ID: 934919312

View in Genome Browser
Species Human (GRCh38)
Location 2:98330115-98330137
Sequence AGTCACCATCTTCCAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934919303_934919312 28 Left 934919303 2:98330064-98330086 CCCTACAACATCTGGGACTGCTG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 212
934919304_934919312 27 Left 934919304 2:98330065-98330087 CCTACAACATCTGGGACTGCTGC 0: 1
1: 0
2: 1
3: 18
4: 621
Right 934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 212
934919308_934919312 -10 Left 934919308 2:98330102-98330124 CCTGGCACATTAGAGTCACCATC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934919312 Original CRISPR AGTCACCATCTTCCAAGGGA GGG Intergenic
902140426 1:14349245-14349267 AGTCCTCATCCTCCAAGGCAGGG - Intergenic
902562461 1:17286243-17286265 AGTCAACATCTTGGAAGGGCTGG + Intergenic
902882053 1:19378607-19378629 TGGCCCCATCCTCCAAGGGAGGG + Exonic
903975299 1:27145870-27145892 AGTCAGCATGATCCCAGGGAAGG + Intronic
904328978 1:29745590-29745612 AGTTACAAACTTCCAGGGGAAGG + Intergenic
904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG + Intronic
904983167 1:34523745-34523767 AGTCTCCATCTTCCACTGCAGGG + Intergenic
904988988 1:34576289-34576311 AGTCACCATCTCACATGGGAAGG + Intergenic
905110378 1:35590379-35590401 AGGCACCAACCTCCAGGGGAGGG - Intronic
905201501 1:36319904-36319926 AGTCACCATCTTCTCTGGGGTGG - Exonic
905999147 1:42408757-42408779 TGTCACCATCTTACAAGGACTGG - Intronic
906009387 1:42509515-42509537 AGTCACCATTTTACAATGGTGGG + Intronic
906540656 1:46583288-46583310 TGTCACCATCTGCGATGGGAAGG + Exonic
908452447 1:64269380-64269402 AGTAAACATCTTCCTTGGGAGGG - Intergenic
910100541 1:83570804-83570826 AGTCACCATCTTGGAAGCCAGGG - Intergenic
915425412 1:155822330-155822352 TGGCACCATCCTCCAAGGTACGG + Exonic
916169656 1:161992030-161992052 TGGCACCTTCTTCCAATGGATGG + Intronic
917160282 1:172049726-172049748 AGTAACCATCTATAAAGGGAAGG - Intronic
918057438 1:181034264-181034286 TGTCACCACCTTCTGAGGGAGGG + Intronic
919212711 1:194509433-194509455 AATCCCCATGTTTCAAGGGAGGG + Intergenic
920503263 1:206498872-206498894 AGTCACCATCCTCACAGGGGAGG + Intergenic
1066243797 10:33562636-33562658 AGTCTCCATCTTCTAAGTGGGGG - Intergenic
1066619639 10:37332351-37332373 AGTGCCCATCATCCAAGGAACGG + Intronic
1068846742 10:61684788-61684810 TGACTCCATCTTCCAGGGGAAGG + Intronic
1069112382 10:64463914-64463936 AATCCCCATATTTCAAGGGAGGG - Intergenic
1072715398 10:97749088-97749110 AGTCCCCATCTTACACGGGAAGG + Intronic
1072997328 10:100256981-100257003 AGGCAGCAACTTCCAAGTGAAGG + Intronic
1073901506 10:108227549-108227571 AGTATCCATCATTCAAGGGAAGG - Intergenic
1079190036 11:18269630-18269652 ATTCTCCCTGTTCCAAGGGAGGG - Intronic
