ID: 934916157

View in Genome Browser
Species Human (GRCh38)
Location 2:98302690-98302712
Sequence GAATGCCTACTCAACACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934916157_934916159 2 Left 934916157 2:98302690-98302712 CCTGGTGTGTTGAGTAGGCATTC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 934916159 2:98302715-98302737 ACACAGACAATCTGGCTCCATGG 0: 1
1: 2
2: 7
3: 68
4: 327
934916157_934916158 -6 Left 934916157 2:98302690-98302712 CCTGGTGTGTTGAGTAGGCATTC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 934916158 2:98302707-98302729 GCATTCGAACACAGACAATCTGG 0: 1
1: 0
2: 0
3: 22
4: 244
934916157_934916162 28 Left 934916157 2:98302690-98302712 CCTGGTGTGTTGAGTAGGCATTC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 934916162 2:98302741-98302763 ACCCTCTAAACTACCATGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934916157 Original CRISPR GAATGCCTACTCAACACACC AGG (reversed) Intronic
900403077 1:2480598-2480620 GAATGCCCAGTCCACTCACCTGG - Intronic
900413330 1:2523674-2523696 GTCTGCCTACTCCCCACACCCGG + Intronic
901286500 1:8083535-8083557 GATTGCCTTCTCAAGACACACGG + Intergenic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
907922249 1:58924596-58924618 AAATACCTTCTCAGCACACCTGG + Intergenic
909195519 1:72616881-72616903 CAATGCCTACCTGACACACCTGG + Intergenic
909521043 1:76568096-76568118 GAATGCCTGGTTAACTCACCGGG + Intronic
912610534 1:111038123-111038145 GAATGCATACTAATCACATCAGG - Intergenic
914936876 1:151989389-151989411 GAAGGCCTACTGGACACACAGGG - Intronic
916625539 1:166551900-166551922 GAATGCCTACTCTCCTCTCCAGG - Intergenic
922021813 1:221712965-221712987 GAATGCCTTCTTAAAATACCAGG - Intronic
1062972035 10:1655291-1655313 GGGTGCCCACTCAACACCCCAGG + Intronic
1070711703 10:78687629-78687651 GAAGGCCTATTCATCACAGCTGG + Intergenic
1085837375 11:79971493-79971515 GAATGCAAACTCCACATACCAGG - Intergenic
1091900196 12:4138318-4138340 GAATGCCTATTAACAACACCAGG + Intergenic
1093912973 12:24768301-24768323 CCAGGCCTACTCAACACCCCAGG + Intergenic
1096688568 12:53305527-53305549 GAATACCTACTCACCCCACCTGG + Intronic
1098292852 12:68974331-68974353 GATGGCCTACTCAACCCAGCAGG + Intergenic
1098309972 12:69138873-69138895 GAATGCCTACTGTCCCCACCAGG - Intergenic
1103081656 12:118028886-118028908 GAAAGCCTACACAAGTCACCTGG - Intronic
1116980727 14:51167189-51167211 GACTGCTTACCCAAGACACCTGG + Intergenic
1118300767 14:64613830-64613852 GAATAACTTCTCAACACACAGGG - Intergenic
1118967851 14:70604759-70604781 GACTGCCAACTCAATACAGCAGG + Intergenic
1119445136 14:74657128-74657150 GAATGAGTACTCAAGACACCTGG - Intronic
1130191608 15:81741723-81741745 GTATGACCACACAACACACCTGG - Intergenic
1135993614 16:27232204-27232226 GAGTGCGTCCTCAACACACATGG + Intronic
1146634526 17:34494304-34494326 GAATGCCTATTCTCCACCCCAGG + Intergenic
