTTGGCTGCTTTGGCAATTTTGG - Intronic
1028811254 7:95089546-95089568 GTTAACTGCTTTGGAGATTCTGG + Intronic
1030149221 7:106386188-106386210 CTCCCCTGCTTTGGAAAATATGG + Intergenic
1030481970 7:110115956-110115978 TTTGACTGCTTTGGGAGAGCAGG - Intergenic
1030899989 7:115111425-115111447 CTTGTCTTCTTTGTCAAATCTGG + Intergenic
1031238834 7:119212059-119212081 CTAGACTGCTTTGGCTATTCTGG + Intergenic
1031290284 7:119925888-119925910 CTTGCCTTCTCTGGAAAAGCTGG + Intergenic
1033156412 7:138960835-138960857 TTTGATCTCTTTGGAAAATCCGG - Intronic
1036074403 8:5478832-5478854 CTTGAGTGCTCTGGAAATGCAGG - Intergenic
1036527572 8:9549279-9549301 CATGCCCTCTTTGGAAAATCAGG - Intergenic
1036701061 8:11014320-11014342 TGTGCCTGCTTTTGAAAATCTGG - Intronic
1039589554 8:38735212-38735234 TTTCACAGCTTTGGAAAATGAGG + Intronic
1040395421 8:46994580-46994602 CATGGCTGATTTGGGAAATCAGG + Intergenic
1040456850 8:47606702-47606724 CTAGACTCCTTTTGAAAAGCTGG + Intronic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1041161409 8:55048965-55048987 CATGATTGCTTTGGATATTCAGG - Intergenic
1041399351 8:57425618-57425640 CTTGATTGCTGTGAAAAACCAGG + Intergenic
1041509331 8:58637916-58637938 GTAGATTGCTTTGGAAAATATGG - Intronic
1041552272 8:59116970-59116992 GTTAAATGCTTTGGAAAATCAGG - Intronic
1043314773 8:78906915-78906937 CTTGACTTCTTTGCAGAATAGGG + Intergenic
1043340704 8:79234768-79234790 CTAGATTGCTTTGGGAAATATGG - Intergenic
1044016431 8:87052729-87052751 CCTGACTGCTGTGGAGAAACAGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045723473 8:105141670-105141692 CTAGGCTGGTTTGGAAATTCTGG + Intronic
1046730621 8:117721970-117721992 CTTGAGTTCTTTGTAAATTCTGG + Intergenic
1050528881 9:6570040-6570062 GGTGACTGCTTTGGAATATTTGG + Intronic
1051182414 9:14425157-14425179 CTTGACTGCTGTGGAATGTGTGG - Intergenic
1052471622 9:28903818-28903840 CTTCAGTGCTTTGGAAAATTTGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055254882 9:74357046-74357068 TTTGAATGTTTTTGAAAATCAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056333045 9:85537602-85537624 CTTGACAGGTGTGGAAATTCAGG + Intergenic
1057160578 9:92885636-92885658 CTTGAATGCTTTGGGGAATTTGG + Intergenic
1057439125 9:95069615-95069637 CTTAACTACTTTTGAAAACCTGG - Intronic
1057828559 9:98389905-98389927 CTTGGCTACTTTGTAACATCCGG - Intronic
1058061292 9:100499281-100499303 CTTGACTGACTTGGAGACTCGGG + Intronic
1058453437 9:105117608-105117630 CCTGACTGCCTTGGAAGAGCCGG + Intergenic
1059749375 9:117233371-117233393 CTTGACTGATGAGGAAAATCAGG - Intronic
1060162423 9:121377205-121377227 CTTGACTGCTTGGAGACATCAGG + Intergenic
1193102687 X:77633819-77633841 CTTGCCTGGTTTGGAAATTCTGG - Intronic
1193239294 X:79147679-79147701 CTTCACTGCTTTCTCAAATCTGG - Intergenic
1193365755 X:80630282-80630304 AATGACTACTTTGGAACATCTGG - Intergenic
1194057117 X:89149436-89149458 TTTCACTGCTTTGGGGAATCGGG + Intergenic
1195492777 X:105491738-105491760 ATTTACAGCTTTGGAAAATCTGG + Intronic
1198025795 X:132705319-132705341 CTTGACCTCTTTGGAGATTCTGG - Intronic
1198767396 X:140093045-140093067 CTTGACATCTTTGTGAAATCTGG + Intergenic