1079553229 11:21727185-21727207 AGTCCCCCTCCTCCCAGGGAGGG - Intergenic
1079683739 11:23330649-23330671 AGTCAAAATGTTCCAAGTGAAGG - Intergenic
1080224318 11:29943506-29943528 AGACACCATCTGCCCAAGGAAGG - Intergenic
1083852856 11:65378066-65378088 AGGCCCCATCTCCCAAGGGATGG - Intronic
1087644899 11:100797309-100797331 TGGCAACTTCTTCCAAGGGAAGG - Intronic
1089219752 11:116860759-116860781 AGTCCCCATGTGTCAAGGGAGGG + Intronic
1093221842 12:16430899-16430921 TGGCACCATCTTCCAACAGAAGG + Intronic
1098785719 12:74751875-74751897 TGGCATCTTCTTCCAAGGGAAGG - Intergenic
1101203042 12:102456805-102456827 AGTCCCCACGTTCCAAAGGAAGG + Intronic
1103362692 12:120363127-120363149 AGTCACCATCTGTTAGGGGAGGG + Exonic
1104534015 12:129601019-129601041 AGGCACCTTCTTCCAATAGAAGG + Intronic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1110724062 13:78799123-78799145 AGACATCTTCTTCCAAGAGAAGG + Intergenic
1110970489 13:81754782-81754804 AATCCCCATGTTTCAAGGGAGGG + Intergenic
1111233793 13:85381083-85381105 AGTCAGCATCCGCCAATGGAAGG + Intergenic
1111635497 13:90898301-90898323 AATCCCCATATGCCAAGGGAGGG + Intergenic
1111924148 13:94445231-94445253 ACTCACCAAGTTTCAAGGGAAGG - Intronic
1112382478 13:98905429-98905451 AGAAACCACCTCCCAAGGGAAGG + Intronic
1112399588 13:99064208-99064230 AGTCCCCATTTTCTATGGGATGG + Intronic
1115764894 14:36613619-36613641 AGACAACATCTTCCAAAGTAAGG + Intergenic
1116781242 14:49240328-49240350 AGTCACACTCTCCCTAGGGAGGG - Intergenic
1119650479 14:76379543-76379565 AGTCTCGGTTTTCCAAGGGAGGG + Intronic
1119763781 14:77175117-77175139 AGACACCAACTCCCAGGGGAAGG + Intronic
1120877089 14:89384996-89385018 AGTCGGCATCTTACCAGGGAAGG + Intronic
1126466232 15:48963612-48963634 AGACAAGATCTTCCAAGAGAGGG - Intergenic
1128307048 15:66605514-66605536 AGTCACCAGCTGCCAGAGGATGG - Intronic
1129124880 15:73430998-73431020 AGCCACCATCCTTCAAAGGATGG - Intergenic
1129236360 15:74225951-74225973 ATTCTCCATCTTCCCTGGGACGG - Intergenic
1131149369 15:90037266-90037288 AGGGACTTTCTTCCAAGGGAAGG - Intronic
1132024489 15:98393170-98393192 AGTCACCACCGGCCCAGGGAAGG + Intergenic
1132305330 15:100807812-100807834 ACTCACCTTCTGCCCAGGGAGGG + Intergenic
1132650045 16:1016621-1016643 AGTCACCATTTTAAAATGGACGG + Intergenic
1134457711 16:14406776-14406798 AGTCACCATCAGCCAGGAGATGG - Intergenic
1139139151 16:64240115-64240137 AATCCCCATCTGTCAAGGGAGGG + Intergenic
1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG + Intronic
1146368790 17:32251010-32251032 TGTGACCATTTCCCAAGGGAAGG + Intronic
1151869479 17:76826771-76826793 ATTCACCAGCTTCCAGGAGATGG + Intergenic
1152555728 17:81052301-81052323 AGCCAACATCTCCCGAGGGAAGG - Intronic