928097455 2:28413306-28413328 GACGCCCTACTCAAGACACCAGG - Exonic
929966311 2:46539827-46539849 AAATCCTTCCTCAACACACCTGG + Intronic
931944729 2:67293176-67293198 GAATGCATGCCCAAAACACCCGG - Intergenic
934916157 2:98302690-98302712 GAATGCCTACTCAACACACCAGG - Intronic
936270770 2:111046882-111046904 GCATTCCTCCTCACCACACCAGG - Intronic
939982622 2:148799292-148799314 GAATGCCTATTTCACATACCAGG + Intergenic
945437699 2:209838531-209838553 GAATGCCATCACACCACACCCGG - Intronic
946042686 2:216795981-216796003 GAATCCCTACCCAAAACCCCAGG - Intergenic
1178986101 21:37304496-37304518 GAATGCCTAATCCACAGACAAGG - Intergenic
956832983 3:73071813-73071835 AAATGAATACTCAAAACACCTGG - Intergenic
960453757 3:117843828-117843850 GTGTGCCTATACAACACACCTGG + Intergenic
961511177 3:127404709-127404731 GAATGCCTGGGCAAGACACCTGG + Intergenic
965402599 3:168230895-168230917 GAATGCCCACACAAGCCACCTGG + Intergenic
965780759 3:172283464-172283486 GATCACCTACTCAACACACAAGG - Intronic
968895776 4:3402298-3402320 AAAGGCCTACTCTACACATCAGG - Intronic
973676533 4:53268835-53268857 GGATGCCTCCTCACCTCACCTGG - Intronic
974725425 4:65793070-65793092 GTTTGTCTACTCTACACACCTGG - Intergenic
984591119 4:181618856-181618878 GAATGCCAACTCAACAAAGTGGG + Intergenic
990845588 5:60134863-60134885 GAATGCCTTCTCAGTACACTTGG - Intronic
992791002 5:80213613-80213635 GAATGCTTACTGTACACACAGGG - Intronic
997003082 5:129785067-129785089 CAATGTCTACTCAACACCCAAGG - Intergenic
1007187312 6:39983250-39983272 TAATTTCTACTCAACACACAAGG - Intergenic
1012001671 6:93662462-93662484 GAATACCTACTCACCTCAACTGG + Intergenic
1015567525 6:134588776-134588798 GAAAGCTTACTCAACACTGCAGG + Intergenic
1020225120 7:6273421-6273443 GAATCCCGATTCAACACACCTGG + Intergenic
1025142711 7:56479133-56479155 GAATCTCTGCTCCACACACCAGG - Intergenic
1025708763 7:63889733-63889755 GAATCTCTGCTCCACACACCAGG - Intergenic
1026732319 7:72922969-72922991 GACTCCCTACTCAAGAAACCTGG - Intronic
1027111659 7:75444392-75444414 GACTCCCTACTCAAGAAACCTGG + Intronic
1027283888 7:76628923-76628945 GACTCCCTACTCAAGAAACCTGG + Intergenic
1028260094 7:88653388-88653410 GAATGCATAATAATCACACCAGG - Intergenic
1030087936 7:105833045-105833067 TAATGGCTTCTCACCACACCAGG + Intronic
1042298974 8:67254948-67254970 GAATGCTTAAAAAACACACCAGG + Intronic
1047517857 8:125570463-125570485 CAAGTCCTACTTAACACACCTGG + Intergenic
1048554780 8:135464301-135464323 GAATGCCTACTGAAGACTGCCGG - Intronic
1049804650 8:144533430-144533452 GAATTCCTGCCCCACACACCTGG + Intronic
1052333834 9:27299632-27299654 GACTCCCTACTGAACACACCTGG + Intergenic
1056424633 9:86464664-86464686 GAATGGGTACTCAACACACAAGG + Intergenic
1060008137 9:120018584-120018606 GAATGCATACTCTAGGCACCAGG - Intergenic
1186072381 X:5836083-5836105 CAATGTCTTCTCAGCACACCTGG + Intergenic
1193759491 X:85446768-85446790 GAATTCATAGTCAGCACACCTGG - Intergenic