1154141172 18:11826155-11826177 ACTCACCATCCCCCATGGGATGG + Intronic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1156079006 18:33312854-33312876 AGTGACCATCTTCAGATGGAAGG - Intronic
1157088205 18:44604191-44604213 AGTCAGTTTCTTCCAGGGGAAGG - Intergenic
1157197155 18:45628946-45628968 AGTCCACATCTTGCAAGTGAGGG + Intronic
1159767709 18:72509976-72509998 GGTTACCATGTTCCAAGGCAGGG + Intergenic
1160067971 18:75595019-75595041 AATCCCCATGTTTCAAGGGAGGG - Intergenic
1162825646 19:13249914-13249936 GGTCACTCTCTTCAAAGGGATGG + Intronic
1164215744 19:23144972-23144994 AGTCACTATGTTACAATGGAGGG + Intronic
1167851052 19:52202276-52202298 AGTCACCAGCTTCCAACTGTTGG - Intronic
1168252919 19:55150815-55150837 AGTCAGCATCTGGCAATGGATGG - Intergenic
1168493658 19:56832651-56832673 GGTCACCAACTTCAAGGGGAGGG + Intronic
925081067 2:1067440-1067462 ATTCACAATCTTCCATGGAAAGG + Intronic
925094194 2:1182122-1182144 AGGCACCATCTCCCAAGGCGAGG - Intronic
926465250 2:13178632-13178654 AGTCCCCATGTTTCAAGGGTGGG - Intergenic
927336223 2:21927889-21927911 AATCACCACCTGTCAAGGGAGGG + Intergenic
930164074 2:48186502-48186524 ATTCACCAGCTAACAAGGGAAGG + Intergenic
930859598 2:56056682-56056704 TGTCACCTTCTTCCTAGAGAAGG + Intergenic
931083650 2:58804413-58804435 AGTCCCCATCTATCATGGGAGGG - Intergenic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
934663720 2:96156408-96156430 GTTCACCATCTTCCAGGGGCTGG + Intergenic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
936345115 2:111669835-111669857 ACTCACCATAAACCAAGGGAGGG + Intergenic
936835163 2:116700838-116700860 AGTCACCATCAACCCAGGCAGGG - Intergenic
937742251 2:125368939-125368961 AGTCCCCATGTGTCAAGGGAGGG - Intergenic
940867985 2:158836153-158836175 TGTCACCATGATCCAAGAGAAGG + Intronic
941191776 2:162393179-162393201 AGTCACCATCTGCAGAGGCATGG + Intronic
942381972 2:175401079-175401101 AGGCACCTTCTTCCCAGGGCGGG + Intergenic
943924748 2:193759762-193759784 ATTCACCATGTTTCAAGGAAGGG - Intergenic
944132081 2:196357634-196357656 AATCCCCATGTGCCAAGGGAAGG + Intronic
944542274 2:200765630-200765652 AGACACCAGCTTCAAATGGAGGG + Intergenic
946153453 2:217791454-217791476 AGTCCCCCTCTTTCATGGGAAGG - Intergenic
947172252 2:227323547-227323569 AGTCTCCATTTTTCTAGGGAAGG - Intergenic
947336214 2:229087419-229087441 AGTCACTATCTCCCAAGGGTAGG - Intronic
947341404 2:229143662-229143684 AATCACCATGTGTCAAGGGAGGG + Intronic
947917389 2:233842017-233842039 TGTCATCATCTTCAAAGGGCTGG + Exonic
948774450 2:240275961-240275983 AATCCCCATGTGCCAAGGGAGGG + Intergenic
1169236235 20:3932123-3932145 AGCCACCATTTTCCATGGAATGG - Exonic
1169603455 20:7289099-7289121 AGTCACCATCTTCCAAGCATTGG + Intergenic
1169976794 20:11338259-11338281 TTACACCATCTTCCAGGGGATGG - Intergenic
1170735291 20:19008963-19008985 AGGCACCATCTCACAAGAGATGG - Intergenic
1172482594 20:35279739-35279761 AGTCCCCGCCTGCCAAGGGATGG + Exonic
1173233062 20:41217521-41217543 GGTCAGCATTTTCCAAAGGAAGG - Intronic
1173321361 20:41990118-41990140 AGTCACCATTTTGCAAGGAGGGG + Intergenic
1174729693 20:52903577-52903599 AATCTCCATCTGTCAAGGGAGGG - Intergenic
1175192496 20:57220994-57221016 AGCCCACATCTTCAAAGGGAAGG + Intronic
1175720068 20:61280442-61280464 GGGCACCGTCTTCCAAGGCAGGG - Intronic
1175772967 20:61635385-61635407 AGTCACCATTCTCCCAGGGGCGG - Intronic
1175836300 20:61997473-61997495 AGCCACCCTCTTCTAGGGGACGG - Intronic
1177085512 21:16697838-16697860 TGTAACAATCTTCAAAGGGATGG - Intergenic
1177479342 21:21666633-21666655 TGTCACCACCTTCCAATGTAGGG - Intergenic
1178767643 21:35469269-35469291 AGGCACCATCTTCCACTGAAGGG + Intronic
1179501487 21:41812115-41812137 AGACTCCACCTTCCAAGGGAGGG + Intronic
1179675811 21:42981332-42981354 AGCTACCATCTGCCAAGGGCGGG - Intronic
1180001683 21:44998077-44998099 AGTCCCCATCTTCTGAGGGTGGG + Intergenic
1182661319 22:31927269-31927291 AGTCACCATCTACCTGGGGTGGG + Intergenic
1184052765 22:42020733-42020755 AGTCCCCATCTTACATGAGAGGG + Intronic
1184376720 22:44118157-44118179 AATAACCATCAACCAAGGGATGG + Intronic
1185365615 22:50435335-50435357 AGTCACCAACTACCCCGGGAGGG - Intronic
953273061 3:41465027-41465049 AGTCACCAGCTCCCAAGGGAAGG + Intronic
954432062 3:50476066-50476088 AGGGACCCTCTTCCAAGGGAAGG - Intronic
954974001 3:54675885-54675907 GGACACCATCTTGGAAGGGATGG - Intronic
955164930 3:56501668-56501690 AGTCAATATCTGTCAAGGGAAGG + Intergenic
956710714 3:72036447-72036469 AGACAAACTCTTCCAAGGGAGGG + Intergenic
958537587 3:95424587-95424609 AATCCCCATCTGTCAAGGGAAGG - Intergenic
962891267 3:139675321-139675343 AGTTACCATGCTCAAAGGGATGG + Intronic
964560443 3:157989496-157989518 AATCCCCATGTTCCATGGGAGGG - Intergenic
965121506 3:164564203-164564225 AGTGAGCATCTTCAATGGGAGGG - Intergenic
966384453 3:179380829-179380851 AGTCACTGTCTTCCAAGTGCTGG - Intronic
968530646 4:1089663-1089685 AGTCCCCATGTGTCAAGGGAGGG + Intronic
968691417 4:1992236-1992258 AGTCACCATCTAGGCAGGGACGG + Intronic
970880495 4:20923644-20923666 AGTCACCATAGTCCATGGAAAGG - Intronic
972383651 4:38542700-38542722 TGTCATCTTCTTCCAAGAGAAGG + Intergenic
973187484 4:47347510-47347532 AGTTACTATGTTCCAAGGGTTGG - Intronic
974201746 4:58651228-58651250 AATCACCATCTGTCATGGGAGGG + Intergenic
975460022 4:74640611-74640633 AGTCACTATGTTCCAAGTGTTGG - Intergenic
976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG + Intronic
977673354 4:99720900-99720922 AGTAACCATCTTTAAAGGTATGG + Intergenic
980300247 4:130981926-130981948 AATCTCCATGTGCCAAGGGAAGG - Intergenic
981351653 4:143736917-143736939 AATCCCCATATGCCAAGGGAGGG + Intergenic
981625218 4:146747510-146747532 AGTCTCCATGTTCCCAGGGGTGG - Intronic
981937062 4:150249760-150249782 AGGCACCAACTTCCATGTGAGGG - Intronic
983079348 4:163366065-163366087 AGTCTCCATGTGTCAAGGGAGGG + Intergenic
983843637 4:172488367-172488389 AGACACCATCTTCCCAGGTGAGG - Intronic
986659478 5:10046159-10046181 AGTCATCATCTCCAAAGGGCAGG - Intergenic
988362538 5:30254809-30254831 AGTCCCCATGTGCCATGGGAGGG - Intergenic
989294204 5:39805109-39805131 TGTCACCTTCTTCCAAGTGGAGG - Intergenic
990000895 5:50891462-50891484 AATCCCCATGTTTCAAGGGAGGG - Intergenic
990764402 5:59166143-59166165 AGACACCATTTTCTAAGGGGAGG + Intronic
990943022 5:61222606-61222628 AGTCCCCACGTGCCAAGGGAGGG + Intergenic
992828034 5:80569308-80569330 ACGCACCATTTCCCAAGGGAGGG - Intronic
993481745 5:88432178-88432200 AATCCCCATGTGCCAAGGGAGGG - Intergenic
994898887 5:105744676-105744698 ACTCTCCCTCTTGCAAGGGATGG + Intergenic
996342192 5:122451246-122451268 AGTCTCCATCTTCCAAGCGTAGG + Exonic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1000427353 5:161107371-161107393 ACTAACAATCTTCCAAGAGAAGG + Intergenic
1000699457 5:164430272-164430294 ACTCACCAACCTCCAAAGGATGG - Intergenic
1005196537 6:23293375-23293397 AATCACCATGTGTCAAGGGAAGG - Intergenic
1006245271 6:32728676-32728698 AGACACCTTCTTCCAATAGAAGG - Intergenic
1008631333 6:53365422-53365444 AGTCCCCATATGTCAAGGGAGGG - Intergenic
1008644507 6:53500246-53500268 AGACACCATCATCAATGGGAAGG - Exonic
1009847502 6:69151832-69151854 AGTCCCCATGTGCCATGGGAGGG + Intronic
1010618588 6:78045221-78045243 AGTCCCCATATGTCAAGGGAGGG - Intergenic
1013949141 6:115758406-115758428 AATCCCCATGTGCCAAGGGAGGG + Intergenic
1014611001 6:123546397-123546419 AGTCATCATTTTCTCAGGGAAGG + Intronic
1015764200 6:136698930-136698952 ATTCACCATCTTTCAAGGCTAGG + Intronic
1016845641 6:148565627-148565649 ACTCACCCACTTCTAAGGGATGG + Intergenic
1018920212 6:168167374-168167396 AATCACCATGTGTCAAGGGAGGG - Intergenic
1019523240 7:1469783-1469805 AGGCACCAGCTCCCAGGGGAGGG - Intergenic
1019868682 7:3737541-3737563 TGTCACCATCTGGCCAGGGAGGG - Intronic
1020520510 7:9180233-9180255 ATTCACCATCTTCACATGGATGG - Intergenic
1020670959 7:11111451-11111473 ATTCTTCATCTTCCAAGGTAAGG + Intronic
1020750309 7:12132567-12132589 AATCTCCATCTGCCATGGGAGGG - Intergenic
1022795754 7:33730281-33730303 TGTCAACTTCTTCCAAGGTAGGG - Intergenic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1025096726 7:56101566-56101588 AGTCATTTTCTTCCAAGGTATGG - Exonic
1025221736 7:57116123-57116145 AATCCCCATGTTTCAAGGGAGGG - Intergenic
1025632517 7:63287794-63287816 AATCCCCATGTTTCAAGGGAGGG - Intergenic
1025650043 7:63458436-63458458 AATCCCCATGTTTCAAGGGAGGG + Intergenic
1026290197 7:68999119-68999141 AGTCACCTTCCTCCAAGAGGAGG + Intergenic
1028338870 7:89693383-89693405 AGTCACCAGGATACAAGGGAAGG + Intergenic
1028560019 7:92164984-92165006 AGTCAACATCTTCCTCTGGAAGG - Exonic
1030123523 7:106133663-106133685 AGCCAGCATCTTGCCAGGGAGGG - Intergenic
1030136823 7:106260161-106260183 CGGCACCTTCTTCCAATGGAAGG + Intronic
1030812806 7:113996134-113996156 AGACACCATCTCCAAAAGGAAGG - Intronic
1031860166 7:126970271-126970293 AGACAACATCTTCCAATAGAAGG + Intronic
1031900975 7:127410275-127410297 AGGCACAATGTTGCAAGGGATGG - Intronic
1033279642 7:139996543-139996565 GGGCAGCATCTTCCAGGGGAAGG - Intronic
1035328392 7:158080131-158080153 AGCCACCATGTTCTAAGGGATGG - Intronic
1036388257 8:8301118-8301140 AGGCATCTTCTTCCAAGAGAAGG + Intergenic
1037214156 8:16428032-16428054 AGCCTCCATTTTCCAAGTGATGG - Intronic
1038284224 8:26192344-26192366 GGTCACCATCTTTCAGGGTAGGG + Intergenic
1040016504 8:42704757-42704779 AGACACCATCTCACAATGGATGG - Intronic
1042215598 8:66428029-66428051 AGTTAATATCGTCCAAGGGAGGG - Intergenic
1044851294 8:96431544-96431566 AATCCCCATGTTTCAAGGGAGGG + Intergenic
1048210573 8:132451067-132451089 AATCCCCATGTTCCATGGGAGGG + Intronic
1049418286 8:142505450-142505472 TGTCCCCATCTCCCAGGGGAGGG - Intronic
1053516692 9:38736227-38736249 AGTCACCCCCTTCCAAGGCCTGG - Intergenic
1055395172 9:75866633-75866655 AGTCTCCAATTTCCCAGGGAAGG + Intergenic
1055779603 9:79805678-79805700 AGTCACCATGATCCCATGGACGG - Intergenic
1056060031 9:82875728-82875750 AGTCACTATATTCCAAGTGTTGG - Intergenic
1056116453 9:83446110-83446132 AGTGACCATGTTCTAATGGAAGG - Intronic
1056163421 9:83920767-83920789 AGTCACCTGCCTCCGAGGGAGGG + Intronic
1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG + Intergenic
1056737966 9:89225923-89225945 GGTCACCATTTTCCAGAGGAAGG + Intergenic
1056763484 9:89430489-89430511 AGCCAACATCTTCCCAGGCAGGG + Intronic
1056942085 9:90964676-90964698 AGCCATCATCTCCCAGGGGACGG + Intergenic
1057179272 9:93021191-93021213 AGCCACCATCTCCCAGGGCACGG - Intronic
1059236412 9:112764101-112764123 AGCCACCATCCTCCAAAGCAAGG - Intronic
1060120312 9:120982937-120982959 AGTCATCATTTTACAAAGGAAGG + Intronic
1060144006 9:121235416-121235438 AGCCACTGTCTTCCAAGGGCTGG + Intronic
1060492558 9:124095616-124095638 AGTCACCATCTCCCCAAGGGTGG + Intergenic
1062503749 9:136862411-136862433 CTTCAACATCTTCCCAGGGAAGG + Intronic
1186776872 X:12873641-12873663 AGTCCCCCTCTTCCCAGGGAAGG + Intronic
1190898920 X:54650266-54650288 ATGCACCAGCTGCCAAGGGATGG - Intergenic
1194920919 X:99762310-99762332 TGTCACCATCTTCCTTGTGAAGG - Intergenic
1195006728 X:100692578-100692600 AGTTCTCATCTTTCAAGGGAAGG + Intronic
1200527576 Y:4293973-4293995 TGTCATCATCTTCCAACAGAAGG - Intergenic
1201676083 Y:16585985-16586007 AGTCCCCATCCTCAAGGGGATGG + Intergenic